Tetrastigma hemsleyanum C-glycosyltransferase and application thereof

Abstract

The invention discloses a tetrastigma hemsleyanum C-glycosyl transferase and application thereof. The amino acid sequence of the C-glycosyl transferase comprises a sequence as shown in SEQ ID NO. 4. The key enzyme-glycosyltransferase (ThCGT) related to vitexin synthesis in radix tetrastigme is cloned for the first time, and it is verified through in-vitro experiments that the enzyme can efficiently catalyze apigenin C-8 site glycosylation reaction to generate vitexin. Furthermore, according to the invention, a tobacco transient expression system is utilized to confirm that the enzyme can also glycosylate the apigenin C-8 site in a plant body to generate vitexin. Besides, a tobacco stable expression system capable of efficiently generating vitexin is further constructed, and an efficient platform is provided for large-scale production of vitexin, so that the production cost of vitexin is expected to be reduced, the market supply is expected to be improved, and a basis is provided for wide application of vitexin in the fields of medicines, health care products, cosmetics and the like.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of plant biotechnology, and particularly relates to a C-glycosyltransferase of Radix Tetrastigae and use thereof. BACKGROUND

[0002] Mulberrin has multiple pharmacological activities such as antioxidant, antitumor and neuroprotective activities, and particularly performs outstandingly in the field of cancer treatment. As a core carbon glycoside flavonoid component in Radix Tetrastigae, mulberrin is rich in Radix Tetrastigae, and the content of mulberrin in leaves can reach 0.4 mg / g, which is a key index component for quality evaluation and drug development of Radix Tetrastigae. However, at present, there is still a major knowledge gap in the key enzyme genes of the mulberrin biosynthesis pathway. First, the key enzyme genes of the mulberrin biosynthesis pathway in Radix Tetrastigae have not been identified, although the flavone synthase (FNS) and glycosyltransferase (CGT) families have been identified in other plants, the gene sequences of ThFNS and ThCGT in Radix Tetrastigae are still unknown, which makes it difficult to predict the catalytic mechanism and spatiotemporal expression characteristics thereof. Second, the biological characteristics of Radix Tetrastigae limit its industrial application. The plant needs to grow for more than 3 years before it can be used for medicine, and the long growth cycle and low content of secondary metabolites make it difficult for traditional cultivation and extraction mode to meet the market demand, which seriously restricts the industrialization process thereof. SUMMARY

[0003] In view of the problems in the prior art, the present application provides a C-glycosyltransferase of Radix Tetrastigae and use thereof.

[0004] A first aspect of the present application protects a C-glycosyltransferase, which comprises the amino acid sequence shown in SEQ ID No. 4.

[0005] MENSNSKPQAALLSCPGLGHLIPTLELAKRLVTLHGFDVTVFTVAATKSSAESEIIHSVAIPKQLEIVELPQADISHLVDADATLFTRIIIIMREIIPSFRSGISAMRVPPTLLIIDVFGFEALQVAEFDMPKYVYFPSPAWVLSLTLYVPTLDLEVEGEYVDRTEPLHLPGCKAVRAEDVLDPMLDRSNQQYREYVRMGAGLGKSDGVLVNSWEDLEPTTLNALRDKLPVYPIGPLTRSSGRSKCELLDWLDLQSTGSVMYVSFGSGGTLSAQQLTEMAWGLEQSKHRFLWVVRPPQENDSGGAYFTLGKGGDDVSRYLPEVFLRRTRDIGVVVPHWAPQMEILRHPSVGGFLSHCGWNSTLESISNGVPMLAWPLYAEQKMNATLLTDELGIAVKPEVSPSKRVVRREEIEKMVKRVMEDGEMRNRVKELKKSGERALTEGGSSHNSLSQIAKDAETRLMHKPRS (SEQ ID No. 4)

[0006] The application first screens a C-glycosyltransferase gene from the transcriptome sequencing database of Radix tetrastigae, and obtains the full-length sequence of the gene from the cDNA by using PCR technology. A prokaryotic expression vector is constructed, transformed into a host, and the target protein is obtained after IPTG induction.

[0007] The second aspect of the application protects a biological material related to the C-glycosyltransferase as described above, which comprises any one of the following:

[0008] a) a polynucleotide encoding the C-glycosyltransferase as described above;

[0009] b) a recombinant expression vector containing the polynucleotide of a);

[0010] c) a bioengineered bacterium in which the polynucleotide of a) is integrated into the genome, or a bioengineered bacterium containing the recombinant expression vector of b).

[0011] In some embodiments, in b), the starting plasmid of the recombinant expression vector includes but is not limited to pColdII.

[0012] In some embodiments, in c), the bioengineered bacterium includes but is not limited to Escherichia coli, such as BL21 (DE3).

[0013] In some embodiments, in a), the nucleotide sequence of the polynucleotide comprises a sequence as set forth in SEQ ID No. 3.

[0014] >Them14G00421.1

[0015]

[0016] A third aspect of the present application protects the use of the C-glycosyltransferase as described above or the biological material as described above in at least one of the following: 1) promoting the synthesis of vitexin in a plant; 2) increasing the content of vitexin in a plant; 3) increasing the accumulation of vitexin in a plant; 4) breeding a transgenic plant; 5) catalyzing the glycosylation of apigenin at C-8 position.

