Endophytic ascocladium subsp. Subsp. Strain DS1 and application thereof
The microbial preparations made from the endophytic Subspora DS1 strain have solved the problem of controlling potato late blight, achieving both inhibition of the pathogenic oomycetes and promotion of crop growth, demonstrating significant dual effects of disease prevention and growth promotion.
Patent Information
- Application Number
- CN202511370811.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-24
- Publication Date
- 2025-12-05
AI Technical Summary
Existing technologies are insufficient to effectively control potato late blight, and resistant varieties are prone to losing resistance during long-term dynamic evolution, necessitating new control methods.
Microbial preparations containing mycelia, secreted proteins, and secondary metabolites, using the endophytic Subspora DS1 strain and its preparations, are used to promote crop growth and control crop diseases.
It significantly inhibits the growth of pathogenic oomycetes such as Phytophthora, preventing potato late blight, while promoting the growth of both potatoes and wheat, exhibiting both broad-spectrum inhibitory activity and growth-promoting functions.
Smart Images
Figure CN121064973A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of agricultural microorganisms, and particularly relates to an endophytic Didymella senecionicola strain DS1 and application thereof. BACKGROUND
[0002] Potato is the fourth largest food crop in the world after rice, wheat and corn, and the tubers can be used for food. The safe production of potato is threatened by a variety of pathogenic organisms, such as bacteria, fungi and oomycete pathogens. Among them, potato late blight caused by the pathogenic Phytophthora infestans is one of the most devastating diseases in potato production.
[0003] Using disease-resistant varieties to control plant diseases is one of the most economical and effective ways. However, in the long-term dynamic evolution process of plants and pathogens, the pathogen population may continuously produce new toxic populations or change the population structure, thereby overcoming the disease resistance of crops, leading to the loss of disease resistance of crop varieties. In recent years, beneficial microorganisms have attracted widespread attention due to their ecological friendliness, strong persistence and wide application range in disease control.
[0004] Endophyte refers to fungi or bacteria that exist in the internal tissues of plants at all or some stages of their life history without causing obvious disease symptoms in host plants. Endophytes have great potential in promoting the growth and development of host plants and improving the stress resistance of host plants, and have become an important source of microbial fertilizers, plant growth regulators and biocontrol agents in agricultural ecosystems. SUMMARY
[0005] The purpose of the present application is to provide an endophytic Didymella senecionicola strain DS1 and application thereof. The strain exhibits broad-spectrum inhibitory activity against crop diseases, and the microbial preparation prepared using the strain can significantly promote the growth of potatoes and control potato late blight.
[0006] The purpose of the present application is achieved by the following technical solutions:
[0007] In a first aspect, the present application claims a strain of endophytic Didymella senecionicola DS1, which is classified and named as Didymella senecionicola, preserved in the China General Microbiological Culture Collection Center (CGMCC) on December 6, 2024, with the preservation number CGMCC NO.41761 and the preservation address being No.3, Yuan 1, Beichen West Road, Chaoyang District, Beijing, China Institute of Microbiology, Chinese Academy of Sciences.
[0008] In a second aspect, the present application claims at least one of the following (a1) and (a2) applications of the above-mentioned endophytic Didymella senecionicola strain DS1:
[0009] (a1) promoting crop growth and / or inhibiting crop pathogenic fungi;
[0010] (a2) preparing a microbial preparation for promoting crop growth and / or preventing crop diseases.
[0011] In a third aspect, the present application claims a microbial preparation comprising or being mycelium, secreted protein or secondary metabolite of the endophytic P. pararoseum strain DS1.
[0012] Further, the microbial preparation is at least one of the following (b1)-(b3):
[0013] (b1) a microbial preparation 1 comprising mycelium of the endophytic P. pararoseum strain DS1;
[0014] (b2) a microbial preparation 2 comprising secreted protein of the endophytic P. pararoseum strain DS1;
[0015] (b3) a microbial preparation 3 comprising secondary metabolite of the endophytic P. pararoseum strain DS1.
