Mechanism for regulating AsA content of kiwi fruit by AcMYB73 and AcMYB108 transcription factors and application of mechanism

Abstract

The invention provides a mechanism for regulating and controlling AsA content of kiwi fruits by AcMYB73 and AcMYB108 transcription factors and application of the mechanism. According to the application disclosed by the invention, after GABA is used for treating kiwi fruits, transcriptome sequencing is carried out, and AcMYB73 and AcMYB108 transcription factors which are most likely to regulate and control ascorbic acid-related metabolic genes are screened from numerous transcription factors with most obvious abundance change; experiments such as LUC / REN dual luciferase, yeast single impurity, gel migration and the like prove that both the AcMYB73 and the AcMYB108 can positively regulate and control the ascorbic acid synthesis gene and the circulating gene of the kiwi fruit and reversely regulate and control the ascorbic acid degradation gene of the kiwi fruit at the same time. The invention also successfully constructs overexpression vectors and interference vectors of AcMYB73 and AcMYB108, and successfully realizes regulation and control of the content of ascorbic acid in kiwi fruits.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of plant molecular biology and genetic engineering, and particularly relates to a mechanism of AcMYB73 and AcMYB108 transcription factors regulating AsA content in kiwifruit and application thereof. BACKGROUND

[0002] MYB transcription factor family is one of the largest families of plant transcription factors, which regulates the expression of target genes by binding to specific motifs in the promoter of the target genes, and is involved in plant growth regulation, environmental stress response, secondary metabolite synthesis and other physiological processes. Environmental stress refers to various external adverse factors affecting the growth, development and physiological function of plants. These stress factors change the normal physiological processes of plants, leading to limited growth or even death of plants. MYB transcription factors are widely involved in the adaptive mechanisms of plants to cope with and alleviate these stresses.

[0003] Kiwifruit is popular due to its rich nutrition and significant health benefits. However, during postharvest storage and transportation, the ascorbic acid (AsA) content in the fruit decreases due to factors such as water loss and temperature fluctuations, affecting its nutritional quality and commercial value. In particular, kiwifruit is prone to cold damage during low-temperature storage, leading to a rapid decrease in AsA content. Recent studies have shown that MYB transcription factors regulate the synthesis of ascorbic acid and are involved in the regulation of plant responses to environmental stress. However, the mechanism of MYB transcription factors regulating the content of ascorbic acid in kiwifruit is not clear.

[0004] Therefore, further research on the mechanism of MYB transcription factors regulating the content of ascorbic acid in kiwifruit and exploration of methods to improve the accumulation of ascorbic acid in kiwifruit are of great significance for extending the shelf life of kiwifruit and enhancing its market competitiveness. SUMMARY

[0005] To solve the difficulties in the prior art, the application provides a mechanism of AcMYB73 and AcMYB108 transcription factors regulating AsA content in kiwifruit and application thereof. The application screens AcMYB73 and AcMYB108 transcription factors that are most likely to regulate ascorbic acid-related metabolic genes from a large number of transcription factors with the most significant abundance changes by performing transcriptome sequencing on kiwifruit treated with GABA, and proves that both AcMYB73 and AcMYB108 can positively regulate ascorbic acid synthesis genes and circulation genes in kiwifruit and simultaneously negatively regulate ascorbic acid degradation genes in kiwifruit through LUC / REN dual luciferase, yeast one-hybrid, gel migration and other experiments. The application also successfully constructs overexpression vectors and interference vectors of AcMYB73 and AcMYB108 to successfully regulate the content of ascorbic acid in kiwifruit.

[0006] In one aspect, the application provides use of AcMYB73 or AcMYB108 gene for preparing a preparation for regulating AsA content of kiwifruit, characterized in that the nucleotide sequence of the AcMYB73 gene is shown as SEQ ID NO. 1, and the nucleotide sequence of the AcMYB108 gene is shown as SEQ ID NO. 2.

[0007] Kiwifruit is an important dietary source of natural ascorbic acid (AsA), and kiwifruit is prone to chilling injury during low-temperature storage, which leads to accelerated degradation of ascorbic acid, severely restricting the nutritional value and commodity properties of the fruit. Gamma-aminobutyric acid (GABA) is widely used in postharvest fruit and vegetable preservation. Using GABA treatment before kiwifruit cold storage can reduce the degree of chilling injury, effectively delay the degradation of ascorbic acid, and maintain the nutritional value of the fruit. Therefore, the application uses GABA-treated kiwifruit and untreated kiwifruit for transcriptome sequencing after low-temperature storage for a period of time, compares the sequencing results with those of untreated GABA kiwifruit, and selects MYB transcription factors AcMYB73 and AcMYB108 that are most likely to participate in regulating the content of AsA from a large number of transcription factors with the most significant abundance changes, and further verifies that the two transcription factors can regulate ascorbic acid metabolism-related genes and thus regulate ascorbic acid content through LUC / REN dual luciferase, yeast one-hybrid, gel migration and other experiments.

[0008] Further, the ascorbic acid content in kiwifruit can be increased by increasing the expression of AcMYB73 or AcMYB108 gene, or the ascorbic acid content in kiwifruit can be reduced by reducing the expression of AcMYB73 or AcMYB108 gene.

[0009] Further, when the expression of AcMYB73 gene is increased, the expression level of any one or more of AcPGI2, AcPMI, AcGME1, AcGGP1, AcGAlLDH and AcMDHAR can be increased, while the expression level of AcAO gene is decreased; when the expression of AcMYB108 gene is increased, the expression level of any one or more of AcPGI2, AcGME1, AcGME2, AcGGP1 and AcMDHAR can be increased, while the expression level of AcAO gene is decreased; when the expression of AcMYB73 gene is decreased, the expression level of any one or more of AcPGI1, AcPMI, AcPMM, AcGMP, AcGME1, AcGME2, AcGGP1, AcGGP2, AcGAlLDH, AcMIOX and AcMDHAR can be decreased, while the expression level of any one or more of AcAO and AcAPX is increased; when the expression of AcMYB108 gene is decreased, the expression level of any one or more of AcPGI1, AcPGI2, AcPMI, AcPMM, AcGME2, AcGGP1, AcGGP2, AcGPP, AcGAlLDH, AcGAlUR and AcMDHAR can be decreased, while the expression level of AcAO gene is increased.

