Reference gene for Chinese olive functional gene expression analysis and application thereof
By screening out the most stable internal reference genes RPN2B, NIFS1, and/or RPS16 in Chinese olive, the problem of unstable expression of traditional internal reference genes in woody plants was solved, achieving high accuracy and stability in the functional gene expression analysis of Chinese olive. Dedicated detection primers and kits were provided to support the accurate quantification of functional gene expression.
Patent Information
- Application Number
- CN202511072675.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-31
- Publication Date
- 2025-12-05
AI Technical Summary
The lack of stable internal reference genes for gene expression analysis of Chinese olive in existing technologies leads to low data reliability. Furthermore, the expression of traditional internal reference genes in woody plants is highly volatile and easily affected by developmental stage and environmental stress, making it impossible to accurately quantify the expression level of functional genes.
The most stably expressed internal reference genes RPN2B, NIFS1, and/or RPS16 in different varieties and developmental stages of Chinese olives were screened out, and primers specifically for the detection of Chinese olive fruits were provided to assist in gene expression analysis using real-time PCR.
This significantly improved the specificity, stability, and accuracy of functional gene expression analysis data, providing strong support for functional gene expression analysis of olives in China and enhancing the reliability and accuracy of the data.
Smart Images

Figure BDA0005529526120000141 
Figure BDA0005529526120000151 
Figure BDA0005529526120000162
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology, and in particular to an internal reference gene for the analysis of functional gene expression in Chinese olives and its application. Background Technology
[0002] Olive (Canarium album L.), also known as green olive, white olive, white olive, yellow olive, etc., is native to my country and is a medicinal and edible resource belonging to the genus *Olive* of the family Burseraceae. Its English name is Chinese olive. The fruit is rich in vitamins, terpenes, and phenolic active substances, possessing antioxidant and anti-inflammatory pharmacological activities, and has significant potential for application in functional foods and medicine. Currently, Fujian Province, as the core production area, has achieved large-scale cultivation; however, technical bottlenecks remain in molecular-level variety improvement and research on the regulation of active ingredients, necessitating the establishment of a precise gene expression analysis system to support its industrial development.
[0003] Real-time quantitative PCR (qRT-PCR) is a core technology for gene expression analysis, and the reliability of its data highly depends on the stability of internal reference genes. Traditional internal reference genes (such as ACT, GAPDH, 18S rRNA, etc.) have significant limitations in plants. In woody plants, their expression generally fluctuates greatly and is easily affected by developmental stages (such as fruit maturity) and environmental stresses, leading to distortion of the quantitative results of target genes.
[0004] Currently, the screening of reference genes for Chinese olives faces the following technical challenges: the lack of a dedicated reference system, leading to low data reliability due to the direct application of reference genes from other plants; underutilization of transcriptome resources, with potential stable genes not systematically explored in existing olive transcriptome data; and a lack of comprehensive stability verification across varieties (e.g., 'Changying' and 'Huiyuan') and tissues (leaves, fruits, roots). To accurately quantify the expression level of target genes, suitable reference genes need to be screened. Currently, there are no reports on the systematic screening and verification of reference genes for Chinese olives. Summary of the Invention
[0005] In view of this, the present invention provides internal reference genes for the analysis of functional gene expression in Chinese olives and their applications. Through extensive data analysis and a rigorous internal reference gene screening procedure, the present invention identifies the most stably expressed internal reference genes RPN2B, NIFS1, and / or RPS16 in fruits from different varieties (lines) and at different developmental stages of Chinese olives. These genes can be used for the expression analysis of nutritional quality or other functional genes in Chinese olive fruits from different varieties (lines) and at different developmental stages, significantly improving the specificity, stability, and accuracy of functional gene expression analysis data, and providing strong support for the analysis of functional gene expression in Chinese olives. The present invention also provides detection primers specifically for the detection of internal reference genes in Chinese olive fruits. These primers can assist in the analysis of gene expression levels and functions through quantitative real-time fluorescence in Chinese olive functional research, demonstrating high application value.
[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0007] This invention provides an internal reference gene for the analysis of functional gene expression in Chinese olive, wherein the internal reference gene is one, two, or more of RPN2B, NIFS1, or RPS16;
[0008] (I) The nucleotide sequence of RPN2B is shown in SEQ ID NO.1, the nucleotide sequence of NIFS1 is shown in SEQ ID NO.3, and the nucleotide sequence of RPS16 is shown in SEQ ID NO.4; or
[0009] (II) A nucleotide sequence that encodes the same protein as the nucleotide sequence shown in (I), but differs from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or
[0010] (III) A nucleotide sequence having one or more nucleotide sequences obtained by substitution, deletion, or addition of the nucleotide sequence shown in (I) or (II), and having the same or similar function as the nucleotide sequence shown in (I) or (II); or
[0011] (IV) A nucleotide sequence having at least 90% sequence homology with the nucleotide sequences described in (I), (II) or (III).