[0016] Further, the microbial preparation 1 is obtained by the following method: (c1) inoculating the endophytic P. pararoseum strain DS1 into PDA plate medium for culture to obtain mycelium;
[0017] (c2) cutting the mycelium obtained in step (c1) into mycelium blocks, adding PDB medium for fermentation culture to obtain mycelium suspension; (c3) adding the mycelium suspension into bran, rice husk and rice bran mixed substrate at an addition ratio of 10%, sealing and culturing in dark conditions for 1 week to obtain a solid microbial agent, i.e. the microbial preparation 1.
[0018] Further, the microbial preparation 2 is obtained by the following method: (d1) obtaining mycelium suspension by the method of steps (c1) and (c2) above; (d2) removing mycelium in the mycelium suspension by filtration to collect fermentation liquor; (d3) slowly adding ammonium sulfate into the fermentation liquor to precipitate protein to obtain secreted protein of the endophytic P. pararoseum strain DS1, i.e. the microbial preparation 2.
[0019] Further, the microbial preparation 3 is obtained by the following method: (e1) obtaining a mycelium suspension by the method of steps (c1) and (c2) above; (e2) removing the mycelium in the mycelium suspension by filtration to collect a fermentation liquor; (e3) adding an equal volume of dichloromethane to the fermentation liquor to perform extraction, and collecting an organic phase; (e4) concentrating the organic phase under reduced pressure, and eluting the product with methanol; and (e5) blowing dry the methanol to obtain the secondary metabolite of the endophytic Paraconiothyrium sp. strain DS1, i.e. the microbial preparation 3.
[0020] In a fourth aspect, the present application claims the use of the microbial preparation in at least one of the following (f1)-(f4):
[0021] (f1) promoting crop growth;
[0022] (f2) inhibiting crop pathogenic bacteria;
[0023] (f3) inducing crop resistance;
[0024] (f4) preventing crop diseases.
[0025] In the technical solution of the present application, the crop pathogenic bacteria are at least one of pathogenic oomycetes and pathogenic bacteria;
[0026] The pathogenic oomycetes are at least one of Phytophthora infestans, Phytophthora sojae, Phytophthora capsici and Phytophthora parasitica;
[0027] The pathogenic bacteria are at least one of Pectobacterium carotovorum and Streptomyces;
[0028] The crop diseases are caused by at least one of the pathogenic oomycetes and pathogenic bacteria.
[0029] In the specific embodiment of the present application, the crop pathogenic bacteria are Phytophthora infestans, and the crop diseases are potato late blight caused by Phytophthora infestans.
[0030] In the technical solution of the present application, the crops are potato, tobacco and wheat.
[0031] The present application has the following beneficial effects:
[0032] The endophytic Paraconiothyrium sp. strain DS1 obtained by screening has a broad-spectrum inhibitory activity on plant diseases, especially a significant inhibitory effect on pathogenic oomycetes such as Phytophthora infestans, Phytophthora sojae and Phytophthora capsici, and can effectively prevent potato late blight caused by Phytophthora infestans.
[0033] When the microorganism preparation 2 prepared by the strain DS1 is used to treat potato, the disease resistance of the plant can be activated, thereby effectively inhibiting the infection of the pathogenic Phytophthora. The microorganism preparation 3 prepared by the strain DS1 can not only significantly inhibit the growth of the above-mentioned pathogenic oomycetes, but also inhibit the reproduction of the pathogenic bacteria of potato scab, and has a good effect in preventing and treating potato late blight. In addition, the microorganism preparation 1 containing the strain DS1 not only can effectively prevent and treat potato late blight when applied to crops, but also can significantly promote the growth of potato and wheat. Therefore, the strain DS1 of the genus Aschersonia and the microorganism preparation prepared therefrom provided by the present application have the dual functions of disease prevention and growth promotion, and have a wide application prospect. BRIEF DESCRIPTION OF DRAWINGS
[0034] Figure 1 The figure is the confrontation result of the strain DS1 in Example 1 and different races of pathogenic Phytophthora.