[0010] In some ways, the LUC / REN dual luciferase experiment results, the kiwifruit transient overexpression experiment results, the kiwifruit callus genetic transformation experiment results and the gene silencing experiment results prove that by increasing the expression of AcMYB73 gene (overexpression), the expression levels of AsA synthesis genes AcPGI2, AcPMI, AcGME1, AcGGP1, AcGAlLDH and AsA cycle gene AcMDHAR can be increased, while the expression level of AsA degradation related gene AcAO is decreased. By silencing AcMYB73 gene to reduce its expression, the expression levels of AsA synthesis genes AcGGP1, AcMIOX, AcGME1, AcGAlLDH, AcPGI1, AcPMI, AcPMM, AcGMP, AcGME2, AcGGP2 and AsA cycle gene AcMDHAR can be decreased, while the expression of AsA degradation related genes AcAO and AcAPX is increased.

[0011] In some embodiments, the LUC / REN dual luciferase experiment results, the kiwifruit transient overexpression experiment results, the kiwifruit callus genetic transformation experiment results, and the gene silencing experiment results demonstrate that by increasing the gene expression (overexpression) of AcMYB108, the expression levels of AsA synthesis genes AcPGI2, AcGME1, AcGME2, AcGGP1, and AsA cycle gene AcMDHAR can be increased, and the expression level of AsA degradation related gene AcAO can be reduced. By silencing the AcMYB108 gene, the expression levels of AsA synthesis genes AcPMM, AcPGI1, AcGGP1, AcGGP2, AcGAlLDH, AcGAlUR, AcPGI2, AcPMI, AcGME2, AcGPP, and AsA cycle gene AcMDHAR can be reduced, and the expression of AsA degradation related gene AcAO can be increased.

[0012] Further, the nucleotide sequences of the AcPGI1, AcPGI2, AcPMI, AcPMM, AcGMP, AcGME1, AcGME2, AcGGP1, AcGGP2, AcGPP, AcGAlLDH, AcGAlUR, AcMIOX, AcMDHAR, AcAO, and AcAPX are shown in SEQ ID NO. 3-18.

[0013] On the other hand, the present application provides a use of an AcMYB73 or AcMYB108 gene overexpression vector for preparing a preparation for increasing the AsA content of kiwifruit, wherein the gene overexpression vector contains a nucleotide sequence as shown in SEQ ID NO. 1 or SEQ ID NO. 2.

[0014] In some embodiments, an overexpression vector containing the AcMYB73 gene and an overexpression vector containing the AcMYB108 gene are constructed respectively and successfully used for transient overexpression in tobacco and kiwifruit. The ascorbic acid content of tobacco and kiwifruit overexpressing the AcMYB73 or AcMYB108 gene is detected, and the detection results show that the ascorbic acid content is significantly increased compared with the control group.

[0015] In some embodiments, an overexpression vector containing the AcMYB73 gene and an overexpression vector containing the AcMYB108 gene are constructed respectively and introduced into kiwifruit callus and then expanded into plants after stable genetic inheritance in the callus. Plants successfully overexpressing the AcMYB73 or AcMYB108 gene are screened, and the ascorbic acid content thereof is detected. The detection results show that the ascorbic acid content is significantly increased compared with the wild type (WT).

[0016] In another aspect, the present application provides a use of an AcMYB73 or AcMYB108 gene interference vector for preparing a preparation for reducing the AsA content of kiwifruit, wherein the gene interference vector contains a nucleotide sequence as shown in SEQ ID NO. 20 or SEQ ID NO. 21.

[0017] In some modes, an interference vector containing an AcMYB73 gene and an interference vector containing an AcMYB108 gene are respectively constructed and successfully silence the AcMYB73 or AcMYB108 gene in kiwifruit, and the AsA content of the kiwifruit silencing the AcMYB73 or AcMYB108 gene is detected.

[0018] The detection results show that the ascorbic acid content is significantly reduced compared with the wild type (WT).

[0019] In another aspect, the present application provides a preparation for increasing or reducing the AsA content of kiwifruit, characterized in that the preparation for increasing the AsA content of kiwifruit comprises an overexpression vector of the AcMYB73 or AcMYB108 gene; and the preparation for reducing the AsA content of kiwifruit comprises an interference expression vector of the AcMYB73 or AcMYB108 gene.

[0020] Further, the overexpression vector contains a nucleotide sequence as shown in SEQ ID NO. 1 or SEQ ID NO. 2.

[0021] Further, the interference expression vector contains a nucleotide sequence as shown in SEQ ID NO. 20 or SEQ ID NO. 21.

[0022] In another aspect, the present application provides a method for increasing or reducing the AsA content of kiwifruit, wherein the preparation as described above is applied to the kiwifruit.

[0023] The present application has the following beneficial effects:

[0024] 1. The present application finds that the AcMYB73 or AcMYB108 transcription factor has the function of regulating the AsA content, and participates in the metabolic regulation of ascorbic acid in postharvest kiwifruit by regulating the expression of AsA metabolism related genes, thereby regulating the AsA content of kiwifruit.

[0025] 2, The application finds that AcMYB73 and AcMYB108 positively regulate the AsA biosynthesis pathway, and have a positive regulation effect on AsA synthesis: increasing the gene expression (overexpression) of AcMYB73 can increase the expression levels of AsA synthesis genes AcPGI2, AcPMI, AcGME1, AcGGP1, AcGAlLDH and AsA cycle gene AcMDHAR, and decrease the expression level of AsA degradation related gene AcAO; increasing the gene expression (overexpression) of AcMYB108 can increase the expression levels of AsA synthesis genes AcPGI2, AcGME1, AcGME2, AcGGP1 and AsA cycle gene AcMDHAR, and decrease the expression level of AsA degradation related gene AcAO;

[0026] 3, The application finds that AcMYB73 can directly bind to the promoter region of AcDHAR and AcAO, while AcMYB108 may indirectly regulate the expression of the two genes through an auxiliary factor;

[0027] 4, The application also successfully constructs an overexpression vector and an interference vector of the AcMYB73 or AcMYB108 gene, and successfully realizes the regulation of the ascorbic acid content in the kiwi fruit;

[0028] 5, The mechanism of the AcMYB73 or AcMYB108 gene found by the application for regulating the AsA content can be applied to the genetic improvement of kiwi and other horticultural crops (such as tomato, strawberry, citrus, etc.), and can be used for cultivating new varieties of functional fruits and vegetables with high AsA content, improving the nutritional quality and antioxidant capacity of agricultural products, and has broad prospects in the development of functional foods and the upgrading of agricultural industry. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 It is a schematic diagram of amino acid sequence analysis of AcMYB73 in embodiment 1;

