Fusion dsRNA for preventing and treating pest mites and application of fusion dsRNA

Abstract

The invention discloses fused dsRNA for preventing and treating pest mites and application of the fused dsRNA, and belongs to the technical field of agricultural biology. The fusion dsRNA is dsfusion 1 or dsfusion 2, and the fusion dsRNA is dsfusion 1 or dsfusion 2. The invention provides two kinds of artificially synthesized fused dsRNAs (dsfusion 1 and dsfusion 2) targeting pest mite ecdysis hormone signal genes ECR-HR3-HR4 and ECR-HR3-E74, and experiments prove that the two kinds of fused dsRNAs have good interference efficiency and can be used for death of pest mites by inhibiting ecdysis of the pest mites; various pest mites can be effectively prevented and treated, but natural enemy predatory mites are not influenced; and the LC50 value is low, so that the prevention and treatment potential at low concentration can be improved. Therefore, the invention provides a new method for preventing and treating pest mites, and the fused dsRNA has a wide application prospect.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of agricultural biotechnology, in particular to a fused dsRNA for controlling spider mites and application thereof. BACKGROUND

[0002] Spider mites are worldwide pests of crops and economic crops. Chemical control is the main means of prevention and control, but spider mites have strong resistance to traditional pesticides such as abamectin and bifenthrin due to their fast reproduction, short generation, strong detoxification ability and easy mutation of target, becoming one of the most serious arthropod groups in the world. Therefore, it is urgent to find a new green and sustainable control method.

[0003] RNA interference (RNAi) technology is considered as the third revolution in the field of pesticides. This technology designs double-stranded RNA (dsRNA) targeting key genes of spider mites (such as development, reproduction, detoxification or nerve conduction related genes), and after being introduced, it specifically silences the target genes, interferes with their physiological processes, and causes growth and reproduction inhibition or death, achieving precise control. Its advantages are: strong species specificity, gene-level action mechanism is not easy to induce resistance and dsRNA is biodegradable, which meets the requirements of green and sustainable management, and is an important path to solve the problem of spider mite resistance.

[0004] Selecting appropriate target genes is the core of controlling pests and diseases based on RNAi technology. Arthropods need to undergo periodic molting to mature, and molting hormone plays an important role in regulating the molting process. In the RNAi target of spider mites, T. urticae cannot molt normally and dies by interfering with the molting hormone signal genes E78 and E75. Molting hormone is essential for the survival and development of spider mites, and is a feasible molecular target for spider mite control. Therefore, finding genes related to molting hormone signal transduction is of great significance for controlling spider mites based on RNAi technology. Reasonable dsRNA design is a key link to improve the control effect of RNAi technology, and the construction of fused dsRNA targeting multiple genes has more advantages: it can overcome the low silencing efficiency of single target or the failure of control caused by functional redundancy, and can also enhance the lethality effect through multiple targets, and delay the evolution of RNAi resistance of spider mites, providing support for sustainable green control. SUMMARY

[0005] The purpose of the present application is to provide a fused dsRNA for controlling spider mites and application thereof to solve the problems existing in the prior art. The present application provides two kinds of fused dsRNA (dsfusion1 and dsfusion2), which have been verified by experiments to have good interference efficiency, can inhibit the molting of spider mites and cause the death of spider mites; can effectively control various spider mites without affecting the predatory mites; and have low LC 50 values, which help to improve the control potential at low concentrations.

[0006] To achieve the above object, the present application provides the following scheme:

[0007] The present application provides a fusion dsRNA for preventing and treating the mite, which is dsfusion1 or dsfusion2.

[0008] The nucleotide sequence of the dsfusion1 is shown in SEQ ID NO. 3; and the nucleotide sequence of the dsfusion2 is shown in SEQ ID NO. 4.

[0009] Optionally, the preparation method of the fusion dsRNA comprises the following steps:

[0010] The plasmid containing the dsfusion1 coding gene or the dsfusion2 coding gene is used as a template, and the forward primer and the reverse primer with the nucleotide sequence shown in SEQ ID NO. 7-8 or the forward primer and the reverse primer with the nucleotide sequence shown in SEQ ID NO. 9-10 are used for PCR amplification; and the PCR amplification product is transcribed in vitro to be integrated into the fusion dsRNA.