[0012] The present invention also provides primers for detecting the internal reference gene, comprising:
[0013] (I) The primers for detecting RPN2B have nucleotide sequences as shown in SEQ ID NO.13 and SEQ ID NO.14; or
[0014] The primers for detecting NIFS1 have nucleotide sequences as shown in SEQ ID NO.17 and SEQ ID NO.18; or
[0015] The primers for detecting RPS16 have nucleotide sequences as shown in SEQ ID NO.19 and SEQ ID NO.20; or
[0016] (II) A nucleotide sequence that encodes the same protein as the nucleotide sequence shown in (I), but differs from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or
[0017] (III) A nucleotide sequence having one or more nucleotide sequences obtained by substitution, deletion, or addition of the nucleotide sequence shown in (I) or (II), and having the same or similar function as the nucleotide sequence shown in (I) or (II); or
[0018] (IV) A nucleotide sequence having at least 90% sequence homology with the nucleotide sequences described in (I), (II) or (III).
[0019] The present invention also provides a detection reagent or kit for detecting the expression level of an internal reference gene, including the primers described above.
[0020] This invention also provides the application of any of the following in the analysis of functional gene expression in Chinese olives:
[0021] (I) the aforementioned internal reference gene; and / or
[0022] (II) the primers described above; and / or
[0023] (III) The aforementioned detection reagents or kits.
[0024] In some specific embodiments of the present invention, the Chinese olive functional genes include genes related to starch and sucrose metabolism pathways and / or genes related to phenylpropane metabolism pathways.
[0025] In some specific embodiments of the present invention, the starch and sucrose metabolism pathway-related genes include TPS9 and / or ISA3; the phenylpropane metabolism pathway-related genes include PER64 and CYP98A2.
[0026] The nucleotide sequence of the TPS9 is shown in SEQ ID NO.9; the detection primers have the nucleotide sequences shown in SEQ ID NO.29 and SEQ ID NO.30.
[0027] The nucleotide sequence of ISA3 is shown in SEQ ID NO.10; the detection primers have the nucleotide sequences shown in SEQ ID NO.31 and SEQ ID NO.32.
[0028] The nucleotide sequence of PER64 is shown in SEQ ID NO.11; the detection primers have the nucleotide sequences shown in SEQ ID NO.33 and SEQ ID NO.34.
[0029] The nucleotide sequence of CYP98A2 is shown in SEQ ID NO.12; the detection primers have the nucleotide sequences shown in SEQ ID NO.35 and SEQ ID NO.36.
[0030] In some specific embodiments of the present invention, the Chinese olives include olive fruits of different varieties or at different developmental stages.
[0031] In some specific embodiments of the present invention, when performing functional gene expression analysis on olive fruits of different varieties and different developmental stages, the internal reference gene includes RPN2B;
[0032] When used for functional gene expression analysis of olive fruits of the different varieties, the internal reference gene includes one, two or more of RPN2B, RPS16 or NIFS1;
[0033] When used for functional gene expression analysis of olive fruits of different varieties and different developmental stages, the internal reference genes include one, two or more of RPN2B, NIFS1 or RPS16.
[0034] The present invention also provides a method for detecting the expression level of functional genes in Chinese olive, comprising using any of the internal reference genes or combinations thereof as internal references, and using the primers or combinations thereof for detection to obtain the expression level of the functional genes in Chinese olive.
[0035] In some specific embodiments of the present invention, the detection method includes real-time quantitative PCR.
[0036] This invention also provides a method for improving the stability of Chinese olive functional gene detection, comprising using any of the internal reference genes or combinations thereof as internal references, and using the primers or combinations thereof to detect the expression level of the Chinese olive functional genes.
[0037] This invention provides the following beneficial effects:
[0038] Through extensive data analysis and a rigorous internal reference gene screening procedure, this invention has, for the first time, identified candidate internal reference genes that are stably expressed in Chinese olives. From these candidates, the most stably expressed internal reference genes RPN2B, NIFS1, and / or RPS16 were selected from fruits of different varieties (lines) and at different developmental and maturity stages in Chinese olives. These genes can be used for the expression analysis of nutritional quality or other functional genes in Chinese olive fruits of different varieties (lines) and at different developmental and maturity stages, significantly improving the specificity, stability, and accuracy of functional gene expression analysis data, and providing strong support for the functional gene expression analysis of Chinese olives.
[0039] This invention also provides a set of detection primers specifically for detecting internal reference genes in Chinese olive fruits. These primers can be used to assist in the analysis of gene expression levels and functions through quantitative fluorescence in Chinese olive functional studies, and have high application value. Attached Figure Description
[0040] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.