[0030] Figure 2 It is a schematic diagram of the phylogenetic tree of AcMYB73 protein in embodiment 1;

[0031] Figure 3 It is a schematic diagram of amino acid sequence analysis of AcMYB108 in embodiment 1;

[0032] Figure 4 It is a schematic diagram of the phylogenetic tree of AcMYB108 protein in embodiment 1;

[0033] Figure 5Schematic diagram of the effect of GABA on the AcMYB73 / AcMYB108 promoter in Example 2 (tobacco leaves sprayed twice a day with water as control (CTR), and twice a day with GABA (10 mmol L-1) as treatment (ETH); the ratio of luciferase to Renilla (LUC / REN) was set as 1 for the control (CTR));

[0034] Figure 6 Schematic diagram of the effect of GABA treatment on the expression of AcMYB73 and AcMYB108 genes in kiwifruit fruits in Example 2;

[0035] Figure 7 Schematic diagram of the subcellular localization of AcMYB73 and AcMYB108 proteins in Example 3;

[0036] Figure 8 Schematic diagram of the construction of the LUC / REN dual luciferase experimental vector in Example 4;

[0037] Figure 9 Schematic diagram of the regulatory effect of AcMYB73 and AcMYB108 on the promoters of key genes in AsA metabolism in Example 4;

[0038] Figure 10 Schematic diagram of the interaction of AcMYB73 and AcMYB108 with AcDHAR and AcAO in yeast single-hybrid in Example 4;

[0039] Figure 11 Schematic diagram of in vitro prokaryotic induction of AcMYB73 and AcMYB108 proteins for SDS-PAGE in Example 4;

[0040] Figure 12 Schematic diagram of EMSA of AcMYB73 and AcMYB108 on the promoters of AcDHAR and AcAO in Example 4 (Biotin Probe1 and Biotin Probe2 are the biolabel probes of AcDHAR, and Biotin Probe3 and Biotin Probe4 are the biolabel probes of AcAO);

[0041] Figure 13 Schematic diagram of EMSA of AcMYB73 on the promoters of AcAO and AcDHAR in Example 4 (A and C are the probe sequences of the AcAO and AcDHAR promoters for EMSA experiments, respectively; B and D are the EMSA experiment results of AcMYB73 on the promoters of AcAO and AcDHAR).

[0042] Figure 14Figure 1 is a schematic diagram of transient overexpression of AcMYB73 and AcMYB108 in tobacco for Example 5 (A: AcMYB73 and AcMYB108 gene expression level; B: AsA content of transient overexpression of AcMYB73 and AcMYB108 in tobacco);

[0043] Figure 15 Figure 2 is a schematic diagram of transient overexpression of AcMYB73 and AcMYB108 in kiwifruit fruit for Example 5 (A: transient overexpression of AcMYB73 in kiwifruit fruit and AsA content determination; B: transient overexpression of AcMYB108 in kiwifruit fruit and AsA content determination);

[0044] Figure 16 Figure 3 is a schematic diagram of the effect of transient overexpression of AcMYB73 and AcMYB108 on AsA synthesis genes in kiwifruit fruit for Example 5 (A: effect of transient overexpression of AcMYB73 on AsA synthesis genes; B: effect of transient overexpression of AcMYB108 on AsA synthesis genes);

[0045] Figure 17 Figure 4 is a schematic diagram of the effect of transient overexpression of AcMYB73 and AcMYB108 on AsA cycle and degradation genes in kiwifruit fruit for Example 5 (A: effect of transient overexpression of AcMYB73 on AsA cycle and degradation genes; B: effect of transient overexpression of AcMYB108 on AsA cycle and degradation genes);

[0046] Figure 18 Figure 5 is a schematic diagram of overexpression of AcMYB73 and AcMYB108 in kiwifruit callus and AsA content determination for Example 5 (A: overexpression of AcMYB73 in kiwifruit callus and AsA content determination; B: overexpression of AcMYB108 in kiwifruit callus and AsA content determination)

[0047] Figure 19 Figure 6 is a schematic diagram of the effect of overexpression of AcMYB73 gene on AsA metabolism genes in kiwifruit callus for Example 5;

[0048] Figure 20 Figure 7 is a schematic diagram of the effect of overexpression of AcMYB108 gene on AsA metabolism genes in kiwifruit callus for Example 5;

[0049] Figure 21 Figure 8 is a schematic diagram of gene silencing of AcMYB73 and AcMYB108 in kiwifruit fruit and AsA content determination for Example 5 (A: gene silencing of AcMYB73 in kiwifruit fruit and AsA content determination; B: gene silencing of AcMYB108 in kiwifruit fruit and AsA content determination);

[0050] Figure 22Schematic diagram of the influence of gene silencing of AcMYB73 and AcMYB108 on AsA synthesis genes (A: influence of gene silencing of AcMYB73 on AsA synthesis genes; B: influence of gene silencing of AcMYB108 on AsA synthesis genes) of Example 5;

[0051] Figure 23 Schematic diagram of the influence of gene silencing of AcMYB73 and AcMYB108 on AsA cycle and degradation genes (A: influence of gene silencing of AcMYB73 on AsA cycle and degradation genes; B: influence of gene silencing of AcMYB108 on AsA cycle and degradation genes) of Example 5. DETAILED DESCRIPTION

[0052] The application will be described in further detail below with reference to the drawings and examples, it should be noted that the following examples are intended to facilitate the understanding of the application and do not limit the application in any way.

[0053] Example 1, screening of transcription factors for regulating ascorbic acid in kiwifruit

[0054] Kiwifruit is an important dietary source of natural ascorbic acid (AsA), and kiwifruit is prone to chilling injury during low-temperature storage, which leads to accelerated degradation of ascorbic acid, severely restricting the nutritional value and commodity properties of the fruit. Gamma-aminobutyric acid (GABA) is widely used in postharvest fruit and vegetable preservation. Using GABA treatment before kiwifruit cold storage can reduce the degree of chilling injury and effectively delay the degradation of ascorbic acid, thereby maintaining the nutritional value of the fruit. Therefore, in this example, the transcriptome of GABA-treated kiwifruit and untreated kiwifruit was sequenced after low-temperature storage for a period of time. Compared with the sequencing results of untreated kiwifruit, the most likely transcription factor involved in regulating the content of AsA was selected from a large number of significantly up-regulated transcription factors in abundance.