[0035] Figure 2 The figure is the confrontation result of the strain DS1 in Example 1 and different pathogenic oomycetes, in which L13 and L45 are other biocontrol bacteria controls.
[0036] Figure 3 The figure is the phylogenetic tree of the strain DS1 in Example 1.
[0037] Figure 4 The figure is the influence of the microorganism preparation 1 prepared by the strain DS1 in Example 2 on potato late blight caused by pathogenic Phytophthora.
[0038] Figure 5 The figure is the hypersensitive reaction of Nicotiana benthamiana caused by the microorganism preparation 2 prepared by the strain DS1 in Example 3.
[0039] Figure 6 The figure is the antibacterial effect of the microorganism preparation 2 prepared by the strain DS1 in Example 5 on pathogenic oomycetes and pathogenic bacteria.
[0040] Figure 7 The figure is the influence of the microorganism preparation 2 and the microorganism preparation 3 prepared by the strain DS1 in Example 4 and Example 6 on potato late blight caused by pathogenic Phytophthora.
[0041] Figure 8 The figure is the growth-promoting effect of the microorganism preparation 1 prepared by the strain DS1 in Example 7 on different crops. DETAILED DESCRIPTION
[0042] In order to make the purpose and advantages of the present application clearer, the present application will be described in detail in conjunction with the following examples. The following examples are only used to make the technical solutions and contents of the present application clearer, and cannot limit the protection scope of the present application. Any modification, equivalent replacement and improvement made according to the principle of the present application shall be included in the protection scope of the present application.
[0043] The culture medium involved in the examples is as follows:
[0044] PDA flat plate culture medium: 200 g of potatoes were peeled and cut into small pieces, boiled in deionized water for 15 min, filtered through four layers of gauze, 20 g of glucose was added, the volume was made up to 1 L, 15 g of agar powder was added, and sterilized at 115 ℃ for 25 min.
[0045] PDB culture medium: 200 g of potatoes were peeled and cut into small pieces, boiled in deionized water for 15 min, filtered through four layers of gauze, 20 g of glucose was added, the volume was made up to 1 L, and sterilized at 115 ℃ for 25 min.
[0046] Screening and identification of endophytic strain DS1 of Paraconiothyrium miniosum in Example 1
[0047] 1. Isolation of potential biocontrol endophytic fungi:
[0048] 1.1, Obtain test materials: collect healthy potato plant leaves from the field where the late blight occurs every year as isolation materials.
[0049] 1.2, Isolation and culture of potato leaf endophytic fungi: cut the leaves into small pieces of about 2 mm × 2 mm, sequentially surface-sterilize with 75% ethanol and 2% sodium hypochlorite solution, then rinse with sterile water for 5 times, and finally dry with sterile absorbent paper. 4-5 pieces of sterilized tissue pieces were inoculated on PDA flat plate culture medium containing ampicillin (50 ng / mL) and kanamycin (50 ng / mL), and cultured at 25 ℃ in the dark for 3-5 days. After the mycelium grew out of the edge of the tissue pieces, the newly grown mycelium was picked and transferred to a new PDA flat plate for multiple purification culture to obtain the test endophytic fungi.
[0050] 2. Plate confrontation screening of biocontrol endophytic fungi:
[0051] The plate confrontation method was used to inoculate endophytic fungi and pathogenic oomycetes at a distance of about 1 cm from the edge on both sides of the culture medium. The confrontation plate of P. infestans was cultured at 18 ℃ in the dark, and the confrontation plates of other pathogenic oomycetes were cultured at 25 ℃ in the dark. By observing and counting the growth of the pathogenic fungi, the endophytic fungus DS1 with significant antagonistic effect was screened. From Figure 1It can be seen that the inhibitory effect of DS1 on different races of P. infestans, Figure 2 It is shown that DS1 can significantly inhibit the growth of oomycete pathogens such as P. sojae, P. capsici, P. parasitica and P. allii.