[0041] Figure 1 The image shows the amplification diagrams of eight candidate internal reference genes, where 1 to 8 represent: RPN2B, PIP1.4, NIFS1, RPS16, At5g12110, HSC-2, ABCG44, and LOS1, respectively.
[0042] Figure 2 The diagram shows the amplification of four target genes, where 9-12 represent TPS9, ISA3, PER64, and CYP98A2, respectively.
[0043] Figure 3 Figure showing the primer specificity analysis of RT-qPCR amplification of 8 candidate internal reference genes—melting curves;
[0044] Figure 4 This is a heatmap showing the expression levels of the candidate internal reference genes established in Experiment Example 3 of the present invention.
[0045] Figure 5 The Cq values of eight candidate internal reference genes are shown. The value of each sample is the average of three technical replicates and three biological replicates. The boxes in the figure represent 25%-75% of the data, the horizontal line represents the median, and the black dots represent the mean. Among them, A: expression level of 44 varieties (lines) (see Table 3); B: expression level at different developmental and maturation stages (the sampling time for fruit development was 40 days, 55 days, 70 days, 95 days, 120 days, 155 days, and 190 days after flowering, a total of 7 stages, and the varieties (lines) were 'Qingguo No. 1 (A7)' and 'Qingpilan (A21)').
[0046] Figure 6 The results of the Genorm analysis are shown, where A: average stable expression value of different varieties in the Genorm analysis, B: average stable expression value of samples at different developmental stages in the Genorm analysis, C: the optimal number of reference genes determined in different varieties, and D: the optimal number of reference genes determined in different developmental stages.
[0047] Figure 7 The results of NormFinder analysis are shown in Figure A: expression stability values of different varieties in NormFinder analysis, and Figure B: expression stability values of different developmental stages in NormFinder analysis.
[0048] Figure 8 This study demonstrates the validation of the stability of different internal reference genes for four target genes in olive fruits at different developmental and maturation stages. A: Olive fruits at different developmental and maturation stages (variety A5); B: Validation in TPS9; C: Validation in ISA3; D: Validation in PER64; E: Validation in CYP98A2.
[0049] Figure 9 This study demonstrates the validation of the stability of four target genes in different varieties of olive fruit and different internal reference genes. Among them, A: different varieties (lines) of olive fruit; B: validation in TPS9; C: validation in ISA3; D: validation in PER64; E: validation in CYP98A2. Detailed Implementation
[0050] This invention discloses an internal reference gene for functional gene expression analysis in Chinese olives and its application. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired result. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.
[0051] The purpose of this invention is to provide an internal reference gene for fruits of different varieties (lines) of Chinese olives and fruits at different developmental stages, and its application in the detection of internal reference genes and the quantitative fluorescence expression analysis of functional genes in Chinese olives.
[0052] To achieve the above objectives, this invention provides an internal reference gene for fruits of different developmental stages and varieties (lines) of Chinese olive. This internal reference gene is RPN2B, and its nucleotide sequence is shown in SEQ ID NO.1. The fruits at different developmental stages are those from 40 to 190 days after flowering. The different varieties (lines) include fruits from 33 germplasm resources. The internal reference gene provided by this invention can be used for real-time quantitative fluorescence analysis and expression analysis in Chinese olive gene research.
[0053] The present invention also provides a detection primer for the above-mentioned internal reference gene, the nucleotide sequence of which is shown in SEQ ID NO.13 and SEQ ID NO.14.
[0054] The present invention also provides an internal reference detection method for Chinese olive fruit, specifically, PCR amplification of the extracted Chinese olive genome using detection primers with nucleotide sequences as shown in SEQ ID NO.13 and SEQ ID NO.14.
[0055] The technical solution of the present invention has the following advantages:
[0056] Through extensive data analysis and a rigorous internal reference gene screening procedure, this invention has, for the first time, identified candidate internal reference genes that are stably expressed in Chinese olives. From these candidates, the most stably expressed internal reference gene, RPN2B, was selected from fruits of different varieties (lines) and at different developmental and maturation stages in Chinese olives. This gene can be used for the expression analysis of nutritional quality or other functional genes in Chinese olive fruits of different varieties (lines) and at different developmental and maturation stages, significantly improving the specificity, stability, and accuracy of functional gene expression analysis data, and providing strong support for the functional gene expression analysis of Chinese olives.
[0057] This invention also provides a set of detection primers specifically for detecting internal reference genes in Chinese olive fruits. These primers can be used to assist in the analysis of gene expression levels and functions through quantitative fluorescence in Chinese olive functional studies, and have high application value.