[0055] The research material of this experiment is "Hongyang" kiwifruit, which is collected from a farm in Ningbo City, Zhejiang Province. The fruit is selected 120 days after pollination (hardness about 42 N, soluble solid content 7.2% ± 0.3%) and quickly transported to the laboratory after picking and spread in a well-ventilated environment to dissipate the field heat.

[0056] Screen kiwifruit fruits of uniform size and without any damage, and randomly divide them into experimental and control groups. The experimental group is soaked in 10 mmol·L -1GABA solution for 10 min, the control group was soaked in distilled water under the same conditions, and after soaking, it was naturally air-dried and stored in a constant temperature environment at 0°C (relative humidity 85-90%) for 100 days. After 100 days, the RNA of the two groups of kiwifruits was extracted and reverse transcribed into cDNA, and then transcriptome sequencing was performed. Compared with the control group, the 10 transcription factors with significant differential expression and the highest expression abundance are shown in Table 1.

[0057] Table 1, sequencing results of 10 transcription factors with significant differential expression and the highest expression abundance

[0058] Gene name CK-80d_fpkm GABA-80d_fpkm log2(fc) AcMYB108 50.041 131.039 1.389 AcMYB73 9.844 28.727 1.545 AcBZIP53 13.466 28.347 1.074 AcERF5.1 13.676 28.328 1.051 AcWRKY24 12.272 25.419 1.051 AcWRKY11 8.932 17.979 1.009 AcLBD12 44.523 17.453 -1.351 AcBZIP43 41.812 17.321 -1.271 AcNAC010 6.587 13.785 1.065 AcERF5.2 4.318 10.137 1.231

[0059] According to the results in Table 1, the 10 transcription factors in the experimental group showed significant expression differences compared with the control group, but comparing log2(fc) found that AcMYB73 and AcMYB108 showed a significant up-regulation trend after GABA treatment, and the expression abundance after up-regulation was the highest. Therefore, AcMYB73 and AcMYB108, two MYB transcription factors, were selected for further study. The nucleotide sequences of AcMYB73 and AcMYB108 genes are shown in SEQ ID NO. 1-2.

[0060] Further, amino acid sequence analysis was performed on AcMYB73 and AcMYB108 transcription factors. NCBI BLASTP was used for homologous alignment of the amino acid sequence of kiwifruit AcMYB73 protein, and the reference species included Arabidopsis thaliana (OAO99912.1), Rhododendron vialii (XP_058188330.1), Raphanus sativus (XP_018478363.2), Pisum sativum (KAI5439358.1), Brassica napus (XP_013705361.1) and Citrus sinensis (KAH9712114.1). The alignment results showed that AcMYB73 protein contains two typical MYB domains (R2 and R3) in the N-terminal 10-110 amino acid interval, consistent with the characteristics of the R2R3-MYB subfamily, as shown in Figure 1 Further, by the method of adjacency, a phylogenetic tree was constructed, and it was found that AcMYB73 and Camellia flower (ClMYB73, KAI8015846.1) were clustered into one branch, and the self-exhibition value was higher than 90%, indicating that the two had the closest genetic relationship, as shown in Figure 2The amino acid sequence of the kiwi AcMYB108 protein was subjected to homologous alignment using NCBI BLASTP, with reference species including Arabidopsis thaliana (OAP01400.1), Jasminum sambac (WHI95075.1), Phaseolus vulgaris (XP_068463569.1), Salvia miltiorrhiza (XP_057809772.1), Raphanus sativus (XP_018490800.2), and Spinacia oleracea (XP_056697219.1). The alignment results showed that the AcMYB108 protein contains two typical MYB domains (R2 and R3) in the N-terminal 20-121 amino acid region, consistent with the characteristics of the R2R3-MYB subfamily, as shown in Figure 3 Further phylogenetic tree construction by the contiguity method found that AcMYB108 was clustered with tea tree (CsMYB108, Camellia sinensis) with a bootstrap value higher than 90%, indicating that they have the closest genetic relationship, as shown in Figure 4

[0061] Example 2, Effect of Exogenous GABA Treatment on Kiwi AcMYB73 and AcMYB108

[0062] In Example 1, AcMYB73 and AcMYB108 were screened as MYB transcription factors that may be involved in the regulation of AsA content in kiwi. Therefore, in this example, kiwi was first treated with exogenous GABA and then stored at low temperature. The changes in ascorbic acid content and the expression of AcMYB73 and AcMYB108 during storage were detected to explore whether the changes in ascorbic acid content in kiwi were correlated with the expression of AcMYB73 and AcMYB108.

[0063] 1. Effect of Exogenous GABA Treatment on Kiwi Ascorbic Acid Content and AcMYB73 and AcMYB108 Expression

[0064] Uniform kiwi fruits without any damage were selected and randomly divided into experimental and control groups. The experimental group was soaked in 10 mmol·L -1 ​The control group was soaked in distilled water under the same conditions. After soaking, the fruits were naturally air-dried, and stored in a constant temperature environment at 0°C (relative humidity 85-90%) for 100 days. Every 20 days, samples were taken, the seeds and central column were discarded, and the pulp was cut into pieces for determination of ascorbic acid (AsA) and total ascorbic acid (T-AsA) content at different storage times. The remaining pulp was quickly frozen with liquid nitrogen and stored in a -80°C refrigerator for total RNA extraction and cDNA synthesis. The relative expression of AcMYB73 and AcMYB108 was determined by real-time fluorescent quantitative PCR (qRT-PCR).

[0065] The detection methods of AsA and T-AsA are as follows:

[0066] (1) Tissue disruption: Fresh samples were quickly frozen with liquid nitrogen and mechanically pulverized into powder using a ball mill;

[0067] (2) Acid extraction treatment: 100 mg of powder sample was weighed into a 50 mL pre-cooled centrifuge tube, 5 mL of pre-cooled extraction solution (5% trichloroacetic acid) was added, and vortexed for 30 seconds to mix;

[0068] (3) Low-temperature centrifugation: centrifugation at 10000 rpm for 15 min at 4°C, the supernatant was separated and divided into sterile EP tubes (labeled as group A) and glass test tubes (labeled as group B) for ascorbic acid (AsA) and total ascorbic acid (T-AsA) determination, respectively;

[0069] (4) Reduction reaction: 1 mL of supernatant from group A was taken, 500 μL of ethanol solution containing 60 mM DTT was added, and the pH was adjusted to 7.0-8.0 using phosphate buffer;

[0070] (5) Constant temperature reaction: after 10 min of room temperature reaction, 500 μl of 20% TCA was added to adjust the pH to 1-2;

[0071] (6) Colorimetric determination: the method described in the paper "Effect of 1-MCP on the regulation processes involved in ascorbate metabolism in kiwifruit" (https: / / doi.org / 10.1016 / j.postharvbio.2021.111563) was used to determine the content of AsA and T-AsA in the reaction system.