[0052] 3. Identification of strain DS1
[0053] 3.1 Strain DS1 was inoculated into PDB medium and cultured at 25°C in the dark with 220 rpm shaking for 3 days. The mycelium obtained by culturing was collected, the culture solution was removed by filtration, and the genomic DNA of strain DS1 was extracted using a genomic DNA rapid extraction kit provided by Tian Gen Biochemical Technology (Beijing) Co., Ltd.
[0054] 3.2 The ITS, β-tubulin and LSU genes of strain DS1 were amplified respectively using the extracted DNA as a template. DNA amplification was performed in a 25 μL system, including 12.5 μL 2x PCR Mix, 1 μL of forward primer / reverse primer (the primer sequences are shown in Table 1), 1 μL of template DNA, and 9.5 μL of ddH2O. The PCR conditions were as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 30 s, 32 cycles; 72°C, extension for 10 min; 4°C storage.
[0055] Table 1 Primer sequences for amplifying the ITS, β-tubulin and LSU genes of strain DS1
[0056]
[0057] 3.3 After the amplification products were detected by 1% agarose gel electrophoresis, the target bands were recovered and sent to Sheng Wu Bioengineering (Shanghai) Co., Ltd. for sequencing. The sequencing results were as follows: the ITS gene of strain DS1 was represented by SEQ ID NO. 1, the β-tubulin gene was represented by SEQ ID NO. 2, and the LSU gene was represented by SEQ ID NO. 3.
[0058] 3.4 The sequences of SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3 were input into NCBI for comparison, and the comparison results were combined to establish a phylogenetic tree (as shown in Figure 3 From this, it can be inferred that the strain DS1 of the present application is Didymella senecionicola, which is preserved in the China General Microbiological Culture Collection Center.
[0059] Biological material: strain DS1
[0060] Classification name: Didymella senecionicola
[0061] Depositary: China General Microbiological Culture Collection Center (CGMCC)
[0062] Abbreviation of the depositary: CGMCC
[0063] Address: No. 1, Yihuan West Road, Beijing, China
[0064] Date of deposit: December 6, 2024
[0065] Accession number of the collection center: CGMCC NO. 41761.
[0066] Example 2: Effect of microbial inoculant 1 prepared by Didymella senecionicola strain DS1 on potato late blight caused by Phytophthora infestans
[0067] Strain DS1 was prepared into microbial inoculant 1 according to the following method: DS1 was inoculated on PDA medium and cultured at 25°C in the dark for 5 days. The cultured mycelium was cut into mycelial blocks and inoculated into PDB medium. After fermentation at 25°C and 220 rpm for 7 days, DS1 mycelium suspension was obtained. The DS1 mycelium suspension was mixed into solid culture medium (bran: rice chaff: rice hull = 6:3:1, w:w:w, material to water ratio 1:1.2, w:w) at a mass percentage of 10%. After stirring with a glass rod and standing for 1 week in the dark, microbial inoculant 1 was obtained.
[0068] Potato variety "Holland 15" was selected, each stem was about 50 g, and microbial inoculant 1 was mixed with nutrient soil at a ratio of 1:1.5 (v / v) and evenly distributed in a 10 cm diameter flowerpot. Each pot was planted with one potato tuber, and each treatment had 3 replicates. The solid culture medium seed treatment was used as a control. After the potato seedlings emerged, they were grown for 28 days. About 5 mL of P. infestans zoospore suspension with a concentration of 500 cells / μL was sprayed on each pot. Immediately after spraying, a fresh-keeping bag was put on to keep the soil moist for 1 day. After 6 days, the disease index was counted.
[0069] Microbial inoculant 1 prepared by DS1 can significantly inhibit the infection of P. infestans and has obvious prevention and control effect on potato late blight (see Figure 4). The results show that microbial inoculant 1 not only can inhibit the growth of pathogenic oomycetes, but also can be used for effective prevention and control of potato late blight.