[0058] The information of the 8 candidate internal reference genes and 4 target genes in this invention is as follows:
[0059] RPN2B (SEQ ID NO.1):
[0060]
[0061] PIP1.4(SEQ ID NO.2):
[0062] ATGGAGGACAAGGAAGAGGATGTTAGATTGGGAGCCAACAAGTTCACCGAGAGGCAGCCAATTGGAACAGCTGCTCAGAGCCAAGATGGCAAGGATTACACTGAGCCGCCACCTGCTCCACTTTTCGAGCCCAGCGAGCTCATTTCTTGGTCGTTTTACAGGGCCGGGATCGCTGAGTTCGTGGCCACTTTCCTCTTCTTGTACATCACTGTTTTGACCGTTATGGGCGTGCTCAGGAGCGATAATAAGTGTAAATCAGTTGGGATTCAAGGGATTGCTTGGGCTTTTGGTGGCATGATCTTCGCTCTAGTCTACTGCACTGCTGGCATCTCAGGCGGTCACATAAACCCGGCTGTGACTTTTGGACTGTTTTTGGCACGCAAGCTGTCGTTGACACGTGCCATTTTCTACATGGTGATGCAGTGCCTTGGTGCAATCTGCGGTGCTGGTGTGGTGAAGGGTTTCCAAGGAGACAGCAGATACGAGTTCTATGGAGGTGGAGCTAACTCCGTCAACCACGGTTACACCAAGGGTGATGGTCTTGGTGCTGAGATTGTTGGTACCTTTGTTCTTGTTTACACTGTTTTCTCTGCCACTGATGCCAAACGTAGTGCCAGAGACTCCCATGTTCCTATTTTGGCACCTTTGCCAATTGGTTTCGCTGTGTTCTTGGTTCACTTGGCCACCATTCCGATTACCGGAACCGGTATCAACCCAGCTAGGAGTCTTGGTGCCGCCATCATCTTCAACAGGGACCATGCCTGGGATGACCACTGGATTTTCTGGGTGGGACCATTCATTGGTGCAGCACTCGCAGCTTTATATCACCAGGTCGTGATCAGAGCCATTCCCTTCAAATCAAAG
[0063] NIFS1(SEQ ID NO.3):
[0064]
[0065] RPS16(SEQ ID NO.4):
[0066] CTTCTAGGGTTTCAAGCCACCACCAGGCACACGCATTACACAACACCACACACCAACCTCAACATGGCTGCTACTGCTGCTGCTGCTGCTTCTATCGAGTCCGTACAATGTTTCGGCCGCAAGAAGACGGCCGTTGCTGTTACCTACTGCAAGCGCGGCCGCGGCTTGATCAAGATCAACGGCTGCCCAATCGAGCTGGTGGAGCCGGAGATCCTCCGTTTCAAGGCCTACGAGCCGATCCTTTTGCTCGGACGACATCGTTTTGCCGGAGTCGACATGCGTATCCGAGTGAAAGGCGGTGGACACACCTCCCAGATCTACGCCATCCGTCAGAGCATTGCAAAGGCGTTGGTAGCGTTCTATCAGAAGTACGTGGACGAGCAAAGCAAGAAGGAAATTAAGGACATTTTGGTTCGGTATGATAGGACTTTGCTTGTGGCTGATCCGAGACGCTGCGAGCCTAAGAAGTTCGGAGGTCGTGGCGCCAGGGCTAGGTTCCAGAAATCTTACCGT
[0067] At5g12110(SEQ ID NO.5):
[0068] ATGGCCATCACTTTCTCAGATCTCCACACAGAGTCAGGCCTCAAGTCACTGGATGAGTATCTGTCTGGCAAATCTTACGTTTCTGGCGATAAGCTGACGAAGGATGACATCAAGGTCTACGCTGCCGTTTTGGTGAACCCGGGTGATTCCTTCCCCAATGCCAGTAAATGGTACCACTGCGTCTCTTCACATCTTGCCCCAAGCTTTCCTGGCAAAGCAGTTGGAGTGAGAATTTGTAGCAAGGGTGCTCCTGTTGTCGCCCAGGAAGCTCCAGCAGGAGATGATGATGACTTGGATCTCTTTGGAGATGAGACAGAGGAGGATAAGAAGGCAGCAGAGGAGAGGGAGGCAGCTAAAGCCAAATCTGCCAAGAAAAAAGAGAGTGGGAAATCTTCTGTTCTTTTGGATGTGAAGCCATGGGATGATGAGACAGACATGAAGAAGCTTGAAGAGGCGGCTAGGAGCATTGAGATGCCTGGTCTCTTGTGGGGAGCATCAAAACTTGTTCCAGTTGGTTATGGGATTAAGAAGATGCAAATCTTGCTTACAATTGTTGATGACCTTGTTTCCGTGGATTCACTTATAGAGGAACATCTTACTGTTGAGCCTTGCAGTGAATATGTCCAGAGCTGTGACATTGTTGCCTTCAACAAAATT
[0069] HSC-2(SEQ ID NO.6):
[0070]
[0071] ABCG44(SEQ ID NO.7):
[0072]
[0073] LOS1(SEQ ID NO.8):
[0074]
[0075] TPS9(SEQ ID NO.9):
[0076]
[0077] ISA3(SEQ ID NO.10):
[0078]
[0079] PER64(SEQ ID NO.11):