[0072] The method of total RNA extraction and cDNA synthesis is as follows: total RNA of pulp at different storage times was extracted using RNA kit (Omega Bio-Tek, Inc., Norcross, GA) and cDNA was synthesized, and then the relative expression of AcMYB73 and AcMYB108 was determined by real-time fluorescent quantitative PCR (qRT-PCR) of Nanjing Novozyme. IIQRT SuperMix for qPCR(+gDNA wiper) kit reverses RNA into cDNA, and the reversed cDNA is stored in a -20°C refrigerator for standby use.

[0073] The primers for detecting AcMYB73 and AcMYB108 by qRT-PCR are shown in Table 2 below, wherein AcActin is used as an internal reference gene, the reaction system is shown in Table 3 below, and the reaction procedure is shown in Table 4 below.

[0074] Table 2, primers for detecting relative expression of AcMYB73 and AcMYB108 by qRT-PCR

[0075]

[0076] Table 3, qRT-PCR reaction system

[0077] Component Volume 2x ChamQ Universal SYBR qPCR Master Mix 10 μL Upstream primer (10 μM) 0.5 μL Downstream primer (10 μM) 0.5 μL cDNA 1 μL ddH2O Add to 20 μL

[0078] Table 4, qRT-PCR reaction procedure

[0079]

[0080] The changes in the contents of AsA and T-AsA of the experimental group and the control group during storage are shown in Table 5 below.

[0081] Table 5, changes in contents of AsA and T-AsA of experimental group and control group during storage

[0082]

[0083]

[0084] Table 5 shows that, from the 20th day of storage, the contents of AsA and T-AsA of the experimental group were significantly higher than those of the control group, indicating that GABA treatment of kiwifruit can increase the contents of AsA and T-AsA.

[0085] The expression of AcMYB73 and AcMYB108 genes in kiwifruit of the experimental group and the control group during storage is shown in Table 5 below. Figure 5 The expression of AcMYB73 gene in the control group and the treatment group showed similar rules, and gradually decreased before 40 days of storage, and the expression level was basically unchanged after 40 days. GABA treatment slowed down this downward trend, and the expression of AcMYB73 gene after treatment was significantly higher than that of the control group at 20-60 days and 100 days. During the storage of kiwifruit, the expression of AcMYB108 gene in the control group changed little, and GABA treatment significantly improved the expression of AcMYB108 at 20-60 days and 100 days of storage.

[0086] From the above experimental results, it can be seen that after exogenous GABA treatment of kiwifruit and low temperature storage, the expression of AcMYB73 and AcMYB108 in kiwifruit can be significantly increased, and the content of ascorbic acid in kiwifruit is increased. Therefore, it is speculated that AcMYB73 and AcMYB108 are positively correlated with the content of AsA and T-AsA in kiwifruit, and also participate in the regulation of ascorbic acid synthesis in kiwifruit.

[0087] 2、Exogenous GABA treatment of kiwifruit on the activity of AcMYB73 and AcMYB108 promoter

[0088] Further, the effect of exogenous GABA on the activity of AcMYB73 and AcMYB108 promoter was analyzed by luciferase experiment.

[0089] The steps of luciferase experiment are as follows:

[0090] (1) Target gene cloning: total RNA of kiwifruit treated with exogenous GABA was extracted and reverse transcribed into cDNA, and PCR primers were designed to amplify the genes of AcMYB73 and AcMYB108 promoters. The primer sequences are shown in Table 6.

[0091] Table 6, PCR primers for luciferase experiment

[0092]

[0093] The target gene was separated by agarose gel electrophoresis, observed under the gel imaging instrument, and the length of the target gene band was cut into a 1.5 mL centrifuge tube. According to the instructions of FastPure Gel DNA Extraction Mini Kit of Nanjing Novozyme, the target gene was recovered and purified.

[0094] (2) Linearization of vector and its purification: the pGreenII 0800-LUC vector was linearized by restriction enzyme digestion and purified by agarose gel electrophoresis, and the method was the same as step (1).

[0095] (3) Homologous recombination: the target gene was connected with the linearized vector using ClonExpress II One Step Cloning Kit of Nanjing Novozyme, and the reaction system is shown in Table 7. AcMYB73-0800-LUC and AcMYB108-0800-LUC plasmids were obtained.

[0096] Table 7, homologous recombination connection system

[0097] Component Amount Target gene 50-200 ng Linearized vector 50-200 ng 5x CE II Buffer 2 μL Exnase II 1 μL ddH2O Add to 10 μL

[0098] (4) Transformation of E. coli competent: The DH5a E. coli competent cells from Nanjing Novagen were used for transformation, and the specific operation was carried out according to the instruction manual.

[0099] (5) Positive clone colony detection: Uniform single colonies were picked from the plate, and PCR identification was performed using the Rapid Taq Master Mix reagent from Nanjing Novagen. The colony PCR reaction system is shown in Table 8, and the identified colonies were inoculated into a new plate containing the corresponding antibiotic and cultured at 37°C for 12h. According to the results of agarose gel electrophoresis, single colonies with a length consistent with the target gene were selected and sent to Hangzhou Qikexin Biotechnology Co., Ltd. for sequencing.

[0100] Table 8, Colony PCR reaction system

[0101]

[0102]

[0103] (6) Plasmid extraction: The correctly sequenced colonies were expanded and cultured, and the plasmid extraction was performed according to the plasmid extraction kit of Nanjing Novagen Plasmid Mini Kit, and the specific method was carried out according to the instruction manual.

[0104] (7) Agrobacterium transformation: The extracted plasmid was transferred into GV3101 Agrobacterium, and the positive clone colonies were detected, and the detection method was the same as step (5).