[0070] Example 3: Induction of potato resistance by microbial inoculant 2 prepared by Didymella senecionicola strain DS1
[0071] Strain DS1 was made into microbial inoculant 2 following the steps: DS1 was inoculated on PDA medium and incubated at 25°C in dark for 5 days. The mycelium was cut into pieces and inoculated into PDB medium and fermented at 25°C, 220 rpm for 7 days to get the mycelium suspension of DS1. The fermentation broth was collected after removing the mycelium by sterile gauze filtration. Ammonium sulfate was slowly added into the filtered fermentation broth at the ratio of 70 g ammonium sulfate per 100 mL broth. The fermentation broth containing ammonium sulfate was put into the refrigerator at 4°C overnight to precipitate the protein. The fermentation broth after standing was aliquoted into centrifuge tubes and centrifuged at 12000 g for 10 min to collect the precipitated protein. The supernatant was discarded and the protein was dissolved in 10 mM Tris-HCl, 1 mM EDTA (pH 7.5) at the ratio of 1:4 (v / v) to obtain microbial inoculant 2.
[0072] Nicotiana benthamiana was planted in perforated plastic cups with vermiculite. After 4 weeks of growth, leaves were collected and injected with microbial inoculant 2. The blank control was ultrapure water of 10 mM Tris-HCl, 1 mM EDTA (pH 7.5) and the positive control was INF1 protein. The results were observed 5 days after injection. As shown in FIG. 1, microbial inoculant 2 prepared by DS1 can cause strong hypersensitive response in N. benthamiana. Figure 5
[0073] Example 4 Effect of microbial inoculant 2 prepared by Chaetomium subglobosum strain DS1 on the late blight caused by Phytophthora infestans
[0074] Potato variety “Holland 15” was selected, each stem was about 50 g, and was planted in a mixture of vermiculite and nutrient soil at a ratio of 1:1 (v / v). After 8 weeks of germination, leaves were cut and sprayed with microbial inoculant 2. After 24 hours of treatment, the surface water of the leaves was wiped dry, 20 μL of P. infestans zoospore suspension was inoculated on the leaves, and the leaves were placed in a humid inoculation tray and incubated at 18°C for 6 days. The infection results were observed and counted.
[0075] As shown in FIG. 3, microbial inoculant 2 prepared by DS1 can significantly inhibit the infection of P. infestans. Figure 7
[0076] Example 5 Inhibitory activity of microbial inoculant 3 prepared by Chaetomium subglobosum strain DS1 on pathogenic oomycetes and bacteria
[0077] Strain DS1 was made into microbial inoculant 3 according to the following steps: inoculate the strain DS1 into PDA medium, cultivate at 25°C in dark for 5 days, cut the cultivated mycelium into mycelium blocks, inoculate into PDB medium, ferment at 25°C with 220 rpm for 7 days, and obtain the mycelium suspension of DS1. Then filter the mycelium using sterile gauze to remove the mycelium, collect the fermentation liquor. Add equal volume of dichloromethane to the filtered fermentation liquor for extraction, concentrate the dichloromethane organic phase under reduced pressure, then elute the product with methanol, and finally dry the methanol using nitrogen blowing instrument to obtain the secondary metabolites of DS1, i.e. microbial inoculant 3.
[0078] Prepare the microbial inoculant 3 with dimethyl sulfoxide into a mother liquor of 100 mg / mL, add into the medium corresponding to each pathogenic fungus, dilute to a final concentration of 100 μg / mL, and use the medium added with DMSO as blank control. The pathogenic oomycetes are Phytophthora infestans, P. capsici and P. sojae, and the results are observed and counted 5 days after inoculation. The pathogenic bacteria are P. pittosporicola and Streptomyces, and the results are observed and counted 2 days after inoculation. As shown in Figure 6 , the microbial inoculant 3 prepared by DS1 can significantly inhibit the growth of pathogenic oomycetes and pathogenic bacteria.