[0080] ATGGCAGCCATAGTCTCACTCATATTTGCGCTTCTCATCTTTCCAATTTCTTCTCCTGTTCGTGCACTGAGCTCGAACTATTATGACAAGACATGCCCCCAGGTCGAGACCACTGTTACCAGTGCCGTCAAAAAAGCAATGATGAGTGATAAAACAGTTCCAGCTGCGCTACTTCGCATGCATTTCCATGATTGCTTTATCAGAGGTTGCGATGCTTCTGTTTTGTTGAACTCAAAGGGGAAGAACAAAGCAGAGAAGGATGGGCCTCCTAACGTTTCACTACATGCATTTTACGTCATTGACAGTGCAAAGAAAGCAGTAGAAGCTTTGTGCCCTGGCGTGGTCTCTTGTGCTGATATTTTGGCTCTGGCTGCTCGGGATGCGGTTGCTCTGTCTGGAGGACCCACTTGGGATGTGCCAAAAGGGAGAAAAGATGGTAGAATTTCTATAGCTACTGATACCAGACAGTTGCCAGCTCCCACCTTCAACATTTCTCAACTTCAGCAAAGCTTCTCCCAGAGAGGTCTTTCATTGGAAGATCTCGTTGCTCTCTCAGGAGGCCATACCCTTGGCTTCTCTCACTGCTCGTCCTTCCAGAGCAGAATCCACGGATTCAATTCCACCTTTGACATCGATCCAACAATGAACCCATCTTTTGCAGCCAGTTTAAGAAACGTGTGTCCCGTACACAACAAGGTGAAAAATGCAGGTGCAACATTAGATTCCTCAACGACTGCGTTCGACAATGCATACTACAAGCTACTTCTACAAGGGAAGAGTCTTCTTTCTTCGGACCAAGCCCTACTCACCACTTCAAAGACTAAAGCATTGGTTTCCAAGTTTGGTACCTCCAAACAAGCCTTTGAAAAGGCCTTTGTGCAGTCCATGATCAAGATGAGTAGCATCACTGGTGGAACAGAGATCAGGCTCGACTGTAGACTAGTCAAT
[0081] CYP98A2(SEQ ID NO.12):
[0082]
[0083] Unless otherwise specified, the internal reference gene for functional gene expression analysis of Chinese olive provided by this invention, as well as the raw materials and reagents used in its application, are all commercially available.
[0084] The present invention will be further illustrated below with reference to the embodiments:
[0085] Example 1: Screening of candidate internal reference genes for mature fruits and developmental processes of different Chinese olive varieties (lines)
[0086] 1. Experimental materials and transcriptome sequencing
[0087] This invention uses three different olive varieties (lines) with different slag-forming properties as materials: 'Qingguo No. 1' (A7), 'Pingyang No. 2' (A25), and 'Qingpilan' (A21). Mature fruits were collected from the Fuzhou Olive Germplasm Resource Nursery (26°8'6"N, 119°15'58"E). Samples were taken evenly from all four directions (north, south, east, and west), selecting olive fruits free from disease, pests, and damage. Sampling was conducted at seven stages: 40, 55, 70, 95, 120, 155, and 190 days after flowering, for the varieties (lines) 'Qingguo No. 1' (A7) and 'Qingpilan' (A21). Thirty fruits were collected from each variety (line). After sampling, the samples were immediately brought back to the laboratory, sliced, and rapidly transferred to liquid nitrogen for quick-freezing and thorough mixing. All samples were stored at -80°C for subsequent transcriptome sequencing and real-time quantitative PCR.
[0088] 2. Screening of candidate internal reference genes
[0089] Based on the transcriptome sequencing results, eight candidate genes were screened as internal control genes according to the criteria of expression level FPKM≥10 and -1<log2FC<1. Four target genes were also selected: two genes from the starch and sucrose metabolism pathway (TPS9 and ISA3) and two genes from the phenylpropanoid metabolism pathway (PER64 and CYP98A2). Eight candidate internal control genes with relatively stable and high expression levels were selected. The candidate internal control genes and their nucleotide sequences are shown in Table 1.
[0090] Table 18 shows the information of candidate internal reference genes and 4 target genes.