[0017] A fourth aspect of the present application protects a method of breeding a transgenic plant, introducing the C-glycosyltransferase as described above or the biological material as described above into a plant to obtain a transgenic plant.

[0018] A fifth aspect of the present application protects a method of promoting the synthesis of vitexin in a plant or increasing the content of vitexin in a plant or increasing the accumulation of vitexin in a plant, introducing the C-glycosyltransferase as described above or the biological material as described above into a plant.

[0019] In some embodiments, the plant is a dicotyledonous plant.

[0020] In some certain embodiments, the plant is Gynostemma pentaphyllum.

[0021] A sixth aspect of the present application protects a method of catalyzing the glycosylation of apigenin at C-8 position to vitexin, comprising the step of: catalyzing apigenin by the C-glycosyltransferase as described above or the biological material as described above.

[0022] A seventh aspect of the present application protects a method of preparing vitexin, comprising the step of: catalyzing apigenin by the C-glycosyltransferase as described above or the biological material as described above to obtain vitexin.

[0023] In some certain embodiments, the apigenin is obtained from naringenin catalyzed by a flavone synthase.

[0024] In certain embodiments, the flavone synthase comprises the amino acid sequence set forth in SEQ ID No. 2.

[0025] In some certain embodiments, the flavone synthase comprises the nucleotide sequence set forth in SEQ ID No. 1.

[0026] MAPSTLTALAEEKTLRQSFVRDEDERPKVAYNQFSDDIPVISLAGIDESEGRRSEICRKIVEACEDWGIFQVVDHGVDADLVSEMTRLAREFFAMPAEEKLRFDMSGGKKGGFIVSSHLQGEAVQDWREIVTYFSYPLRTRDYSRWPDKPEGWRAVTEVYSEKLMGVACKLLEVLSEAMDLEKEALTKACVDMDQKVVVNYYPKCPQPDLTLGLKRHTDPGTITLLLQDLVGGLQATRDGGNTWITVQPVEGAFVVNLGDHGHYLSNGRFKNADHQAVVNSECSRLSIATFQNPAPEAVVYPLKIREGEKSVMEEPITFAEMYKRKMSKDLELARLKKLAKQQDDQAQMESNGIDQQMKPKVIDEILA (SEQ ID No. 2)

[0027] >Them08G00403.1

[0028]

[0029] Compared with the prior art, the present application has the following beneficial effects:

[0030] 1) The present application successfully cloned the key enzyme C-glycosyltransferase gene (ThCGT) related to the synthesis of vitexin in Radix Tetrastigme for the first time, which fills the gap in the research on the biosynthesis pathway of vitexin in Radix Tetrastigme at the molecular level, and provides an important theoretical basis for in-depth understanding of the synthesis and regulation mechanism of plant secondary metabolites.

[0031] 2) The present application found that the C-glycosyltransferase gene (ThCGT) precisely mediates the glycosylation of apigenin at C-8 to generate vitexin through in vitro recombinant protein expression and enzymatic reaction system verification, which provides technical support for subsequent metabolic engineering modification of the vitexin synthesis pathway.

[0032] 3) The present application successfully verified that ThCGT specifically catalyzes the glycosylation of apigenin at C-8 to generate vitexin using a tobacco transient expression system, which not only quickly and efficiently confirms the catalytic activity of the enzyme, but also provides a reliable technical means for subsequent functional research of related enzymes.

[0033] 4) The present application constructed an Agrobacterium-mediated tobacco stable genetic transformation system, and realized the complete reconstruction of the “apigenin-vitexin” pathway in Nicotiana benthamiana for the first time. Compared with traditional plant extraction methods, the biosynthesis technology based on stable expression system has the advantages of not being limited by plant growth cycle, not being affected by environmental factors, high production efficiency, stable product quality, etc. It is expected to realize the efficient and stable production of vitexin, and meet the growing demand of the market for vitexin. BRIEF DESCRIPTION OF DRAWINGS

[0034] Figure 1 For cloning of ThFNS and ThCGT genes in Example 1 of the present application.

[0035] Figure 2 For SDS-PAGE verification after purification of the present application.

[0036] Figure 3-1 For LC-MS detection of in vitro recombinant ThFNS protein catalytic products in Example 2 of the present application.

[0037] Figure 3-2 For LC-MS detection of in vitro recombinant CGT protein catalytic products in Example 2 of the present application.

[0038] Figure 4-1 For transient expression FNS tobacco liquid chromatography detection results in Example 3 of the present application.

[0039] Figure 4-2The results of liquid chromatography-mass spectrometry detection of transient expression of CGT in Example 3 of the present application.

[0040] Figure 5 The results of qPCR of overexpression strain in Example 4 of the present application.

[0041] Figure 6-1 The liquid chromatography-mass spectrometry detection chart of stable co-transferred FNS strain in Example 4 of the present application.

[0042] Figure 6-2 The liquid chromatography-mass spectrometry detection chart of stable co-transferred CGT strain in Example 4 of the present application.

[0043] Figure 6-3 The liquid chromatography-mass spectrometry detection chart of stable co-transferred FNS and CGT strain in Example 4 of the present application. DETAILED DESCRIPTION

[0044] The present application will be further described below in conjunction with specific examples. The following examples are only specific embodiments of the present application, and the protection scope of the present application is not limited to this. In the following examples, the experimental methods are conventional methods unless otherwise specified. In the following examples, the test materials used are commercially available from conventional biochemical reagent stores unless otherwise specified.

