DsRNA for preventing and treating liriomyza sativae and pesticide compound thereof

Abstract

The invention provides dsRNA for preventing and controlling liriomyza sativae and a pesticide compound thereof, the pesticide compound is formed by mixing dsRNA and an SPc star-type cation nano-carrier according to the mass ratio of 1: 1, and a nano-platform is formed through self-assembly and is used for targeted delivery of double-stranded RNA (dsRNA). The compound provided by the invention can significantly reduce the degradation rate of dsRNA in a plant leaf surface environment, can penetrate through a plant leaf cuticle and enter mesophyll tissue, so that larvae latent in the leaf can intake the compound, and the dsRNA targeted to LtCht2 is designed to specifically cut LtCht2 mRNA through the RNA interference pathway effect in the larva body, so that chitin metabolism disorder is caused, and the expression of the LtCht2 in the larva body is inhibited. Therefore, normal pupation and eclosion of the larvae are blocked, and finally the purpose of controlling the population of the liriomyza clover is achieved.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of pest control, and particularly relates to a dsRNA for controlling Liriomyza trifolii and a pesticide compound thereof. BACKGROUND

[0002] Liriomyza trifolii (Liriomyza trifolii) Belonging to Diptera (Diptera) Agromyzidae (Agromyzidae) is an important worldwide invasive pest. The pest was first discovered in North America, and gradually spread with global trade of agricultural products and flow of plant materials. At present, it has formed a wide distribution in more than 80 countries and regions in Asia, Europe, Africa and Oceania. Since it was first recorded in Guangdong, China in 2005, the pest has rapidly spread to South China and East China, and has caused significant influence on facility agriculture and field cultivation crops.

[0003] The larvae of Liriomyza trifolii mainly feed on host leaves in a tunnel-like manner between leaf tissues, forming obvious white tunnels, weakening the photosynthetic capacity of leaves, and leading to inhibited plant growth, reduced yield and decreased commodity value. When the occurrence is serious, the host crop leaves will be yellow and withered on a large scale, causing certain losses. The host range of the pest is very wide, and it can harm hundreds of crops of more than 20 plant families such as Leguminosae, Solanaceae, Asteraceae and Cucurbitaceae. Especially, it can harm vegetables, flowers, legumes and ornamental plants, and therefore is listed as one of the transnational quarantine pests in agricultural production.

[0004] In agricultural production practice, chemical pesticides are the main means to control Liriomyza trifolii at present. Commonly used pesticides include indoxacarb (indoxacarb) , pyrethroid (pyrethroids) , avermectin (avermectins) and the like. These pesticides can effectively reduce the number of pest populations in the field through contact or stomach poisoning, and to some extent, protect crops from damage. With the development of pesticide science, chemical control is still one of the important measures to ensure agricultural yield at present. However, although chemical pesticides can inhibit pest populations in the short term, due to long-term and large-area dependence on pesticides with the same action mechanism, the result is that the pest population develops resistance, and the pesticides accumulate in the environment and migrate along the food chain, causing poisoning and pollution of non-target organisms and ecosystems.

[0005] With the progress of molecular biology and modern entomology, RNA interference (RNAi) technology has gradually become an important research direction in the field of pest molecular control. RNAi is a conserved gene silencing mechanism mediated by double-stranded RNA (dsRNA), which can achieve specific silencing of target genes by guiding the degradation of specific mRNA. In insects, RNAi can interfere with the normal physiological process of pests by inhibiting the function of genes closely related to growth, development, reproduction and survival, and even leading to death. RNAi technology has not only been intensively studied in model insects Drosophila melanogaster and mosquitoes, but also gradually applied to the exploration of agricultural pest control, and is generally considered as an important development direction of the new generation of green pesticides. (Drosophila melanogaster)