[0011] The nucleotide sequence of the dsfusion1 coding gene is shown in SEQ ID NO. 1;

[0012] The nucleotide sequence of the dsfusion2 coding gene is shown in SEQ ID NO. 2.

[0013] Optionally, the reaction system of the PCR amplification is sterile water 17 μL, forward primer 2 μL, reverse primer 2 μL, plasmid 4 μL and 2×Taq PCR StarMix (Dye) 25 μL;

[0014] The reaction procedure of the PCR amplification is pre-denaturation at 95℃ for 2 min, denaturation at 95℃ for 30 s, annealing at 60℃ for 30 s, extension at 72℃ for 40 s, 35 cycles are set, and terminal extension at 72℃ for 5 min.

[0015] The present application further provides a recombinant expression vector, a recombinant bacteria or an expression cassette containing the fusion dsRNA.

[0016] The present application further provides the application of the fusion dsRNA or the recombinant expression vector, the recombinant bacteria or the expression cassette in any of the following:

[0017] (1) the application in preventing and treating the mite;

[0018] (2) the application in preparing the product for preventing and treating the mite;

[0019] (3) the application in inhibiting the mite molting.

[0020] (4) Application in preparing a product for inhibiting the ecdysis of the spider mite.

[0021] Optionally, the ecdysis of the spider mite is inhibited by introducing the fusion dsRNA into the spider mite, so as to control the spider mite.

[0022] Optionally, the spider mite includes Tetranychus urticae or Eutetranychus seriniae.

[0023] The application further provides a product for controlling the spider mite and / or inhibiting the ecdysis of the spider mite, which comprises the fusion dsRNA or the recombinant expression vector, the recombinant bacteria or the expression cassette.

[0024] The application further provides a method for controlling the spider mite, which comprises the step of introducing the fusion dsRNA into the spider mite to inhibit the ecdysis of the spider mite, so as to control the spider mite.

[0025] The application further provides a method for inhibiting the ecdysis of the spider mite, which comprises the step of introducing the fusion dsRNA into the spider mite, so as to inhibit the ecdysis of the spider mite.

[0026] The application discloses the following technical effects:

[0027] The application aims to solve the key problems in the existing spider mite control technology, such as serious chemical pesticide resistance, limitations of single-target RNAi technology and insufficient ecological safety, and provides a multi-target fusion dsRNA green control scheme based on RNAi control technology, which realizes efficient mite killing, delays resistance evolution and protects natural enemies by synergistically targeting key genes (ECR, HR3, HR4 / E74) in the ecdysone signaling pathway.

[0028] The application provides two artificially synthesized fusion dsRNAs (dsfusion1 and dsfusion2) targeting the ecdysone signaling genes ECR-HR3-HR4 and ECR-HR3-E74 of the spider mite, which have good interference efficiency and can kill the spider mite by inhibiting the ecdysis of the spider mite, can effectively control various spider mites without affecting the predatory mites, and have a low LC 50 value, which helps to improve the control potential at a low concentration. It can be seen that the application provides a new method for controlling the spider mite, and the fusion dsRNA has a wide application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0029] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed in the embodiments. Obviously, the drawings described below only illustrate some of the embodiments of the present application, and for those skilled in the art, other drawings can also be obtained from these drawings without any creative effort.

[0030] Figure 1 Survival curves of T. urticae after injection of fusion dsRNA;

[0031] Figure 2 Survival curves of T. urticae after injection of fusion dsRNA;

[0032] Figure 3 Effect of injection of fusion dsRNA on mortality of E. herberti;

[0033] Figure 4 Effect of feeding fusion dsRNA on survival of N. californicus; A: molting curve of N. californicus after feeding fusion dsRNA; B: survival curve of N. californicus after feeding fusion dsRNA. DETAILED DESCRIPTION

[0034] The detailed description set forth below will describe various illustrative embodiments of the present application, but is not intended to limit the present application. Rather, the detailed description is intended to describe certain aspects, features and embodiments of the present application.

[0035] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. In addition, for any numerical limits recited herein, these numerical limits are approximations. Although these numerical limits are approximations, the numerical limits are indicated with a degree of precision that is not exact. Any numerical limit should at least be construed in light of this statement as permitting some slight deviations from the indicated numerical values in order to account for the precision of actual measurement of a value. In one embodiment, the numerical value of a limit can include amounts that are -10% lower and 10% higher than the indicated numeric value as well as modest variations that include smaller ranges.