[0045] Example 1

[0046] In this embodiment, the cloning of C-glycosyltransferase ThCGT and flavonoid synthase ThFNS genes of Tripterygium wilfordii Hook.f. is carried out. It includes the following:

[0047] 1.1 Extraction of total RNA of Tripterygium wilfordii Hook.f. and reverse transcription

[0048] 1) Tripterygium wilfordii Hook.f. was collected from a Tripterygium wilfordii Hook.f. breeding base in Lishui, Zhejiang Province. After the plant was collected, it was successively washed with distilled water and dehydrated on the surface of absorbent paper, and then the leaves of Tripterygium wilfordii Hook.f. were selected as the material for total RNA extraction. The extraction was carried out according to the instructions of the total RNA extraction kit for polysaccharide and polyphenol plants of Tiangen (catalog number: DP441).

[0049] 2) The total RNA of step 1) was prepared according to the system in Table 1, and the temperature was controlled using a PCR instrument, incubated at 50℃ for 5 minutes, and heated at 85℃ for 2 minutes to inactivate the enzyme. The RNA was reversed to cDNA.

[0050] Table 1 cDNA system for reverse transcription of total RNA

[0051] Components Volume Total RNA 5 μL 5x All-in-One Reaction Mix for qPCR 4 μL TransScriprs Uni All-in-One Enzyme Mix 1 μL RNase-free Water 10 μL

[0052] 1.2 Gene cloning

[0053] 1) According to the BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) analysis of the whole genome data of Radix tigridia and the FNS, CGT homologous gene sequences in NCBI, based on the screening results of homologous alignment, the development and verification of target gene amplification primers were completed by using Primer Premier 6.0 bioinformatics tools. The amplification primers are shown in Table 2.

[0054] Table 2 Amplification primers

[0055]

[0056]

[0057] The PCR amplification system was prepared according to Table 3, and the amplification product was obtained.

[0058] Table 3

[0059] Reagents Volume 2x Phanta Max Master Mix (Dye Plus) 25 μL Template cDNA of Step 1.1 2.5 μL Forward primer (10 μM) 1.25 μL Reverse primer (10 μM) 1.25 μL RNase Free ddH2O Up to 50 μL

[0060] The ThFNS and ThCGT genes were obtained by PCR amplification respectively using the reverse-transcribed Radix tigridia cDNA as a template. Figure 1 The sequencing results of the PCR product were compared with the predicted sequence, and the results showed that the sequence was correct.

[0061] 2) The amplification product obtained in step 1) was connected to the cloning vector pCE2TA / Blunt-Zero, and the reaction system was as shown in Table 4, and the TOPO connection product was obtained.

[0062] Table 4 TOPO cloning system

[0063] Components Volume 5x TA or Blunt-Zero Cloning Mix 2 μL PCR amplification product 4 μL ddH2O 1 μL

[0064] The temperature was controlled by using a PCR instrument, and incubated at 24℃ for 5min.

[0065] After the DH5α competent cells were taken out from-80℃ and placed on ice for melting, 10μL TOPO connection product was added and gently mixed, and then continued to be placed on ice for 25min. After 42℃ heat shock for 45s, immediately placed on ice for 2min, added 700μL of anti-LB liquid medium, and recovered at 37℃ with 200rpm for 60min. After centrifugation at 4000rpm for 1min, the supernatant was discarded into the tube, and the remaining 100μL liquid was resuspended and coated on Amp-LB plate at 37℃ for 16h. Under sterile conditions, single colonies were picked and expanded, and positive clones were sent to Genescript for Sanger sequencing.

[0066] Bioinformatics analysis revealed that ThFNS gene has an open reading frame of 1107 bp, encoding a protein containing 368 amino acid residues, with a theoretical molecular weight of 41.5 kDa and an isoelectric point of 5.08. For ThCGT gene, the open reading frame extends to 1404 bp, encoding a polypeptide chain of 467 amino acids, with a calculated molecular weight of 51.9 kDa and an isoelectric point of 5.75.

[0067] The amino acid sequence of flavone synthase ThFNS is SEQ ID No. 2; the nucleotide sequence encoding flavone synthase ThFNS is SEQ ID No. 1.

[0068] The amino acid sequence of C-glycosyltransferase ThCGT is SEQ ID No. 4; the nucleotide sequence encoding C-glycosyltransferase ThCGT is SEQ ID No. 3.

[0069] Example 2

[0070] In this embodiment, pCold II recombinant plasmid is constructed to achieve soluble expression of ThFNS and ThCGT in E. Coil BL21 (DE3); in vitro enzyme activity experiment confirms that ThFNS catalyzes naringenin to generate apigenin, and ThCGT can further catalyze C-8 glycosylation of apigenin to generate vitexin, confirming the cascade function of the two in the synthesis pathway.