[0091]
[0092] Example 2: Determination of internal reference genes in fruits of different Chinese olive varieties (lines) during the development and maturation process
[0093] 1. RNA extraction and cDNA synthesis
[0094] The olive samples preserved in Example 1 were thoroughly ground into powder in liquid nitrogen. 0.1 g of the sample powder ('Qingguo No. 1' (A7), 'Pingyang No. 2' (A25), 'Qingpilan' (A21)) was used for RNA extraction. RNA extraction was performed using the Tiangen Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (TIANGEN, Beijing, China). Specific procedures are detailed in the RNA extraction kit instructions. The extracted RNA was tested for purity and integrity using 1% agarose gel electrophoresis (180V, 16 min), and the RNA concentration was determined using a micro spectrophotometer (Q5000, Quawell, USA). A cDNA synthesis kit (ABclonal, Wuhan, China) was used for cDNA template synthesis. Before qRT-PCR, the purified cDNA sample was diluted 10-fold with ddH2O. The obtained cDNA was stored at -20℃ until qRT-PCR was performed. All samples were tested in triplicate (3 biological replicates and 3 technical replicates).
[0095] 2. Primer design
[0096] Based on the eight internal reference genes screened in Example 1 above, specific primers for the eight internal reference genes were designed using Primer3 Plus software. The melting temperature and primer sequences are shown in Table 2.
[0097] Table 2 Melting temperature and primer sequences
[0098]
[0099]
[0100] 3. qRT-PCR and amplification efficiency detection
[0101] After spotting samples into 96-well plates, qRT-PCR analysis was performed using a real-time quantitative PCR instrument (qTOWER3, AnalytikJena AG, Germany). The total reaction volume was 10 μL, containing 1 μL of diluted sample cDNA template, 5 μL of BrightCycle Universal SYBR Green qPCR Mix with UDG, 0.4 μL of primers, and 3.6 μL of ddH2O. The reaction program was set to 37℃ for 2 min, 95℃ for 3 min, for 40 cycles of 95℃ for 5 s and 60℃ for 34 s. Cq values and melting curves were obtained after the reaction. Each sample was subjected to three biological replicates and three technical replicates. The template cDNA was serially diluted 10-fold to five concentration gradients, and qRT-PCR was performed using different concentrations of cDNA as templates, with the same reaction volume and program as above. Standard curves were prepared for each candidate internal reference gene. The correlation coefficient (R2) and slope were obtained from the standard curves. The amplification efficiency (E) of each primer was calculated by combining E = (10-1 / slope-1) × 100%.
[0102] The efficiency of each primer pair ranges from 96% to 105%, R 2 All were above 99% (Table 3). The gene with the highest amplification efficiency was LOS1, and the lowest was ABCG44. This indicates that the primer pairs performed well in the experiment and could accurately reflect the amplification of the template. The experimental data had a high degree of fit with the standard curve and a good linear relationship, indicating that the 8 pairs of amplification primers had good specificity.
[0103] Simultaneously, the RT-qPCR melting curves of the candidate internal reference gene were obtained as follows: Figure 3 Melting curve analysis showed that individual amplification peaks were free of primer dimers or other target sequences, and exhibited good reproducibility, further confirming the high specificity of the eight candidate internal reference genes, all of which can be used for RT-qPCR detection of Chinese olive fruits. Figure 1 ).
[0104] Table 38 shows the amplification efficiency of candidate reference genes.
[0105]
[0106] Example 3: Stability analysis of internal reference genes
[0107] 1. Internal reference gene expression analysis
[0108] Based on the transcriptome data of eight candidate reference genes selected in the fruits of three olive varieties (lines): 'Qingguo No. 1' (A7), 'Pingyang No. 2' (A25), and 'Qingpilan' (A21), the results are as follows: Figure 4As shown, all eight candidate internal reference genes were expressed in the fruits of different varieties (lines) of Chinese olives, and the fluctuations of each candidate internal reference gene among different samples were small, i.e., the differences were not significant.
[0109] Eight stable genes were selected from the transcriptome database as candidate internal reference genes. Using cDNA from olive fruits at different developmental stages and of different varieties as templates, qRT-PCR was performed on these eight genes using the primers listed in Table 1 for detecting the eight candidate internal reference genes. The Cq values of the eight candidate internal reference genes were obtained, as shown below. Figure 5 As shown, the expression levels of the eight candidate internal control genes ranged from 16 to 25, while the Cq values of good internal control genes were between 15 and 30. This indicates that the selected candidate internal control genes meet the basic requirements for standardized use and can be stably expressed. Cq is an important parameter reflecting gene expression levels; a lower value indicates higher gene expression, and vice versa. Figure 5 As can be seen in (A), the expression of RPS16 and RPN2B is relatively concentrated and has a small fluctuation range in different varieties, while HSC-2 and At5g12110 are more dispersed, and their expression varies at different fruit development stages. Figure 5 (B) The two genes with the most concentrated distribution are NIFS16 and RPN2B, while HSC-2 and At5g12110 are the most dispersed. This result is consistent with the transcriptome sequencing results.