[0036] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All publications mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any reference is not an admission that it is prior art with respect to the present application.

[0037] Many modifications and variations of the present disclosure described herein will be apparent to those of ordinary skill in the art without departing from the scope or spirit of the present disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification and practice of the present disclosure. The specification and examples are illustrative only.

[0038] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean inclusion, but not limited to, the listed material or step.

[0039] Example 1 Design and synthesis of fusion dsRNA

[0040] 1. Design of fusion dsRNA

[0041] The ECR (ID: tetur01g15140), HR3 (ID: tetur01g26750), HR4 (ID: tetur03g36170), and E74 (ID: tetur14g01410) gene fragments were obtained based on the two-spotted spider mite genome database (https: / / bioinformatics.psb.ugent.be / orcae / overview / Tetur). The target / off-target analysis was performed on the dsRNA Engineer website (https: / / dsrna-engineer.cn / ) using the obtained ECR, HR3, HR4, and E74 gene sequences, and sequences with high homology among pest mites and low similarity among beneficial species and a length of 151-200 bp were screened. The ECR (346 bp-536 bp), HR3 (135-335 bp), and HR4 (269-449 bp) were spliced to obtain No. 1 fusion dsRNA (dsfusion1), and the ECR (346 bp-536 bp), HR3 (209-379 bp), and E74 (446-616 bp) were spliced to obtain No. 2 fusion dsRNA (dsfusion2). The nucleotide sequences of the genes encoding dsfusion1 and dsfusion2 are shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively. The gene fragment encoding the fusion dsRNA was sent to Shengong Bioengineering (Shanghai) Co., Ltd. for preparation of a template (plasmid) by a chemical synthesis method. The RT-qPCR primers of the ECR, HR3, HR4, and E74 genes and the primers of dsfusion1, dsfusion2, and dsHR3 were designed on the NCBI primer design website Prime designing tool (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ), and were sent to Shengong Bioengineering (Shanghai) Co., Ltd. for synthesis.

[0042] Table 1. Primer information

[0043] No. Primer name Sequence (5'-3') A1 dsEGFP F: taatacgactcactataggg TGGGCACAAATTTTCTGTC (SEQ ID NO. 5) R: taatacgactcactataggg AAGGGTATCACCTTCAAAC (SEQ ID NO. 6) A2 dsfusionl F: taatacgactcactataggg TGTCAAGAATGTCGATTAAA (SEQ ID NO. 7) R: taatacgactcactataggg ACCTCATCTTCAACCTTTTC (SEQ ID NO. 8) A3 dsfusion2 F: taatacgactcactataggg ACCGAATAAATCGAAACCGT (SEQ ID NO. 9) R: taatacgactcactataggg GGTGTTTTGGTACCTAAAAC (SEQ ID NO. 10) A4 dsHR3 F: taatacgactcactataggg GGTGGACCTTCAACAACCGA (SEQ ID NO. 11) R: taatacgactcactataggg CAACGGCTAATCTGGAGGCA (SEQ ID NO. 12) A5 qECR F: CTGAAAACGGGAGTGGAACTG (SEQ ID NO. 13) R: TCTTGCTGTCTTGGAGCTGG (SEQ ID NO. 14) A6 qHR3 F: TGAGGTTCGCTTCCATCAGG (SEQ ID NO. 15) R: TCGTTGACCCTGGTCCATTG (SEQ ID NO. 16) A7 qHR4 F: CCACCTTCAAGCACCGGTAT (SEQ ID NO. 17) R: ATGATCGCGAGAAGAACCGT (SEQ ID NO. 18) A8 qE74 F: CGTCAGCCAATGGTCTTGGA (SEQ ID NO. 19) R: ACGATGATGAGTCGGTCCAT (SEQ ID NO. 20) A9 qATP F: CCCGAAGAGATGATCCAAACTG (SEQ ID NO. 21) R: CGGTAAACCTGATGCTGAGAAA (SEQ ID NO. 22)

[0044] SEQ ID NO. 1 (nucleotide sequence of the gene encoding dsfusion1):