[0071] 2.1 Prokaryotic expression vector construction

[0072] 2.1.1 Construction of homologous arm of target gene

[0073] Using pCold II as the vector and Nde I and Xba I as the enzyme cutting sites, pCold II-ThFNS plasmid and pCold II-ThCGT plasmid are constructed. According to the CDS sequence of ThFNS and ThCGT, SnapGene is used to design primers with homologous arms for the target gene, and then PCR reaction is used to add homologous arm sequences to both ends of the gene to obtain the target sequence. The primer sequences are shown in Table 5, and the amplification system is shown in Tables 6 and 7.

[0074] Table 5 Primer sequences

[0075]

[0076] Table 6 ThFNS homologous arm PCR amplification system

[0077] Components Volume 2x Phanta Max Master Mix (Dye Plus) 12.5 μL pColdII-ThFNS-HA-F 1 μL pColdII-ThFNS-HA-R 1 μL ddH2O 8 μL ThFNS fragment 2.5 μL

[0078] Table 7 ThCGT homologous arm PCR amplification system

[0079] Components Volume 2x Phanta Max Master Mix (Dye Plus) 12.5 μL pColdII-ThCGT-HA-F 1 μL pColdII-ThCGT-HA-R 1 μL ddH2O 8 μL ThCGT fragment 2.5 μL

[0080] 2.1.2 Vector linearization and recombination

[0081] pCold II was linearized by double digestion with NdeI / XbaI (37℃ for 2h) to obtain the linearized vector (pColdII(Liner)).

[0082] Then use The Seamless Cloning and Assembly Kit uses homologous recombination to construct the target sequence obtained in step 2.1.1 onto a linearized vector, as shown in Table 8.

[0083] Table 8 Configuration of Homologous Recombination System

[0084] Components Volume 2x Basic Assembly Mix 5 μL pColdII (Liner) 2 μL Inserts of 2.1.1 1 μL Nuclease-free Water 2 μL

[0085] The PCR instrument was used for temperature control at 50℃ for 25 min. The recombinant plasmid was transformed into DH5α, and the positive colonies obtained after screening and identification were used to extract plasmids according to the instructions of the plasmid extraction kit (DP103). Subsequently, the plasmids were transformed into BL21(DE3) for induced expression.

[0086] 2.1.3 IPTG Induction and Protein Collection

[0087] The positive clone BL21(DE3) obtained in step 2.1.2 was revived and cultured overnight with shaking. Then, it was transferred to LB medium containing Amp (100 μg / mL) at a 1% inoculum for expansion culture (37℃, 200 rpm). The bacterial culture was allowed to grow until the OD of the culture was reached. 600 Low-temperature induction was performed when the bacterial culture reached a pH of 0.4–0.5. After incubating the bacterial culture on ice for 30 min, 0.1 mM IPTG was added, and the culture was induced with continuous shaking at 16°C and 200 rpm for 16 h. Subsequently, the bacterial cells were enriched by centrifugation (8000 rpm, 10 min), washed with PBS, and then centrifuged again (8000 rpm, 5 min) to obtain a bacterial cell pellet. The bacterial cells were resuspended in 10% of the initial culture volume of lysis buffer, and 1 mg / mL of protease inhibitor was added to prevent degradation. After incubating on ice for 30 min, the bacterial culture was ultrasonically disrupted (parameters: amplitude bar 25, power 80%, 4°C intermittent operation mode: 10 s disruption / 10 s pause) until the bacterial culture was clear. Finally, the supernatant obtained by low-temperature centrifugation (12000 rpm, 20 min, 4°C) was filtered through a 0.45 μm filter membrane to obtain the filtrate, which was then placed on ice for later use.

[0088] 2.1.4 Purification of the target protein

[0089] Take 5 mL His-tag purification resin, pre-equilibrate five times with lysis buffer. Incubate the filtrate obtained in step 2.1.3 with the equilibrated resin at 4°C for 2 h to complete the binding, and obtain a mixture. Then transfer the mixture to a chromatography column, and circulate the flow-through through the column twice to improve the binding efficiency. Wash the column with an equal volume of wash buffer five times until no protein signal is detected in the eluate by the Bradford method. Finally, elute with half-column volume of elution buffer in ten portions, and collect each elution fraction.

[0090] Pre-cool the protein ultrafiltration tube with ultrapure water (equilibrate on ice for 20 min), remove the soaking solution, and transfer the target eluate to the tube according to the SDS-PAGE screening results. Concentrate at 5000 rpm at 4°C to a final volume of 500 μL. Then add 1 mL of Tris-HCl buffer (50 mM, pH 7.4), and perform three buffer exchanges by low-temperature centrifugation (10 min / time) at 3000 rpm. Finally, remove the concentrated protein solution, aliquot, and store at -80°C for later use.

[0091] Induce the expression of ThFNS-His and ThCGT-His proteins by IPTG, and the SDS-PAGE detection results after purification show that the protein size is consistent with the expected size, as shown in Figure 2 .

[0092] 2.2 LC-MS detection of recombinant protein in vitro enzymatic reaction system

[0093] Accurately weigh the standard substances of apigenin, naringenin, and vitexin using an analytical balance, dissolve them in DMSO, and dilute to 0.1 M stock solution. Establish the enzymatic reaction system according to Table 9.

[0094] Table 9 Reaction system

[0095] Reagents Volume ThFNS or ThCGT protein of Step 2.1.4 20 μL Naringenin or Apigenin 0.5 μL UDP-Glc 2 μL 50 Mm Tris-HCl (pH 7.4) 80 μL

[0096] After 5 h of reaction at 30°C, add 100 μL of methanol to terminate the reaction.