[0110] Table 441 Information on Different Varieties (Lineages) of Olives
[0111]
[0112] Note: A1 to A33 are olive varieties for internal screening, and B1 to B8 are olive varieties for verification of the target genes.
[0113] 2. Evaluation of internal reference gene stability
[0114] The expression stability of eight candidate internal reference genes in fruits of different Chinese olive varieties (lines) at different developmental and maturation stages was comprehensively analyzed using GeNorm, NormFinder, BestKeeper software, and the online platform RefFinder. The results are as follows: Figure 6 The smaller the obtained analytical value, the better the expression stability of the internal reference gene.
[0115] GeNorm analysis showed that the two genes with the lowest M values across different varieties were RPN2B and RPS16, followed by NIFS1. The M values of the top three genes were relatively close, but significantly different from those of PIP1.4 (M = 0.69), which ranked fourth. ABCG44 had the highest M value and was the most unstable. Figure 6A) At different developmental maturation stages, RPN2B and NIFS1 had the lowest M values and were the most stable, followed by RPS16. The gene with the highest M value and the least stable was PIP1.4. Figure 6 B). In both groups of samples, RPN2B tied for first place, while RPS16 and NIFS1 ranked differently in different groups.
[0116] NormFinder analysis results show that Figure 7 A. Among different varieties (lines), the internal reference gene with the lowest stability value was RPS16, followed by RPN2B and NIFS1, with LOS1 ranking fourth. The least stable candidate internal reference gene was PIP1.4. (The text abruptly ends here, so the translation stops as well.) Figure 7 B) The gene with the lowest stability value is RPN2B, followed by RPS16 and NIFS1, and the least stable gene is PIP1.4. The order is: RPN2B > RPS16 > NIFS1 > LOS1 > At5g12110 > HSC-2 > ABCG44 > PIP1.4.
[0117] The BestKeeper analysis is shown in Table 5. The stability ranking of different varieties (lines) is RPN2B > RPS16 > NIFS1 > PIP1.4 > LOS1 > At5g12110 > HSC-2 > ABCG44. The expression stability ranking of candidate internal reference genes at different developmental maturation stages is RPN2B > NIFS1 > ABCG44 > RPS16 > LOS1 > PIP1.4 > At5g12110 > HSC-2.
[0118] Table 5. Coefficient of variation and standard deviation calculated by BestKeeper
[0119]
[0120] The stability of eight candidate reference genes was analyzed using four methods: ΔCq, Genorm, NormFinder, and BestKeeper. The optimal reference gene was inconsistent, so the online platform RefFinder was used to further analyze the stability of the candidate reference genes and obtain a comprehensive score for each gene, which was then ranked (Table 6). The lower the score, the more stable the candidate reference gene. In different varieties, RefFinder recommended the gene stability ranking as follows: RPN2B > RPS16 > NIFS1 > At5g12110 > PIP1.4 > LOS1 > HSC-2 > ABCG44. At different developmental stages, RefFinder recommended the gene stability ranking as follows: RPN2B > NIFS1 > RPS16 > LOS1 > ABCG44 >
[0121] At5g12110 > PIP1.4 > HSC-2. In summary, the optimal internal reference genes for different varieties (lines) are, in descending order, RPN2B, RPS16, and NIFS1; the optimal internal reference genes for different developmental stages are, in descending order, RPN2B, NIFS1, and RPS16. RPN2B is the optimal internal reference gene for different varieties and developmental stages, but the overall scores and rankings of NIFS1 and RPS16 vary across different varieties and developmental stages. Among different varieties, RPS16 ranks higher than NIFS1; NIFS1 is more stable than RPS16 at different developmental stages.
[0122] Table 6 shows the comprehensive scores and rankings of candidate reference genes analyzed by RefFinder.