[0045] TGTCAAGAATGTCGATTAAAGAAATGCCTGAATGTTGGCATGAGGCCTGAATGTGTTGTCCCGGAGTACCAATGTGCCATCAAACGGGAATCCAAAAGAGCCCAAAAGGAGAAAGATAAGCCTAATAGTACTACAAAAGACGCCTCACCAGACAAGGAGGATAAAACTCTGGTTTTAGGTACCAAAACACCGCCTTGACCTTACCACTAAACCAAAGGCCACTTCAGGCTCTTCGGTGAAAAAATCTCACCTCAGCTGTGGCTTACCTCCAACACCCCTCATCATGGGTGATTTACCAGGCCAAGGATCTGGAAAAACTATGTTATGGACCATAATGAACAAAGGATCACCACCTTCAAGCACCGGTATGACCAAGGCAAAAGAATTGCGTTGTCGACCGAATAAATCGAAACCGTTGTCAATATTGTCGTCTTAAAAAATGTCTCACTCTGGGAATGTCCAGAGATGCAGTAAAATTTGGACGAATGTCCAAAAAGCAGCGAGAAAAGGTTGAAGATGAGGT;

[0046] SEQ ID NO. 2 (nucleotide sequence of the gene encoding dsfusion2):

[0047] ACCGAATAAATCGAAACCGTTGTCAATATTGTCGTCTTAAAAAATGTCTCACTCTGGGAATGTCCAGAGATGCAGTAAAATTTGGACGAATGTCCAAAAAGCAGCGAGAAAAGGTTGAAGATGAGGTTCGCTTCCATCAGGCTCAAATGGTACGAACACCGGGATCCGGTGCAAATTCATCGTCAGCCAATGGTCTTGGACATTTATCAATGGGACAAACAAATAGTAACACCTCTCCACTTCCTCCTTCACCAGCAGATTCCGGTGTAAGTGATGTTGACTCACATTACAGTTCCAACGATGAACAACACCAATTAAGCCAATATGGCTACTTTTATCCAATGTCAAGAATGTCGATTAAAGAAATGCCTGAATGTTGGCATGAGGCCTGAATGTGTTGTCCCGGAGTACCAATGTGCCATCAAACGGGAATCCAAAAGAGCCCAAAAGGAGAAAGATAAGCCTAATAGTACTACAAAAGACGCCTCACCAGACAAGGAGGATAAAACTCTGGTTTTAGGTACCAAAACACC.

[0048] 2. Preparation of DsRNA

[0049] Take 150 adult T. urticae in a 1.5 mL centrifuge tube, extract total RNA of T. urticae by Trizol method, detect RNA concentration and purity by Nanodrop 2000 ultramicro spectrophotometer, and detect RNA integrity by 1% agarose gel electrophoresis. Reverse transcription was performed by using reverse transcription kit StarScript II RT Mix with gDNA Remover (Genstar Company) according to the instruction steps, and the first strand of cDNA was synthesized.

[0050] The plasmids (containing dsfusion1 coding gene or dsfusion2 coding gene plasmid), ordinary cDNA as template, using primer A2, A3 or A4 in table 1 to carry out PCR amplification, the reaction system of PCR amplification is sterile water 17 μL, forward primer 2 μL, reverse primer 2 μL, cDNA / plasmid 4 μL and 2×Taq PCR StarMix(Dye) 25 μL. PCR reaction program: 95℃ pre-denaturation 2 min, 95℃ denaturation 30 s, 60℃ annealing 30 s, 72℃ extension 40 s, set 35 cycles, 72℃ final extension 5 min. The amplification product is stored at 4℃, and the amplification result is detected by 1% agarose gel electrophoresis.

[0051] The SanPrep column DNA gel recovery kit produced by Shengwo Bioengineering (Shanghai) Co., Ltd. was used to purify the three PCR products obtained above as templates for in vitro transcription of fusion dsRNA and dsHR3. The TranscriptAid T7 High Yield Transcription Kit produced by Thermo Fisher Scientific (China) Co., Ltd. was used to synthesize and purify dsRNA according to the instructions, and dsfusion1, dsfusion2 and dsHR3 were obtained. Finally, the concentration and purity of the fusion dsRNA were detected by Nanodrop 2000 ultramicro spectrophotometer, and the integrity of the fusion dsRNA was detected by 1% agarose gel electrophoresis, and stored at -80℃. The nucleotide sequence of dsfusion1 is shown in SEQ ID NO. 3, and the nucleotide sequence of dsfusion2 is shown in SEQ ID NO. 4.