[0097] The LC-MS related parameters are shown in Tables 10 and 11:

[0098] Table 10 Mass spectrometry conditions

[0099] Instrument Model Liquid chromatograph Waters UPLC I-Class / Synapt G2s Column CORTECS@ UPLC T3 1.6 μm 2.1x150mm Column Mobile phase ratio 0.1% formic acid in water: acetonitrile gradient see Table 3.9 Flow rate 0.3 mL / min Injection volume Calibration 0.1 μL; sample 0.2 μL Ionization mode ESI negative Scan mode Full information scan, including parent / daughter ions; 50-1000 Da Ion source temperature 80℃ Capillary voltage 2.5 kv Conical hole voltage 40v

[0100] Table 11 Liquid chromatography conditions

[0101] Time 0.1% formic acid water Acetonitrile 0 min 90％ 10％ 1 min 10％ 10％ 5 min 5％ 95％ 9 min 5％ 95％ 9.5 min 90％ 10％ 11 min 90％ 10％

[0102] In vitro, the obtained recombinant enzyme was functionally verified by reacting with naringenin and apigenin as substrates, respectively. The results are shown in Figure 3-1 andFigure 3-2 . Wherein, Figure 3-1 , A is the liquid chromatography detection results of FNS in vitro reaction solution and apigenin standard, Y axis is relative intensity (%); B is the mass spectrum of apigenin standard 792, Y axis is relative intensity (%); C is the mass spectrum of DACHANG-FNS 790, Y axis is relative intensity (%). Wherein, Figure 3-2 , A is the liquid chromatography detection results of CGT in vitro reaction solution and vitexin standard, Y axis is relative intensity (%); B is the mass spectrum of DACHANG-GCT516, Y axis is relative intensity (%); C is the mass spectrum of vitexin standard M578, Y axis is relative intensity (%).

[0103] From Figure 3-1 it can be seen that LC shows that the relative response intensity of FNS in vitro reaction solution is consistent with the relative intensity of apigenin standard, indicating that FNS can catalyze the synthesis of apigenin (A figure); MS shows that the mass spectrum of FNS in vitro reaction solution (C figure) has mass-to-charge ratio values such as 269.039, 270.043, 539.088, which are very close to the values in figure B, indicating that the two samples may contain similar compounds or molecular fragments, indicating that FNS can catalyze the synthesis of apigenin. The results of LC-MS show that the recombinant ThFNS protein constructed in vitro can catalyze naringenin to generate apigenin.

[0104] From Figure 3-2 it can be seen that LC shows that the relative response intensity of CGT in vitro reaction solution is consistent with the relative intensity of vitexin standard, indicating that CGT can catalyze the synthesis of vitexin (A figure); MS shows that the mass spectrum of CGT in vitro reaction solution (C figure) has mass-to-charge ratio values such as 431.088, 432.094, which are very close to the values in figure B, indicating that the two samples may contain similar compounds or molecular fragments, indicating that FNS can catalyze the synthesis of apigenin. The results of LC-MS show that the recombinant ThCGT protein constructed in vitro can catalyze apigenin to generate vitexin.

[0105] Example 3

[0106] Although the in vitro enzyme activity experiment has confirmed the catalytic activity of the two, its functional synergy in plant cells, substrate specificity and subcellular localization characteristics still need to be verified by in vivo system. In this study, pCambia1301-ThFNS and pCambia1301-ThCGT recombinant vectors were constructed, and the target gene was expressed efficiently in Nicotiana benthamiana leaves using Agrobacterium GV3101-mediated transient expression system. Combined with exogenous substrate (naringenin or apigenin) injection and LC-MS analysis, the cascade catalytic function of ThFNS and ThCGT was systematically analyzed.

[0107] 3.1 Seedling and germination regulation

[0108] Nicotiana benthamiana was evenly sown using the five-point sowing method and placed in a light and temperature controlled incubator (25℃ / 18℃ diurnal rhythm) for germination induction. Cotyledon unfolding was observed 3-4 days after sowing, and the seedling stage began on the 5th day. During the seedling stage, the light intensity was 8000-10000 lux (LED full spectrum); the photoperiod was 14h light / 10h dark; temperature and humidity: daytime 25±1℃ / 70% relative humidity, nighttime 18±1℃ / 60% relative humidity; and general plant nutrient solution was applied every other day.

[0109] When seedlings reach the 4-5 true leaf stage (approximately 14 days), gently grasp the root collar junction with blunt-tipped tweezers and transplant them, along with the original substrate block, into 10×10cm nutrient pots filled with sterilized substrate. Maintain substrate moisture content >70% for 48 hours after transplanting, then gradually transition to routine management. All plants were cultured in an artificial climate chamber at 23±1℃ for 2-3 weeks, entering the experimental treatment stage when they had 6-8 unfolded leaves.

[0110] 3.2 Construction and Validation of Recombinant Vectors

[0111] Based on the coding region sequences of ThFNS and ThCGT, homologous recombination primers were designed using Primer Premier 6.0 software (Table 12).

[0112] Table 12 Primer sequences

[0113]

[0114] Using ThFNS and ThCGT as templates, PCR amplification was performed according to the primers in Table 11 to obtain the amplification products.