[0123]
[0124]
[0125] Example 4: Verification of the stability of internal reference gene expression
[0126] The three most stable internal reference genes (RPN2B, NIFS1, RPS16) and the one least stable internal reference gene (HSC-2) were selected, and their relative expression levels were analyzed against four target genes (TPS9, ISA3, PER64, CYP98A2). Figure 5 As shown, when RPN2B, NIFS1, and RPS16 were used as standardized internal reference genes, the expression levels of the four target genes showed similar trends during development, with RPN2B and NIFS1 showing even closer trends. When HSC-2 was used as the standardized internal reference gene, its expression level differed significantly from the other three. In TPS9 validation, the expression trend of HSC-2 as the internal reference gene during Chinese olive fruit development was significantly different from the other three. In the validation of the four target genes, the expression of HSC-2 as the target gene was lower than that of the other three internal reference genes. The results are consistent with the overall ranking; at different developmental and maturation stages, the stability of the internal reference genes was, in descending order, RPN2B, NIFS1, and RPS16, while HSC-2 is not suitable as an internal reference gene during olive development. Figure 8 )
[0127] Three relatively stable genes (RPN2B, NIFS1, and RPS16) selected from different varieties, and one least stable internal reference gene (LOS1), were analyzed for relative expression levels with the four target genes. For example... Figure 7As shown, when RPN2B, NIFS1, and RPS16 were used as standardized internal controls, the expression levels of the four target genes were relatively similar, with the relative expression trends being even closer when RPN2B and RPS16 were used as internal controls. When LOS1 was used as a standardized internal control, the expression levels of the four target genes in different varieties differed significantly from those using the other three internal control genes, consistent with the overall ranking obtained from RefFinder. Figure 9 )
[0128] In summary, RPN2B can serve as an internal reference gene for quantitative analysis of Chinese olive fruits across different varieties (lines) and developmental stages. Its use in quantitative fluorescence analysis and expression analysis of Chinese olive genes can significantly improve the specificity, stability, and accuracy of functional gene expression data, providing strong support for functional gene expression analysis in Chinese olives. RPN2B, RPS16, and NIFS1 can all be used as internal reference genes across different varieties (lines). RPN2B, NIFS1, and RPS16 can also be used as internal reference genes at different developmental stages.
[0129] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A reference gene for functional gene expression analysis of Chinese olive, characterized in that, the internal reference gene is one, two or more of RPN2B, NIFS1 or RPS16; (I) the nucleotide sequence of RPN2B is shown as SEQ ID NO. 1, the nucleotide sequence of NIFS1 is shown as SEQ ID NO. 3, and the nucleotide sequence of RPS16 is shown as SEQ ID NO. 4; or (II) a nucleotide sequence encoding the same protein as the nucleotide sequence shown in (I), but different from the nucleotide sequence shown in (I) due to the degeneracy of genetic code; or (III) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (I) or (II), and a nucleotide sequence functionally identical or similar to the nucleotide sequence shown in (I) or (II); or (IV) a nucleotide sequence having at least 90% sequence homology with the nucleotide sequence of (I), (II) or (III).
2. A primer for detecting the internal control gene according to claim 1, characterized by, comprising: (I) the primer for detecting RPN2B has a nucleotide sequence shown as SEQ ID NO. 13, SEQ ID NO. 14; or the primer for detecting NIFS1 has a nucleotide sequence shown as SEQ ID NO. 17, SEQ ID NO. 18; or the primer for detecting RPS16 has a nucleotide sequence shown as SEQ ID NO. 19, SEQ ID NO. 20; or (II) a nucleotide sequence encoding the same protein as the nucleotide sequence shown in (I), but different from the nucleotide sequence shown in (I) due to the degeneracy of genetic code; or (III) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (I) or (II), and a nucleotide sequence functionally identical or similar to the nucleotide sequence shown in (I) or (II); or (IV) a nucleotide sequence having at least 90% sequence homology with the nucleotide sequence of (I), (II) or (III).
3. A detection reagent or a kit for detecting the expression amount of an internal control gene, characterized by, the primer as claimed in claim 2.
4. Application of any of the following in functional gene expression analysis of Chinese olive: (I) the internal reference gene as claimed in claim 1; and / or (II) the primer as claimed in claim 2; and / or (III) the detection reagent or kit as claimed in claim 3.
5. The use according to claim 4, wherein the compound is ###0002### the functional gene of Chinese olive comprises a starch and sucrose metabolism pathway related gene and / or a phenylpropanoid metabolism pathway related gene.
6. The use according to claim 5, wherein the compound is ###0002### the starch and sucrose metabolism pathway related gene comprises TPS9 and / or ISA3; and the phenylpropanoid metabolism pathway related gene comprises PER64 and CYP98A2.
7. Use according to any one of claims 4 to 6, wherein the compound is ###0002### the Chinese olive comprises olive fruits of different varieties or different development periods.
8. A method of detecting the expression level of a function gene of Chinese olive, characterized in that, comprising using any of the internal reference genes as claimed in claim 1 or a combination thereof as an internal reference, and using the primers as claimed in claim 2 or a combination thereof for detection, to obtain the expression level of the functional gene of Chinese olive.
9. The method of claim 8, wherein, the method for detection comprises real-time fluorescent quantitative PCR.
10. A method for improving the stability of detection of Chinese olive functional genes, characterized in that, The method comprises using any one of the internal reference genes or a combination thereof as claimed in claim 1 as an internal reference, and using the primers or a combination thereof as claimed in claim 2 to detect the functional gene expression level of the Chinese olive.