[0052] SEQ ID NO. 3 (nucleotide sequence of dsfusion1):

[0053] UGUCAAGAAUGUCGAUUAAAGAAAUGCCUGAAUGUUGGCAUGAGGCCUGAAUGUGUUGUCCCGGAGUACCAAUGUGCCAUCAAACGGGAAUCCAAAAGAGCCCAAAAGGAGAAAGAUAAGCCUAAUAGUACUACAAAAGACGCCUCACCAGACAAGGAGGAUAAAACUCUGGUUUUAGGUACCAAAACACCGCCUUGACCUUACCACUAAACCAAAGGCCACUUCAGGCUCUUCGGUGAAAAAAUCUCACCUCAGCUGUGGCUUACCUCCAACACCCCUCAUCAUGGGUGAUUUACCAGGCCAAGGAUCUGGAAAAACUAUGUUAUGGACCAUAAUGAACAAAGGAUCACCACCUUCAAGCACCGGUAUGACCAAGGCAAAAGAAUUGCGUUGUCGACCGAAUAAAUCGAAACCGUUGUCAAUAUUGUCGUCUUAAAAAAUGUCUCACUCUGGGAAUGUCCAGAGAUGCAGUAAAAUUUGGACGAAUGUCCAAAAAGCAGCGAGAAAAGGUUGAAGAUGAGGU.

[0054] SEQ ID NO. 4 (nucleotide sequence of dsfusion2):

[0055] ACCGAAUAAAUCGAAACCGUUGUCAAUAUUGUCGUCUUAAAAAAUGUCUCACUCUGGGAAUGUCCAGAGAUGCAGUAAAAUUUGGACGAAUGUCCAAAAAGCAGCGAGAAAAGGUUGAAGAUGAGGUUCGCUUCCAUCAGGCUCAAAUGGUACGAACACCGGGAUCCGGUGCAAAUUCAUCGUCAGCCAAUGGUCUUGGACAUUUAUCAAUGGGACAAACAAAUAGUAACACCUCUCCACUUCCUCCUUCACCAGCAGAUUCCGGUGUAAGUGAUGUUGACUCACAUUACAGUUCCAACGAUGAACAACACCAAUUAAGCCAAUAUGGCUACUUUUAUCCAAUGUCAAGAAUGUCGAUUAAAGAAAUGCCUGAAUGUUGGCAUGAGGCCUGAAUGUGUUGUCCCGGAGUACCAAUGUGCCAUCAAACGGGAAUCCAAAAGAGCCCAAAAGGAGAAAGAUAAGCCUAAUAGUACUACAAAAGACGCCUCACCAGACAAGGAGGAUAAAACUCUGGUUUUAGGUACCAAAACACC.

[0056] Example 2 Efficiency evaluation of fusion dsRNA

[0057] 1. Effect of fusion dsRNA on interference efficiency, molting rate and mortality of T. urticae

[0058] The exogenous dsfusionl and dsfusion2 were introduced into T. urticae by microinjection, and the same amount of dsEGFP was injected as a control group. More than 50 nymphs were injected in each group, and the samples were collected for interference efficiency detection after 24 h. Meanwhile, more than 20 nymphs were injected in each group, and the molting rate and mortality were observed and counted every 12 h. Four biological replicates were set for the experimental and control groups. Each test mite was injected with 2.25 nL of fusion dsRNA, and the concentration of fusion dsRNA was 10000 ng / µL.

[0059] The total RNA was extracted by Trizol method, and the RNA concentration and purity were detected by Nanodrop 2000 ultramicro spectrophotometer, and the RNA integrity was detected by 1% agarose gel electrophoresis. Reverse transcription was performed using the reverse transcription kit StarScript II RT Mix with gDNA Remover (Genstar Company) according to the instruction steps, and the first strand of cDNA was synthesized. The cDNA template was diluted 25 times, and the relative expression amounts of ECR, HR3, HR4 and E74 genes were detected using primers A5, A6, A7, A8 and A9 in Table 1 using CFX96 TM fluorescent quantitative PCR instrument. The quantitative detection reaction system was 10 μL (including 2x RealStar Green FastMixture 5 μL, forward primer 0.5 μL, reverse primer 0.5 μL, cDNA 4 μL). According to the calculation of ATP as the internal reference gene and the use of 2 -△△Ct After processing all the relative expression amounts of genes, the interference efficiency of the target genes ECR, HR3, HR4 and E74 in the experimental group and the control group was calculated, and the significant difference was analyzed by independent sample t test.