[0115] pCambia1301 (purchased from Beijing Coollab Technology Co., Ltd.) was linearized by digesting it with two restriction endonucleases, SaiI and XbaI, to obtain a linearized vector.

[0116] according to The Seamless Cloning and Assembly Kit instructions state that ThFNS or ThCGT should be inserted into the linearized vector, and the reaction system is shown in Table 13. Subsequently, DH5α chemocompetent cells were transformed, and the recombinant plasmid was verified by colony PCR and sequencing (Qingke Company).

[0117] Table 13 Homologous Recombination Configuration System

[0118] Components Volume 2x Basic Assembly Mix 5 μL pCambia 1301 (Liner) 2 μL Inserts 1 μL Nuclease-free Water 2 μL

[0119] 3.3 Agrobacterium transformation and induction

[0120] GV3101 competent cells were thawed, and 2 μL of the recombinant plasmid obtained in step 3.2 was added and mixed gently. The cells were subjected to cold shock: ice bath for 5 min, liquid nitrogen freezing for 5 min, 37°C heat shock for 5 min, and ice bath for 5 min. Then, 800 μL of LB liquid medium without antibiotics was added, and the cells were recovered at 28°C and 200 rpm for 2-3 h. After centrifugation (6000 rpm, 1 min), 100 μL of the bacterial solution was uniformly spread on YEB solid medium containing Kan and Rif (20 mg / L), and incubated at 28°C until single colonies were formed. Positive transformants (obtained engineering strains) were screened by colony PCR, and after sequencing verification, they were mixed with 50% sterilized glycerol in equal volume, frozen in liquid nitrogen, and stored at -80°C for long-term preservation.

[0121] 3.4 Transient expression and substrate injection

[0122] Healthy N. benthamiana plants grown for about 28 days were selected as the transformation receptor, and the Agrobacterium transient expression technology system was used: first, the engineering strain obtained in step 3.3 was activated on YEB solid medium (containing antibiotics) (28°C / 48 h), and then transferred to YEB liquid medium (5 mL, corresponding to the resistance) and shaken for amplification (28°C / 220 rpm / 16 h). After removing the supernatant by sterile centrifugation, the bacterial body was resuspended in 1 / 2MS liquid medium to OD600≈0.6, and 10 mM 2-morpholinoethanesulfonic acid (MES) MES (pH 5.6) and 200 μM acetyl-syringone (AS) were added to induce for 3 h (28°C, static). The lower epidermis of the leaves was infiltrated with a sterile syringe, and after dark culture (24°C / 48-72 h), 250 μM flavonoid substrate was injected into the same site, and the leaves were cultured for another 24 h. The leaf samples were frozen in liquid nitrogen and stored at -80°C in a low-temperature environment for subsequent analysis.

[0123] 3.5 LC-MS detection of transient expression products

[0124] The frozen N. benthamiana transient expression leaf samples were ground in liquid nitrogen, and 200 μL of 80% methanol was added and vortexed. The samples were extracted by low-temperature ultrasonic extraction (60 min). After centrifugation (12000 rpm, 20 min), the supernatant was collected and filtered through a 0.22 μm organic filter to obtain the test solution. The results are shown in Figure 4-1 and Figure 4-2 .

[0125] From Figure 4-1It can be seen that the liquid quality detection result shows that after adding naringenin for 3 days in the transient expression FNS strain, the sample appears the peak with the same chromatographic retention time as the standard apigenin. By comparing the mass spectrum ions of the standard and the sample, it is found that the mass-to-charge ratio of the target peak in the sample is consistent with the apigenin standard (LC-MS detection m / z 269.04), and the types and relative abundance of the secondary mass spectrum fragment ions of the standard and the sample are highly consistent. Therefore, ThFNS has the function of catalyzing naringenin to generate apigenin;

[0126] From Figure 4-2 It can be seen that the liquid quality detection result shows that after adding naringenin for 3 days in the transient expression FNS strain, the sample appears the peak with the same chromatographic retention time as the standard apigenin. By comparing the mass spectrum ions of the standard and the sample, it is found that the mass-to-charge ratio of the target peak in the sample is consistent with the apigenin standard (LC-MS detection m / z 269.04), and the types and relative abundance of the secondary mass spectrum fragment ions of the standard and the sample are highly consistent. Therefore, ThFNS has the function of catalyzing naringenin to generate apigenin;

[0127] The experimental results show that the transient expression of ThFNS and ThCGT in N. benthamiana can catalyze naringenin to generate apigenin, and further catalyze apigenin to form vitexin, and LC-MS detection shows that the secondary mass spectrum fragments of the apigenin parent ion (m / z 269.04) and the vitexin parent ion (m / z 431.09) are completely matched with the standard, which confirms that ThFNS and ThCGT have enzyme activity in plant cells.

[0128] Example 4

[0129] Based on the previous transient expression system for the function verification of the key enzymes ThFNS and ThCGT of threeleaf milkwort flavonoids, this study further focuses on establishing a stable genetic transformation system. In this study, N. benthamiana was selected as the host of the heterologous expression system, and a stable transgenic genetic system mediated by Agrobacterium tumefaciens GV3101 was used to construct OE-FNS, OE-CGT and OE-FNS / CGT stable genetic strains in N. benthamiana. Further, RT-qPCR was used to screen the relatively high expression transgenic plants for downstream product verification. The contents of apigenin and vitexin were determined by Waters UPLC-Synapt G2s high-resolution mass spectrometry platform.