[0006] However, as a molecular control means, RNA interference (RNAi) is limited in practical application in many aspects, such as: double-stranded RNA (dsRNA) is rapidly degraded by ultraviolet light, high temperature, microorganisms and exogenous nucleases when exposed in the field, and its stability is difficult to maintain, and its macromolecular structure is hindered by the barrier of plant cuticle, wax layer and trichome, resulting in difficulty in effectively entering the mesophyll tissue and achieving systemic transportation, especially the larvae that feed on the inside of the leaf are difficult to ingest through conventional spraying; in insects, exogenous dsRNA needs to cross the body wall or intestinal epithelium, and due to the presence of nucleases in the intestinal cavity and hemolymph and the action of endosome-lysosome pathway, the molecules are often degraded or insufficiently transported, and the response difference of different insect groups and developmental stages makes the silencing effect unstable; if the sequence specificity and population genetic difference are not fully considered in the selection of target genes, non-target silencing is easily caused. SUMMARY

[0007] Therefore, the purpose of the present application is to provide a dsRNA for controlling Liriomyza trifolii and a pesticide complex thereof. The formed complex can significantly reduce the degradation rate of dsRNA in the surface environment of plant leaves, can penetrate the cuticle of plant leaves and enter the mesophyll tissue, so that the larvae that feed on the inside of the leaves can ingest, and the dsRNA designed to target LtCht2 the dsRNA can be specifically cut LtCht2 mRNA in the body of the larvae through the RNA interference pathway, leading to chitin metabolic disorder, thereby blocking the normal pupation and eclosion of the larvae, and finally achieving the purpose of controlling the population of Liriomyza trifolii.

[0008] In order to achieve the above purpose, the technical scheme adopted by the present application is as follows: The first aspect of the present application is to provide a dsRNA for controlling Liriomyza trifolii, which is transcribed from a target gene segment of a Liriomyza trifolii LtCht2 gene, LtCht2 ​The dsRNA of the application is double-stranded RNA, which is composed of a sense strand and an antisense strand, the nucleotide sequence of the sense strand is as shown in SEQ ID. No. 1, and the nucleotide sequence of the antisense strand is the reverse complement sequence of SEQ ID. No. 1.

[0009] The nucleotide sequence of the sense strand of the dsRNA as shown in SEQ ID. No. 1 is as follows: AACAUGAGCUGCAGGAGUUAUGAUCUGGUCUGUGGACACGGAUGAUUUUCGUGGGAAUUGCUUUACUCCCACGGAUACCUAUGCTGACUACAAAUAUCAGCCAACAAGUCGGCGUACAAAUUUCACCAAUUAUGUGCUGUUACGUACAGUUAAUGAAGCCACAGUGUUAGCAUUGGAGGCGAUUAGCAAUGAUUUCAAUCCGGAUACCAACUUUGAUAAUAAAUUCAGCUCAACAGAGUCUACUUCGACUGAUGGCAACCGCAUCAUGGUGAUAAUGGUGAUAAAAAUGUGAUUGAUGAUACUAUGAAUGAAAAUACCACACGGCACAAUAUACGAUAGAAAGACUUCGGCUGGUAAUAUGCUGCAAACUACGCCCAUAGCAU The second aspect of the application is to provide a target gene segment for preventing and treating Liriomyza trifolii, which is a target gene segment of Liriomyza trifolii Cht2 The target gene segment of the gene, the sequence of the double-stranded DNA sense strand is as shown in SEQ ID. No. 2.

[0010] The nucleotide sequence as shown in SEQ ID. No. 2 is as follows: AACATGAGCTCGCAGGAGTTATGATCTGGTCTGTGGACACGGATGATTTTCGTGGGAATTGCTTTACTCCCACGGATACCTATGCTGACTACAAATATCAGCCAACAAGTCGGCGTACAAATTTCACCAATTATGTGCTGTTACGTACAGTTAATGAAGCCACAGTGTTAGCATTGGAGGCGATTAGCAATGATTTCAATCCGGATACCAACTTTGATAATAAATTCAGCTCAACAGAGTCTACTTCGACTGATGGCAACCGCGATCATGGTGATAATGGTGATAAAAATGTGATTGATGATACTATGAACGAAATACCACACGGCACAATATACGATAGAAAGACTTCGGCTGGTAATATGCTGCAACTTACGCCCATAGCAT The third aspect of the present application provides an RNA pesticide compound for preventing and treating Liriomyza trifolii, the RNA pesticide compound comprising the dsRNA.