[0060] The results of the interference efficiency are shown in Figure 1 The results show that after injecting dsfusion1, the expression amounts of ECR, HR3 and HR4 genes of T. urticae are significantly down-regulated, and after injecting dsfusion2, the expression amounts of ECR, HR3 and E74 genes of T. urticae are significantly down-regulated, indicating that the fusion dsRNA can effectively target the target genes.

[0061] The results of the mortality rate are shown in Figure 2 The survival rate of the nymphs injected with dsEGFP is 94.12%, and the mortality rates of the nymphs injected with dsfusion1 and dsfusion2 are 91.00% and 89.19% respectively, indicating that the fusion dsRNA can effectively hinder the ecdysis of T. urticae.

[0062] 2, LC 50 value of fusion dsRNA on T. urticae

[0063] The LC 50Values ​​were determined. Each group was injected with at least 20 post-injection nymphs, with four biological replicates. The injected mites were then placed on bean leaves and fed to the mite. The leaves were placed in an AI-controlled climate chamber (temperature 27±1℃, relative humidity 60%, photoperiod 14 L:10 D). Molting rate and mortality were observed and recorded every 12 hours. Approximately 2.25 nL of fusion dsRNA was injected into each mite, with injection concentrations of 5000 ng / µL, 1000 ng / µL, 500 ng / µL, 100 ng / µL, 50 ng / µL, 40 ng / µL, and 25 ng / µL.

[0064] As shown in Table 2, the LC50 of dsfusion1 and dsfusion2 against the two-spotted spider mite 50 The values ​​were 0.068 ng and 0.064 ng, respectively, both lower than the LC50 of dsHR3 against the two-spotted spider mite. 50 The value was 0.103 ng, indicating that under low concentration conditions, the control potential of fused dsRNA against two-spotted spider mites is greater than that of single-gene dsRNA.

[0065] Table 2. Regression equations for the virulence of dsRNA against Tetranychus bicolor in each group.

[0066] dsRNA Slope SE LC 50 ]] 95% Confidence Interval Chi-square Dr dsHR3 0.975 0.089 0.103 ng 0.016-0.252 31.213 5 dsfusionl 0.885 0.091 0.068 ng 0.020-0.206 35.7025 5 dsfusion2 0.788 0.085 0.064 ng 0.003-0.200 27.471 5

[0067] 2. Effects of fused dsRNA on Tetranychus edreichestrel

[0068] dsfusion1 and dsfusion2 were injected into *Tetranychus edodes* using microinjection. An equal amount of dsEGFP was injected as a control group. Each group contained at least 20 post-nymphal mites, with four biological replicates for both the experimental and control groups. Approximately 2.25 nL of dsRNA was injected into each mite at a concentration of 1000 ng / µL. The injected mites were then placed on bean leaves and fed to the mites in an AI-controlled climate chamber (temperature 27±1℃, relative humidity 60%, photoperiod 14 L:10 D). Molting rate and mortality were observed and recorded every 12 hours.

[0069] The results are as follows Figure 3 As shown, the results indicated that after injection of dsfusion1, *Tetranychus edodes* was unable to molt normally, with a mortality rate of 79.90%; after injection of dsfusion2, *Tetranychus edodes* was unable to molt normally, with a mortality rate of 82.94%. However, after injection of dsEGFP, some *Tetranychus edodes* molted into adults, with a survival rate of 94.92%. This demonstrates that fused dsRNA can effectively control a variety of harmful mites.

[0070] Example 3 Safety evaluation of dsRNA fusion

[0071] The effect of the fusion dsRNA on the survival of Neoseiulus californicus was detected, and the specific experiment was as follows.

[0072] 1. Experimental method

[0073] The newly molted N. californicus nymphs were picked into the feeding table and starved for 24 h, 10 μL of the prepared feed liquid was added to the feeding table, the feed liquid contained 7.4 μL of dsfusion1 or dsfusion2 solution, 2 μL of saturated sucrose solution, and 0.6 μL of blue edible pigment. dsEGFP was fed as a control group, 20 N. californicus nymphs were fed in each group, and 3 biological replicates were set for the experimental group and the control group. The concentration of the fed fusion dsRNA was 1000 ng / µL.