[0079] Example 6: Prevention and control effect of microbial inoculant 3 prepared by the strain DS1 of Chaetomium subglobosum on potato late blight
[0080] Select potato variety "Holland 15", about 50 g per stem, and plant in mixed soil of vermiculite and nutrient soil at a ratio of 1:1. After 8 weeks of germination, cut the leaves, spray the microbial inoculant 3 on the detached leaves, wipe off the water on the surface of the leaves after 24 hours of treatment, inoculate 20 μL of P. infestans zoospore suspension on the leaves, and place the leaves in a humid inoculation tray, cultivate at 18°C for 6 days, and observe and count the infection results. As shown in Figure 7 , the microbial inoculant 3 prepared by DS1 can significantly inhibit the infection of P. infestans.
[0081] Example 7: Promotion effect of microbial inoculant 1 prepared by the strain DS1 of Chaetomium subglobosum on the growth of different crops
[0082] Select potato variety Holland 15, and cut about 50 g of tubers. Mix the microbial inoculant 1 with nutrient soil at a ratio of 1:1.5 (v / v), fill into a 10 cm diameter flowerpot, plant one potato tuber in each pot, and set 5 replicates for each treatment. After germination, continue to cultivate for 40 days, and count the growth phenotypes of different treatments. As shown in Figure 8 , the microbial inoculant 1 significantly promotes the growth of potato.
[0083] Wheat variety Jimai 22 was selected, and the seeds were disinfected with 5% sodium hypochlorite solution for 10 min, and then washed with sterile water for 3 times. The seeds were soaked in sterile water for 48 h until they were white and rooted. The microbial agent 1 and the nutrient soil were mixed at a ratio of 1:1.5, and then were loaded into perforated plastic cups with a diameter of 10 cm. 15 seeds were uniformly sown in each cup, and a layer of topsoil was covered. 5 replicates were set for each treatment. After 28 days of growth, the growth phenotypes of different treatments were counted. As shown in Figure 8 Figure 1, the microbial agent 1 significantly promoted the growth of wheat.
[0084] SEQ ID NO: 1:
[0085] CTTCCGTAGGGTGAACCTGCGGAAGGATCATTACCTAGAGTTGCGGGCTCTGCCTGCCATCTCTTACCCATGTCTTTTGAGTACCTTACGTTTCCTCGGCGGGTCCGCCCGCCGACTGGACAATTTAAACCACTTGCAGTTGCAATCAGCGTCTGAAAAAACATAATAGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGCCTTGCTTGGTGTTGGGTGTTGTCTCGCCTCTGCGCGCAGACTCGCCTCAAAACAATTGGCAGCCGGCGTATTGATTTCGGAGCGCAGTACATCTCGCGCTTTGCACTCAGAACGACGACGTCCAAAAGTACATTTTTACACTCTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCCGGAGGAA
[0086] SEQ ID NO: 2:
[0087] TGTAACACCTTCAGACCGGTCAATGCGTAAGTACACCACTACAGCCTTCTGCTGTCGACTCTTACTCACAATTGGCAGGGTAACCAAATCGGTGCCGCCTTCTGGCAGACCATCTCTGGCGAGCATGGCCTCGACGGCTCCGGTGTCTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTAGAACTGACACGATGTCCTAAGACGGACTGCGAGTGCTGACCTCTTCTAGGCCTCTGGCAACAAGTTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGATGCTGTTCGCGCTGGCCCCTTCGGCCAGCTCTTCCGTCCTGACAA
[0088] SEQ ID NO: 3:
[0089] ACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTAGGTTTCTACCTAGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCTTTCGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTT.
Claims
1. An endophytic Didymella senecionicola strain DS1, which is classified as Didymella senecionicola, preserved in the China General Microbiological Culture Collection Center (CGMCC) on December 6, 2024, with the preservation number CGMCC NO. 41761, and the address of the preservation center is No. 1, Yitianxili, Chaoyang District, Beijing, China.