[0130] 4.1 Establishment of transgenic tobacco strains

[0131] N. benthamiana seeds (100 mg) were placed in a 2 mL centrifuge tube, and sequentially sterilized with 75% ethanol (1 min), 5% NaClO (containing 0.1% Tween-20, 15 min), and rinsed with sterile water for 5 times. The seeds were suspended in 0.1% agar solution and sowed on MS medium, and then transferred to a light cycle (16 h light / 8 h dark, 25 ± 1°C, light intensity 60 μmol·m -2 ·s -1 ) after dark culture for 24 h. The aseptic seedlings with a height of ≥3 cm and developed root system were selected and transferred to a tissue culture tank (1 seedling per tank) containing 50 mL of MS solid medium (purchased from Beijing Coolabio Technology Co., Ltd.).

[0132] 4.2 Agrobacterium-mediated genetic transformation

[0133] 1) The frozen Agrobacterium tumefaciens GV3101 strain was thawed at -80°C, and then activated by four-zone streaking method. After 48 h, single colonies were picked and expanded for bacterial liquid PCR verification, and the positive strains were expanded for culture.

[0134] 2) The positive bacterial liquid obtained in Example 1 was inoculated into YEB liquid medium containing Rif (25 mg / L) and Kana (50 mg / L) at an inoculation amount of 1 v / v%, and then placed in a 220 rpm 28°C shaking incubator for culture until the logarithmic growth phase.

[0135] 3) The bacterial liquid after overnight culture was centrifuged (6000 rpm, 10 min) to enrich the bacterial bodies, and the supernatant was discarded. The bacterial body precipitate was washed with 1 / 2MS liquid medium containing 100 μM acetosyringone and ordinary 1 / 2MS medium, respectively, and finally resuspended to OD 600 ≈0.4-0.5, which was used as an infection liquid.

[0136] 4) Under sterile conditions, the N. benthamiana leaves were cut into regular small pieces, and then pre-cultured on MS solid medium (2-3 days) after surface scratching to obtain pre-cultured leaves.

[0137] 5) The pre-cultured leaves obtained in step 4) were immersed in the infection liquid obtained in step 3), and then shaken at room temperature (120 rpm, 10 min). After the surface residual bacterial liquid was absorbed by sterile filter paper, the leaves were transferred to co-culture medium for continuous culture. When a slight bacterial plaque appeared on the edge of the explant, the leaves were shaken in sterile water to remove bacteria, and then repeatedly washed and dried by filter paper. The leaves were inoculated into antibiotic-containing sterilization medium (sterilization medium was MS medium base salt containing 200 mg or L timentin and 200 mg or L cefotaxime acid; purchased from Beijing Coolabio Biological Co., Ltd.). The culture was carried out for 2 weeks.

[0138] 6) After sterilization, the leaves were placed on the induction medium (5-6 pieces per dish) with the front side up, and then cultured under a light cycle for 3 weeks to form adventitious buds.

[0139] 7) Cut the new shoots and continue to expand the culture for 1 week, then transfer to rooting medium to complete plant regeneration, and obtain transgenic tobacco.

[0140] Co-expression of ThFNS and ThCGT, each strain was cultured to OD 600 = 0.6, then mixed at a volume ratio of 1:1, and then inoculated into YEB liquid medium containing Rif (25 mg / L) and Kana (50 mg / L) at a seeding amount of 1 v or v%, and then the remaining steps were the same as above.

[0141] 4.3 Quantitative analysis

[0142] Extract RNA from transgenic tobacco leaves and perform reverse transcription (method same as step 1.1 in Example 1), then use the QuantStudioTM6 Flex Real-Time PCR system to screen plants with higher relative expression by qRT-PCR. The reaction system is configured according to Table 14.

[0143] Table 14 q-PCR reaction system

[0144] Name Amount cDNA 1 μL qPCR SuperMix 5 μL F primer (see Table 15) 0.2 μL R primer (see Table 15) 0.2 μL ddH2O 3.6 μL

[0145] Table 15

[0146] Primer Name Primer Sequence 5'-3' SEQ ID No. NbActin-F AGGCTGTTCTTTCCCTCTATGC 17 NbActin-R CAACTTCTCCTTCACATCCCTAAC 18 FNSqpcrl-F GTGGAAGGAGCATTCGTCGTCAA 19 FNSqpcrl-R ACAGCCTGGTGGTCCGCATT 20 CGTqpcrl-F GGAACCTACTACGCTCAATGCTCTT 21 CGTqpcrl-R GCCAATCCAACAACTCGCACTTG 22

[0147] qRT-PCR reaction system of 10 μL system, the whole process is operated in the dark. The amplification program is set as: 95℃ pre-denaturation for 30 seconds; then 40 cycles of amplification (95℃ denaturation for 15 seconds→60℃ annealing / extension for 40 seconds); the melting curve analysis stage is performed according to the gradient of 95℃ for 15 seconds→60℃ for 1 minute→95℃ final extension for 15 seconds. The specificity of the primers is verified by the characteristic peak of the melting curve and the Ct threshold value, Nicotiana benthamiana Actin is used as the internal reference gene, and the relative expression amount is calculated by using the 2- ΔΔCT method.