[0105] (8) Preparation of Agrobacterium infection solution:

[0106] 1) Inoculate the positive strain subjected to colony PCR in 1mL of liquid LB medium containing the corresponding resistance, and culture at 28°C, 220rpm for 12-15h;

[0107] 2) Inoculate 1mL of bacterial solution in 50mL of liquid LB medium containing the corresponding resistance, and culture at 28°C, 220rpm for 12h;

[0108] 3) Centrifuge the cultured bacterial solution at 6000rpm for 8min to collect the bacteria, and only the bacterial precipitate is retained. Wash the bacteria with ddH2O at 6000rpm for 8min and collect the bacteria again;

[0109] 4) Resuspend the bacteria with the infection solution (formula shown in Table 9), adjust the concentration of the bacterial solution to OD600=0.75, and place it in the dark at room temperature for 3h.

[0110] Table 9, Infection solution formula

[0111] Ingredient Concentration MgCl2 10 mM MES 10 mM AS 100 mM ​

[0112] (9) Luciferase experiment, the specific operation is as follows: the agrobacterium infection solution containing AcMYB73-0800-LUC and AcMYB108-0800-LUC plasmids is injected into tobacco leaves, and after injection, the tobacco is cultured in a climate chamber for 72 hours; during the culture process, the control group of tobacco is sprayed with water twice every 24 hours, and the experimental group is sprayed with 10 mM GABA every 24 hours twice, and after 72 hours, luciferase detection is performed.

[0113] The detection results are shown in Table 8. Figure 6 As shown in Table 8, after GABA treatment, the activity of AcMYB73 promoter is 2.6 times that of the control group, and the activity of AcMYB108 promoter is increased to about 1.4 times. These results show that GABA can directly affect the expression of AcMYB73 and AcMYB108 by regulating its promoter.

[0114] Example 3, exploring the distribution position of AcMYB73 and AcMYB108 transcription factors in cells

[0115] This embodiment further determines the specific distribution position of AcMYB73 and AcMYB108 transcription factors in cells by subcellular localization, and further reveals the functional mechanism.

[0116] 1, target gene cloning: total RNA of kiwi fruit is extracted and reverse transcribed into cDNA, PCR primers are designed to amplify the genes of AcMYB73 and AcMYB108, and the primer sequences are shown in Table 10, and the remaining steps are the same as those of Example 2 luciferase experiment.

[0117] Table 10, PCR primers for subcellular localization experiment

[0118]

[0119] 2, linearization of vector and purification: the steps are the same as those of Example 2 luciferase experiment, and the vector is pCAMBIA1301-GFP.

[0120] 3, homologous recombination: the steps are the same as those of Example 2 luciferase experiment, and AcMYB73-1301-GFP and AcMYB108-1301-GFP plasmids are obtained.

[0121] 4, transformation of E. coli competent cells: the steps are the same as those of Example 2 luciferase experiment.

[0122] 5, positive clone colony detection: the steps are the same as those of Example 2 luciferase experiment.

[0123] 6, plasmid extraction: the steps are the same as those of Example 2 luciferase experiment.

[0124] 7. Agrobacterium transformation: the procedure is the same as that of Example 2 luciferase experiment.

[0125] 8. Preparation of Agrobacterium infection solution: the procedure is the same as that of Example 2 luciferase experiment, the resuspension solution is diluted to OD 600 = 0.5.

[0126] 9. Subcellular localization experiment: inject 1 mL syringe into the lower epidermis of tobacco back, cultivate in the climate box for 3 days, select the leaf tissue of the infiltration area of the bacterial solution after 3 days, make epidermal cell sections, and then use laser confocal microscope to observe the distribution of green fluorescent signal in the sections.

[0127] The detection results are shown in Figure 7 In the tobacco cells expressing 35S::AcMYB73-GFP and 35S::AcMYB108-GFP fusion proteins, green fluorescent signal is only detected in the nucleus, while the green fluorescent signal of the positive control group 35S::GFP protein is distributed in the whole cell. This result shows that AcMYB73 and AcMYB108 as transcription factors, their biological functions are likely to be exercised in the nucleus. As members of the MYB family, AcMYB73 and AcMYB108 may participate in various physiological processes in the nucleus, such as gene transcription regulation, stress response, etc. by regulating the expression of target genes.

[0128] Example 4, Regulation mechanism of AcMYB73 and AcMYB108 transcription factors on ascorbic acid in kiwifruit

[0129] Example 2 After treating kiwifruit with exogenous GABA and storing it at low temperature, the rate of decrease of ascorbic acid content in kiwifruit is slowed down, and the expression of AcMYB73 and AcMYB108 is significantly improved, it is guessed that AcMYB73 and AcMYB108 may be involved in regulating the ascorbic acid content of kiwifruit. This embodiment will further explore the regulation mechanism of AcMYB73 and AcMYB108 on ascorbic acid in kiwifruit.

[0130] 1. LUC / REN dual luciferase experiment

[0131] (1) Amplification of target genes: total RNA of kiwifruit fruit is extracted and reverse transcribed into cDNA, primers are designed to amplify the ORF sequence of AcMYB73 and AcMYB108 (the nucleotide sequence of AcMYB73 is shown as SEQ ID NO. 1, and the nucleotide sequence of AcMYB108 is shown as SEQ ID NO. 2) and the promoter sequence of AsA metabolic gene, the primers are shown in Table 11, and the remaining steps are the same as those of Example 2 luciferase experiment.

[0132] Table 11, PCR amplification primers for LUC / REN dual luciferase experiment

[0133]

[0134] (2) Linearization of the vector and its purification: The steps are the same as those in the luciferase experiment of Example 2. The vectors are pGreenII 62-SK and pGreenII 0800-LUC.

[0135] (3) Homologous recombination: The steps are the same as those in the luciferase experiment of Example 2. The ORF sequences of AcMYB73 and AcMYB108 are constructed into the pGreenII 62-SK vector as the effector, and the promoter sequences of the AsA metabolic genes are constructed into the pGreenII 0800-LUC vector as the reporter, as shown in Figure 8 .

[0136] (4) Transformation of E. coli competent cells: The steps are the same as those in the luciferase experiment of Example 2.

[0137] (5) Detection of positive clone colonies: The steps are the same as those in the luciferase experiment of Example 2.

[0138] (6) Plasmid extraction: The steps are the same as those in the luciferase experiment of Example 2.

[0139] (7) Agrobacterium transformation: The steps are the same as those in the luciferase experiment of Example 2.

[0140] (8) Preparation of Agrobacterium infection solution: The concentration of the resuspended bacterial solution is adjusted to OD600 = 0.25.