2. The endophytic Didymella senecionicola strain DS1 of claim 1 is used in at least one of the following (a1) and (a2): (a1) promoting crop growth and / or inhibiting crop pathogenic bacteria; (a2) preparing a microbial preparation for promoting crop growth and / or preventing crop diseases. The crop pathogenic bacteria are at least one of pathogenic oomycetes and pathogenic bacteria; the pathogenic oomycetes are at least one of Phytophthora infestans, P. sojae, P. capsici, and P. parasitica; the pathogenic bacteria are at least one of Pectobacterium chrysanthemi and Streptomyces; and the crop diseases are caused by at least one of the pathogenic oomycetes and pathogenic bacteria. The microbial preparation comprises or is the mycelium, secreted protein, or secondary metabolite of the endophytic Didymella senecionicola strain DS1 of claim 1.
3. Use according to claim 2, characterized in that, The microbial preparation is at least one of the following (b1)-(b3): (b1) a microbial preparation 1 comprising the mycelium of the endophytic Didymella senecionicola strain DS1; (b2) a microbial preparation 2 comprising the secreted protein of the endophytic Didymella senecionicola strain DS1; (b3) a microbial preparation 3 comprising the secondary metabolite of the endophytic Didymella senecionicola strain DS1.
4. A microbial preparation, characterized in that, The microbial preparation 1 is obtained by the following method: (c1) inoculating the endophytic Didymella senecionicola strain DS1 into PDA plate medium for culture to obtain mycelium; (c2) cutting the mycelium obtained in step (c1) into mycelium blocks, adding PDB medium for fermentation culture to obtain mycelium suspension; and (c3) adding the mycelium suspension into a mixed substrate of bran, rice husk, and rice bran at an addition ratio of 10%, sealing, and culturing in the dark for 1 week to obtain a solid inoculum, i.e., the microbial preparation 1.
5. The microbial preparation according to claim 4, characterized in that, The microbial preparation 2 is obtained by the following method: (d1) obtaining the mycelium suspension by the method of steps (c1) and (c2) in claim 6; (d2) removing the mycelium in the mycelium suspension by filtration to collect the fermentation broth; and (d3) slowly adding ammonium sulfate to the fermentation broth to precipitate the protein to obtain the secreted protein of the endophytic Didymella senecionicola strain DS1, i.e., the microbial preparation 2. 6. The microbial preparation according to claim 5, characterized in that, 7. The microbial preparation according to claim 5, characterized in that, 8. The microbial preparation according to claim 5, characterized in that, The microbial preparation 3 is obtained by the following method: (e1) obtaining mycelium suspension by the method of steps (c1) and (c2) in claim 6; (e2) removing the mycelium in the mycelium suspension by filtration to collect fermentation liquor; (e3) adding equal volume of dichloromethane to the fermentation liquor to extract, and collecting organic phase; (e4) concentrating the organic phase under reduced pressure, and eluting the product with methanol; (e5) blowing dry the methanol to obtain the secondary metabolite of endophytic Paraconiothyrium sp. strain DS1, i.e. the microbial preparation 3.
9. The microbial preparation of any one of claims 4-8 for use in at least one of the following (f1)-(f3): (f1) promoting crop growth; (f2) inhibiting crop pathogenic bacteria; (f3) inducing crop resistance; (f4) preventing and treating crop diseases.
10. Use according to claim 9, characterized in that, The crop pathogenic bacteria are at least one of pathogenic oomycetes and pathogenic bacteria; The pathogenic oomycetes are at least one of Phytophthora infestans, P. sojae, P. capsici and P. parasitica; The pathogenic bacteria are at least one of Pectobacterium chrysanthemi and Streptomyces; The crop diseases are caused by at least one of the pathogenic oomycetes and pathogenic bacteria.
Citation Information
Cited By
Grape endophytic fungus NZ1-b-1 and application thereof in prevention and treatment of grape diseases
CN121427695A