[0148] The results of the quantitative analysis based on qRT-PCR are shown in Figure 5 .

[0149] From Figure 5 it can be seen that the relative expression of OE-FNS-2, OE-CGT-4, and OE-CO-4 which co-overexpresses FNS and CGT is the highest.

[0150] 4.4 LC-MS detection of product of stable genetic strain

[0151] According to the qPCR results, the plants with relatively high gene expression (OE-FNS-2, OE-CGT-4, and OE-CO-4 co-expressing FNS and CGT) were selected for the next product detection. First, the selected tissue culture transgenic tobacco was subjected to acclimation treatment. 24 hours before acclimation, 0.1% carbendazim solution was sprayed to prevent mold infection. After 14 days of acclimation, the culture was changed to hydroponic culture, and 1 / 2MS liquid medium was used as the culture solution, and substrate was added to a final concentration of 100 μM.

[0152] About 0.2g of the tobacco leaves to be tested was placed in a 2ml centrifuge tube, quickly frozen in liquid nitrogen, and broken by a grinder using small steel balls (50Hz, 1min). 100mg of the powder was added to 200μL of 80% methanol extraction solution, and the sample was fully mixed by vortex oscillation, then transferred to an ice bath for ultrasonic-assisted extraction, and the treatment time was 30 minutes.

[0153] The reaction solution was centrifuged (12000rpm, 20min), and the supernatant was filtered using an organic filter membrane with a pore size of 0.22 μm. The filtrate was stored in a brown light-proof liquid phase vial for detection and analysis. The results are shown in Figure 6-1 、 6-2 and Figure 6-3 .

[0154] From Figure 6-1 , it can be seen that through LC-MS analysis, characteristic peaks consistent with the retention time of the apigenin standard, the parent ion (m / z 269.04) and the secondary mass spectrum fragments were detected in the sample of the stable ThFNS strain, confirming that ThFNS can catalyze naringenin to generate apigenin.

[0155] From Figure 6-2 , it can be seen that after adding apigenin, the product consistent with the retention time of the vitexin standard, the parent ion (m / z 431.09) and the secondary mass spectrum characteristics were detected in the sample, proving that ThCGT has the function of catalyzing apigenin to generate vitexin.

[0156] From Figure 6-3 , it can be seen that through the verification of the N. benthamiana system co-expressing two genes, it is found that only by adding the substrate naringenin can the end product vitexin be generated through the cascade reaction of the endogenous metabolic pathway, confirming that the system can realize the total synthesis from naringenin to vitexin.

[0157] The present application is not limited by the above specific literal description, and various changes can be made within the scope of the claims, which are within the scope of the present application.

Claims

1. A C- glycosyltransferase from Tripterygium regelii, characterized in that, The C-glycosyltransferase comprises the amino acid sequence shown in SEQ ID NO.

4.

2. A biological material related to the C-glycosyltransferase as claimed in claim 1, characterized in that, The biological material comprises at least one of the following: a) a polynucleotide encoding the C-glycosyltransferase as claimed in claim 1; b) a recombinant expression vector containing the polynucleotide of a); c) a bioengineered bacterium in which the polynucleotide of a) is integrated into the genome, or a bioengineered bacterium containing the recombinant expression vector of b).

3. The biomaterial of claim 2, wherein, In a), the nucleotide sequence of the polynucleotide comprises the sequence shown in SEQ ID NO.

3.

4. Use of the C-glycosyltransferase as claimed in claim 1 or the biological material as claimed in claim 2 or 3 in at least one of the following: 1) promoting synthesis of vitexin in a plant; 2) increasing the content of vitexin in a plant; 3) increasing accumulation of vitexin in a plant; 4) cultivating a transgenic plant; 5) catalyzing glycosylation of apigenin at C-8.

5. A method of growing a transgenic plant, comprising, Introducing the C-glycosyltransferase as claimed in claim 1 or the biological material as claimed in claim 2 or 3 into a plant to obtain a transgenic plant.

6. A method of promoting the synthesis of vitexin in a plant or increasing the content of vitexin in a plant or increasing the accumulation of vitexin in a plant, characterized in that, Introducing the C-glycosyltransferase as claimed in claim 1 or the biological material as claimed in claim 2 or 3 into a plant.

7. A method of catalyzing the glycosylation of apigenin at the C-8 position to convert it to vitexin, characterized by, The method comprises the step of catalyzing apigenin using the C-glycosyltransferase as claimed in claim 1 or the biological material as claimed in claim 2 or 3.

8. Use according to claim 4 or method according to any one of claims 5 to 7, characterized in that, The plant is a dicotyledon; preferably, the plant is Gynostemma pentaphyllum.

9. A method of preparing uterin, characterized by, The method comprises the step of catalyzing apigenin using the C-glycosyltransferase as claimed in claim 1 or the biological material as claimed in claim 2 or 3 to obtain vitexin.

10. The method of claim 9, wherein, The apigenin is obtained from naringenin catalyzed by a flavone synthase; preferably, the flavone synthase comprises the amino acid sequence shown in SEQ ID NO. 2.

Images