[0011] The dsRNA is prepared by in vitro transcription or in vivo vector expression, the in vitro transcription comprising the following steps: using a primer with a T7 promoter sequence to PCR amplify LtCht2 a gene fragment, using the amplification product as a template to transcribe and synthesize the dsCht2.

[0012] In an alternative embodiment, the RNA pesticide compound further comprises a nano-carrier.

[0013] In an alternative embodiment, the nano-carrier is an SPc star cationic nano-carrier.

[0014] In an alternative embodiment, the mass ratio of the dsRNA and the SPc star cationic nano-carrier is 1:1.

[0015] Compared with the prior art, the present application has the following beneficial effects: The present application mines a target gene that plays a key role in the pupation and eclosion process of Liriomyza trifolii larvae LtCht2 (chitinase 2), and designs and synthesizes a dsRNA targeting LtCht2 the target gene, which can target and specifically cut the target gene in the Liriomyza trifolii larvae through the RNA interference pathway in the larvae. LtCht2mRNA (i.e., specifically silencing the gene) leads to chitin metabolism disorder, which can effectively block the normal pupation and emergence of larvae, ultimately achieving the goal of controlling the clover leafminer population; by loading dsRNA onto a nanocarrier to form a nanocomposite with a smaller particle size, the dsRNA can be effectively protected from field ultraviolet rays, high temperatures and nuclease degradation, which can effectively improve the stability and permeability of dsRNA in the field, allowing dsRNA to penetrate the cuticle of plant leaves and enter the mesophyll tissue, so that larvae feeding inside the leaves can ingest it, thus improving the control effect. Attached Figure Description

[0016] Figure 1 This is a particle size distribution diagram of the SPc-dsCht2 nanocomposite material of the present invention; Figure 2 The results of gel retardation electrophoresis of the SPc-dsCht2 nanocomposite material of this invention are shown below. Figure 3 This invention relates to the effects of the SPc-dsCht2 nanocomposite material on the silencing efficiency of target genes and development. Detailed Implementation

[0017] The present invention will be further illustrated below with reference to embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0018] Example 1 Clover leafminer LtCht2 Synthesis of dsRNA in genes I. Clover leafminer tested Trifoliate leafminer ( Liriomyza trifolii ) populations under controlled conditions in cowpea ( Vigna unguiculata Rearing on plants: Temperature 25 ± 1℃, relative humidity 65 ± 5%, photoperiod of 16 hours light, 8 hours darkness. Larvae, pupae, and adults were collected at specific developmental stages for subsequent experiments. Healthy cowpea plants were cultivated in a greenhouse or grow box under the same conditions, with regular watering to maintain soil moisture and ensure normal growth. Leaf spraying tests and stability experiments were conducted using plants at the 3-4 true leaf stage.

[0019] II. Synthesis of dsRNA Total RNA was extracted from larvae of the clover leafminer using the VeZol Reagent kit (R411-01, Novizumi Biotechnology Co., Ltd., Nanjing). cDNA was synthesized using the HiScript III 1st Strand cDNA Synthesis Kit (R312-01, Novizumi Biotechnology Co., Ltd., Nanjing). Clover leafminer larvae were obtained from the Insectbase database. LtCht2 Primers containing the T7 promoter were designed based on the coding region sequence of the gene (number Ltri005460.1), and primers for dseGFP synthesis were also designed. Using these primers (primer sequences are shown in Table 1), PCR amplification was performed using *Leymus chinensis* cDNA (template for amplifying dsCht2) and a plasmid containing the eGFP gene (template for amplifying dseGFP), respectively. The PCR products were verified by agarose gel electrophoresis and then purified. Using the purified PCR products as templates, dsRNA was synthesized and purified in vitro according to the instructions of the T7 RNAiTranscription Kit (TR102-01, Nanjing Novizan Biotechnology Co., Ltd., Nanjing). dsRNA quality was assessed by 1% agarose gel electrophoresis, and dsRNA concentration was measured using a micro-UV spectrophotometer. The aliquots were then stored at -80℃.