[0074] The N. californicus with blue intestinal tract after feeding dsRNA was picked onto bean leaf blades, the leaf blades were placed in an artificial intelligent climate box (temperature 27±1℃, relative humidity 60%, light cycle 14 L:10 D), sufficient two-spotted spider mite larvae were picked into each day, and the molting rate and mortality rate were observed and counted once every 12 h.

[0075] 2. Experimental results

[0076] The results are shown in Table 1. Figure 4 As shown in Table 1, the molting rate of the control group fed with dsEGFP was 87.30%, and the survival rate was 90.48%; the molting rates of the experimental groups fed with dsfusion1 or dsfusion2 were 83.33% and 84.38% respectively, and the survival rates were 84.85% and 87.50% respectively, and there was no obvious difference between the molting rate and the survival rate, and the N. californicus nymphs basically molted normally into the adult stage. It is proved that the fusion dsRNA has no effect on non-target organisms and has certain safety.

[0077] The above-described embodiments are only used to describe the preferred modes of the present application, and do not limit the scope of the present application, and various modifications and improvements to the technical solutions of the present application made by those skilled in the art without departing from the design spirit of the present application shall fall within the protection scope of the present application defined by the claims.

Claims

1. A fused dsRNA for controlling spider mites, characterized in that, The fusion dsRNA is dsfusion1 or dsfusion2. The nucleotide sequence of the dsfusion1 is shown as SEQ ID NO. 3; and the nucleotide sequence of the dsfusion2 is shown as SEQ ID NO.

4.

2. The fusion dsRNA of claim 1, wherein, The preparation method of the fusion dsRNA comprises the following steps: PCR amplification is performed by using a forward primer and a reverse primer with the nucleotide sequences shown as SEQ ID NO. 7-8 or a forward primer and a reverse primer with the nucleotide sequences shown as SEQ ID NO. 9-10 as templates of a plasmid containing a dsfusion1 coding gene or a dsfusion2 coding gene; and the PCR amplification product is transcribed in vitro to synthesize the fusion dsRNA. The nucleotide sequence of the dsfusion1 coding gene is shown as SEQ ID NO.

1. The nucleotide sequence of the dsfusion2 coding gene is shown as SEQ ID NO.

2.

3. The fusion dsRNA of claim 2, wherein, The reaction system of the PCR amplification is 17 μL of sterile water, 2 μL of a forward primer, 2 μL of a reverse primer, 4 μL of a plasmid and 25 μL of 2×Taq PCR StarMix (Dye). The reaction procedure of the PCR amplification is pre-denaturation at 95℃ for 2 min, denaturation at 95℃ for 30 s, annealing at 60℃ for 30 s, extension at 72℃ for 40 s, 35 cycles, and terminal extension at 72℃ for 5 min.

4. A recombinant expression vector, a recombinant bacterium or an expression cassette containing the fusion dsRNA of claim 1.

5. The fusion dsRNA of claim 1 or the recombinant expression vector, the recombinant bacterium or the expression cassette of claim 4 is used in any one of the following: (1) in the prevention and treatment of mites; (2) in the preparation of a product for preventing and treating mites; (3) in the inhibition of mite ecdysis; (4) in the preparation of a product for inhibiting mite ecdysis.

6. The use according to claim 5, wherein the compound is ###0002### The mite ecdysis is inhibited by introducing the fusion dsRNA into the mite, thereby preventing and treating the mite.

7. The use according to claim 5, wherein the compound is ###00003### or a pharmaceutically acceptable salt thereof. The mite includes Tetranychus urticae or Eutetranychus seriniae.

8. A product for controlling and / or inhibiting molting of a pest mite, characterized by, The fusion dsRNA of claim 1 or the recombinant expression vector, the recombinant bacterium or the expression cassette of claim 4 is contained.

9. A method for controlling a spider mite, characterized by, The method comprises the step of introducing the fusion dsRNA of claim 1 into the mite, thereby preventing and treating the mite.

10. A method of inhibiting molting of a pest mite, characterized by, The method comprises the step of introducing the fusion dsRNA of claim 1 into the mite, thereby preventing and treating the mite.

Images