[0141] (9) Dual luciferase experiment using the Dual Luciferase Reporter Assay Kit from Nanjing NoviZon. The specific operation is as follows: The report bacteria solution and the effector bacteria solution that have been allowed to stand are mixed at a ratio of 1:8, and after mixing, they are injected into tobacco leaves. After injection, the leaves are cultured in a climate chamber for 72 h. After 72 h, a puncher is used to take a 1 cm diameter disc from the injection area, and the LUC and REN luciferase activities in the infected area of the tobacco leaves are measured. The relative activity ratio of LUC / REN is calculated, which represents the regulation strength of the transcription factor on the promoter of the target gene. Each experiment is repeated 4 times.

[0142] The experimental group is the mixed bacteria solution of AcMYB73-62-SK and AcMYB108-62-SK and the test gene pGreenII 0800-LUC, and the mixed bacteria solution of the empty vector and the test gene pGreenII 0800-LUC is used as the negative control.

[0143] The detection results are as shown in Figure 9As shown in Fig. 6, it can be seen that, compared with the control group, AcMYB73 significantly activated the promoter activity of AcPGI2, AcPMI, AcGME1, AcGGP1, AcGAlLDH, AcDHAR and AcMDHAR, while inhibited the promoter activity of AcAO. AcMYB108 promoted the promoter activity of AcPGI2, AcGME1, AcGME2, AcGGP1, AcDHAR and AcMDHAR, and inhibited the promoter activity of AcPMI, AcGAlLDH and AcAO. The down-regulation of the promoter activity of AcPMI and AcGAlLDH may be affected by the common regulation of tobacco ontology genes. In general, the two MYB transcription factors both promote the accumulation of AsA in kiwifruit by activating part of the AsA synthesis genes and inhibiting the promoter activity of AsA degradation genes, but differ in the target genes for regulation, which reflects their different mechanisms in regulating the metabolism of ascorbic acid in kiwifruit after harvest.

[0144] 2. Yeast one-hybrid

[0145] (1) Amplification of target genes: total RNA of kiwifruit was extracted and reverse transcribed into cDNA, and primers were designed to amplify the ORF sequences of AcMYB73 and AcMYB108 and the promoter sequences of AsA metabolic genes (the promoter sequences of leaf AsA metabolic genes were analyzed, and genes containing MYB binding elements on the promoter were selected for amplification). The primers are shown in Table 12 below, and the remaining steps are the same as those in Example 2 luciferase experiment.

[0146] Table 12, PCR amplification primers for yeast one-hybrid experiment

[0147]

[0148] (2) Linearization of vectors and purification: the steps are the same as those in Example 2 luciferase experiment, and the vectors are pGADT7 and pAbAi.

[0149] (3) Homologous recombination: the steps are the same as those in Example 2 luciferase experiment, and the ORF sequences of AcMYB73 and AcMYB108 are constructed into the pGADT7 vector as prey vectors, and the promoter sequences of AsA metabolic genes are constructed into the pAbAi vector as bait vectors pBait-AbAi.

[0150] (4) Transformation of E. coli competent cells: the steps are the same as those in Example 2 luciferase experiment.

[0151] (5) Positive clone colony detection: the steps are the same as those in Example 2 luciferase experiment.

[0152] (6) Plasmid extraction: the steps are the same as those in Example 2 luciferase experiment.

[0153] (7) Yeast one-hybrid experiment:

[0154] 1) Linearization of bait vector pBait-AbAi plasmid: linearize the plasmid using Bstb I (NEB) restriction enzyme, the enzyme reaction system is shown in Table 13, electrophoresis after 65℃ enzyme digestion for 2 hours and recovery.

[0155] Table 13, enzyme reaction system

[0156]

[0157]

[0158] 2) Transformation of bait vector pBait-AbAi into Y1HGold: take 100 μL of Y1HGold competent cells melted on ice, prepare the competent cells according to the classic yeast transformation kit of Beijing Coolab and transform according to the instructions.

[0159] 3) Bait strain identification: the steps are the same as the luciferase experiment in Example 2.

[0160] 4) After the transformation verification is successful, pick a fresh single colony and resuspend it in 1 mL of SD / -Ura liquid medium, adjust the OD 600 to 0.2; then, dilute the sample by 10 times, 100 times and 1000 times gradient, respectively, so that the final OD 600 is 0.2, 0.02, 0.002 and 0.0002, respectively; next, spot 10 μL of bacteria liquid of different dilution times on SD / -Ura solid medium and SD / -Ura plates containing different concentrations of AbA (100, 200, 300, 500, 800, 1000 ng / mL), respectively; finally, place the plates at 30℃ for 2-3d, observe the growth of the yeast strain under different AbA concentrations, and determine the optimal working concentration of AbA.

[0161] 5) According to the instructions, introduce the prey plasmid into the yeast cells of step 4), after transformation is completed, select a single colony with good morphology with a diameter of 2-3mm, resuspend it with 1 mL of SD-Leu liquid medium, and adjust the concentration of the resuspension to OD 600 0.2; then, prepare different concentration gradients of resuspension using gradient dilution method (10 times series dilution) (i.e. OD 6000.2, 0.02, 0.002, 0.0002); inoculate each dilution sample with 10 μL inoculation amount on the surface of the AbA-containing SD / -Leu selective medium; finally, after placing the plates in a 30°C constant temperature incubator for 48-72 hours, observe the growth state of each group of yeast strains under different AbA concentrations and evaluate whether interaction occurs.

[0162] The evaluation results are shown in Table 5. Figure 10 As shown in Table 5, AcMYB108 failed to directly bind to the promoters of AcDHAR and AcAO, while AcMYB73 showed specific binding ability to the promoters of the two genes. It is thus inferred that AcMYB73 can directly regulate the expression of AcDHAR and AcAO genes, while AcMYB108 can participate in the regulation through an indirect pathway.

[0163] 3. Gel migration experiment (EMSA)

[0164] This experiment further verified that AcMYB73 transcription factor directly binds to AcDHAR and AcAO genes, while AcMYB108 cannot directly bind to the two genes through a gel migration experiment (EMSA), and the specific experimental steps are as follows:

[0165] (1) Amplification of target genes: total RNA of kiwi fruit was extracted and reverse transcribed into cDNA, and primers were designed to amplify the ORF sequences of AcMYB73 and AcMYB108, as shown in Table 14, and the remaining steps were the same as those in Example 2 luciferase experiment.

[0166] Table 14, PCR amplification primers for gel migration experiment

[0167]

[0168] (2) Linearization of vector and purification: the steps were the same as those in Example 2 luciferase experiment, and the vector was pGEX-4T-1.