[0020] The dsRNA synthesized using this method includes two types: one is dseGFP, which serves as a control group and targets the non-endogenous gene enhancing green fluorescent protein eGFP of the clover leafminer. This dsRNA has no interference effect on the clover leafminer's own genes and is used to compare RNAi efficiency. The other group is the dsCht2 treatment group, which targets the endogenous gene of the clover leafminer. LtCht2 The dsRNA sequence is shown in SEQ ID. No. 1. The synthesis methods for both groups of dsRNA are the same, differing only in the primers and template DNA used. The primer sequences used for the dseGFP and dsCht2 groups are detailed in Table 1. The dsRNA of the eGFP gene is double-stranded, consisting of a sense strand and an antisense strand. The nucleotide sequence of the sense strand is shown in SEQ ID. No. 3, and the nucleotide sequence of the antisense strand is the reverse complementary sequence of SEQ ID. No. 3. The target gene region of the eGFP gene has a double-stranded DNA sense strand sequence shown in SEQ ID. No. 4.

[0021] The nucleotide sequence described in SEQ ID. No. 3 is as follows: GGCCACAAGUUCAGCGTGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAUGCUUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCAAUUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAAACGCAUCGAGCUGGAGGGCAUCGACUUCAAGGAGGACGGCAAUAUCCUGGGGCACAAGCUGGAGUACAAUUACAACAGCCACAACGUCAUAUCAUGGCCGACAAGCAGAAGAACGGCGUCAAGGUGAAC wherein the nucleotide sequence of SEQ ID. No. 4 is as follows: GGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAAC

[0022] Example 2 Preparation and characterization of SPc-dsRNA (SPc-dsCht2) pesticide complex I. Preparation of the Pesticide Compound Take the dsCht2 solution with a concentration of 2 μg / μL, and add an equal volume of 2 μg / μL SPc solution; let stand at room temperature (25°C) for 15 min to allow self-assembly of dsCht2 and SPc into nanocomposite SPc-dsCht2.

[0023] It should be noted that the specific preparation method of the SPc star cationic nanocarrier is referred to in the patent document CN108794710B, which will not be described in detail here.

[0024] II. Particle size determination (I) Experimental process In order to preliminarily characterize the physicochemical properties of the SPc nanocomposite, the dynamic light scattering (DLS) technique was used to determine the particle size changes of different treatment groups. dsCht2 was used as a template, and two treatment groups were set up: (1) dsCht2 group (bare dsRNA control); (2) dsCht2+SPc group (SPc-dsCht2 complex).

[0025] The particle size distribution of each group of samples was detected on the machine, and the effect of the combination of SPc nanomaterials and dsRNA on the particle characteristics was evaluated.

[0026] (II) Experimental results and analysis The results are shown in Figure 1 The particle size analysis results show that, compared with dsCht2 and unloaded SPc nanoparticles, the particle size of the SPc-dsCht2 complex is significantly increased, indicating that the SPc-dsCht2 complex is successfully formed, and the particle size is about 238 nm.

[0027] III. Gel retardation assay (I) Experimental process In order to further verify the successful formation of the SPc nanocarrier-dsCht2 complex, a gel retardation assay was performed. First, dseGFP was mixed with SPc at a mass ratio of 1:1, and allowed to stand at room temperature for 15 min to promote the formation of the SPc-dseGFP complex. Subsequently, an equal amount of sample (SPc-dseGFP, SPc-dsCht2) was subjected to 1% agarose gel electrophoresis, run at the same voltage, and stained with a nucleic acid dye. The bare dsRNA group was used as a control to observe the normal migration behavior of the unbound dsRNA.

[0028] (II) Experimental results and analysis The results are shown inFigure 2 As shown, naked dsRNA [dsRNA (dseGFP) and dsRNA (dsCht2)] migrates clearly in the agarose gel, with a band visible at approximately 500 bp. However, when dsRNA (dseGFP and dsCht2) are complexed with SPc respectively, their band migration is significantly weakened and they remain at the sample well, indicating that dsRNA and SPc form a stable complex structure. After complexation, the surface charge of the particles is partially neutralized, thereby reducing their migration ability in the gel.

[0029] Different dsRNA sequences [dsRNA (dseGFP) and dsRNA (dsCht2)] exhibited similar band retention after binding to SPc, indicating that the binding of SPc nanomaterials to dsRNA is universal. This result verifies the successful construction of the complex and lays the foundation for subsequent delivery and interference experiments.

[0030] Example 3 Bioactivity determination of SPc-dsCht2 nanocomposite I. Experimental Procedure To further verify the effects of the SPc-dsCht2 nanocomposite on the silencing effect of target genes and the developmental phenotype of insects, this experiment will target the gene... LtCht2 The dsRNA (dsCht2) was prepared in two treatment forms, with SPc-dseGFP used as a negative control group.

[0031] (1) dsRNA (dsCht2) group, that is, dsRNA dissolved in ddH2O.

[0032] (2) SPc-dsCht2 complex, which is to mix dsRNA (dsCht2) with SPc nanomaterials in a 1:1 ratio to form a stable nanocomposite.

[0033] (3) SPc-dseGFP complex, which is to mix dsRNA (dseGFP) with SPc nanomaterials in a 1:1 ratio to form a stable nanocomposite.

[0034] Subsequently, the three treatments were applied to foliar leafminer larvae via foliar spraying, with the SPc-dseGFP treatment group serving as a negative control. Samples were collected at predetermined time points after treatment, and the transcriptional level of the target gene was detected using qRT-PCR. Developmental indicators such as pupation rate, emergence rate, and emergence time were recorded to evaluate the gene silencing effect and its biological impact.

[0035] II. Experimental Results and Analysis like Figure 3As shown in Figure A, the expression levels of target genes in the SPc-dsCht2 group were significantly lower than those in the dsRNA (dsCht2) group and the SPc-dseGFP group. This indicates that SPc-dsCht2 nanocomposites can enhance gene silencing efficiency.

[0036] like Figure 3 As shown in Figures B and C, the pupation rate and eclosion rate of the SPc-dsCht2 group were significantly lower than those of the dsRNA (dsCht2) group and the SPc-dseGFP group. This indicates that gene silencing has a significant inhibitory effect on insect development; while the effects of the dsRNA (dsCht2) group and the SPc-dseGFP group are relatively weak.

[0037] like Figure 3 As shown in Figure D, the eclosion time of the SPc-dsCht2 group was significantly prolonged compared to the dsRNA (dsCht2) group and the SPc-dseGFP group. This further demonstrates that the SPc-dsCht2 group has stronger biological activity and a more durable interference effect.

[0038] Based on the above indicators, the SPc-dsCht2 nanocomposite can effectively improve the interference efficiency of dsRNA on the genes of the clover leafminer fly, thereby enhancing the phenotypic effect.

[0039] Although the present invention has been described using the above preferred embodiments, it is not intended to limit the scope of protection of the present invention. Any changes and modifications made by those skilled in the art to the above embodiments without departing from the spirit and scope of the present invention shall still fall within the scope of protection of the present invention.

Claims

1. A dsRNA for controlling Liriomyza trifolii, characterized in that, The dsRNA is double-stranded RNA, which is composed of a sense strand and an antisense strand, the nucleotide sequence of the sense strand is shown as SEQ ID. No. 1, and the nucleotide sequence of the antisense strand is the reverse complement sequence of SEQ ID. No.

1.

2. An RNA pesticide complex for controlling clover leafminer, characterized in that, The RNA pesticide complex comprises the dsRNA of claim 1.

3. The RNA pesticide complex for controlling Liriomyza trifolii of claim 2, characterized by, The RNA pesticide complex further comprises a nano-carrier.

4. The RNA pesticide complex for controlling Liriomyza trifolii of claim 3, wherein the RNA pesticide complex is a double-stranded RNA having a sequence of 5'-GGGAAUUGUUGUUGUUGUCCU-3' (SEQ ID NO: 1). The nano-carrier is an SPc star cationic nano-carrier.

5. The RNA pesticide complex for controlling Liriomyza trifolii of claim 4, wherein the RNA pesticide complex is a double-stranded RNA having a sequence of 5'-GGGAAUUGUUGUUGUUGUCCU-3' (SEQ ID NO: 1). The mass ratio of the dsRNA and the SPc star cationic nano-carrier is 1:1.

Images