[0169] (3) Homologous recombination: the steps were the same as those in Example 2 luciferase experiment, and the ORF sequences of AcMYB73 and AcMYB108 were constructed into the pGEX-4T-1 vector (GST tag).

[0170] (4) Transformation of E. coli competent cells: the steps were the same as those in Example 2 luciferase experiment.

[0171] (5) Positive clone colony detection: the steps were the same as those in Example 2 luciferase experiment.

[0172] (6) Expression of the target protein: 1) 20 μL of the positive clone preserved in glycerol was inoculated into 5 mL of LB medium (containing Amp 100 μg / mL, Chl 34 μg / mL) and incubated at 37°C for 12-15 h; 2) 2% of the bacterial liquid was transferred into 250 mL of LB liquid medium, and the same antibiotics were used to incubate at 37°C until the OD 600 reached 0.6-0.8; 3) IPTG was added to a concentration of 1 mM, the culture temperature was adjusted to 16°C, and induction was performed at 180 rpm for 24 h; 4) the bacterial liquid was centrifuged (4°C, 4000 rpm, 15 min), and the bacterial precipitate was collected; 5) the bacterial precipitate was resuspended in 20 mL of 1x PBS buffer; 6) an ultrasonic disrupter (25% power, pulse cycle 3 s on / 2 s off) was used for intermittent treatment in an ice water bath until the bacterial liquid was clear; 7) the broken bacterial liquid was centrifuged (4°C, 10000 g, 20 min), and the supernatant was sterilized by 0.45 μm filter membrane and stored in a pre-cooled centrifuge tube.

[0173] (7) Purification of the target protein: GST-tag Protein Purification Kit (P2262) from Shanghai Biyun Tian Biotechnology Co., Ltd. was used to purify the AcMYB73 and AcMYB108 fusion protein crude extract, and the specific operation was performed according to the instructions. The SDS-PAGE results of the AcMYB73 and AcMYB108 fusion protein before and after purification are shown in Figure 11

[0174] (8) Probe synthesis: MYB family proteins can specifically recognize CGGTT sequences. It was found through PlantPAN4.0 database (http: / / PlantPAN.itps.ncku.edu.tw / ) prediction that the AcDHAR gene promoter region contains a CGGTT binding element located in the interval of -62 bp to -25 bp upstream of the transcription start site; and the AcAO gene promoter contains two CGGTT binding elements, located in the -945 bp to -933 bp and -930 bp to -913 bp regions, respectively; based on the above binding sites, biotin-labeled DNA probes were designed, and Beijing Zixi Biological Technology Co., Ltd. was entrusted to complete the synthesis and HPLC purification of the probes; the probes were denatured at 95°C for 5 min, and then annealed and renatured by gradient cooling (-0.5°C / min) to 25°C.

[0175] (9) Gel shift experiment: the operation was performed according to the instructions of the Chemiluminescent EMSA Kit from Shanghai Biyun Tian.

[0176] The gel shift experiment results are shown in Figure 12 ​As shown, AcMYB73 protein can bind to the probe containing CGGTT element, resulting in a significant delay in the migration speed of protein-DNA complex; while AcMYB108 protein does not show binding activity.

[0177] To verify the binding specificity of AcMYB73 protein, unlabeled competitive probes were further added for dose gradient experiments, and the experimental results are as follows Figure 13 As shown, the binding signal of biotin-labeled probe was gradually weakened with the increase of competitive probe concentration. This indicates that AcMYB73 protein can specifically bind to CGGTT sequence in the promoters of AcDHAR and AcAO genes.

[0178] Based on the above results, the regulatory mechanism of AcMYB73 and AcMYB108 on the promoters of AsA metabolic genes was found. AcMYB73 significantly activated the promoter activities of AcPGI2, AcPMI, AcGME1, AcGGP1, AcGAlLDH, AcDHAR and AcMDHAR, while inhibited the promoter activity of AcAO. AcMYB108 promoted the promoter activities of AcPGI2, AcGME1, AcGME2, AcGGP1, AcDHAR and AcMDHAR, and inhibited the promoter activities of AcPMI, AcGAlLDH and AcAO. In addition, AcMYB73 can directly bind to the promoters of AcDHAR and AcAO genes, while AcMYB108 may regulate the expression of AcDHAR and AcAO genes through an indirect pathway.

[0179] Example 5, Verification of the regulation of AcMYB73 and AcMYB108 transcription factors on ascorbic acid in kiwifruit

[0180] This example further verifies the regulation of AcMYB73 and AcMYB108 transcription factors on ascorbic acid in kiwifruit by constructing overexpression vectors and gene interference vectors of AcMYB73 and AcMYB108.

[0181] 1. The effect of transient overexpression of AcMYB73 / AcMYB108 on ascorbic acid

[0182] (1) Transient overexpression in tobacco

[0183] The method for constructing AcMYB73-62-SK and AcMYB108-62-SK vector plasmids, the method for preparing the infection solution (the resuspension concentration is OD600=0.8), and the tobacco injection method all refer to the LUC / REN dual luciferase experiment of Example 4. The tobacco injected with the infection solution is cultured in an artificial climate chamber for 3 days, and then the infected part of the tobacco is cut off, ground in liquid nitrogen, and stored in a-80°C refrigerator. Three biological replicates are set, and the empty vector pGreenII 62-SK is used as a negative control. The relative expression amounts of AcMYB73 / AcMYB108 in the injection sites of the experimental group and the control group of tobacco are detected by qRT-PCR (the primers refer to Table 1), and the ascorbic acid content is detected (the detection method refers to Example 2).

[0184] The relative expression amount detection results of AcMYB73 / AcMYB108 are shown in Figure 14 As shown in A, the expression level of AcMYB73 / AcMYB108 gene after transient overexpression treatment is significantly higher than that of the control group (p<0.001), indicating that the exogenous gene has been successfully expressed in tobacco. As shown in Figure 14 B, after confirming the success of transient overexpression, the contents of AsA (ascorbic acid) and T-AsA (total ascorbic acid) are determined, and the contents of AsA and T-AsA of 35S:AcMYB73 / 35S:AcMYB108 overexpression plants are significantly higher than those of the empty vector control group (p<0.01). This result shows that AcMYB73 and AcMYB108 are involved in the regulation of AsA biosynthesis in tobacco leaves.

[0185] (2) Kiwi transient overexpression

[0186] The experimental steps of kiwi transient overexpression refer to the above-mentioned tobacco transient overexpression (the resuspension infection solution concentration is adjusted to OD600=0.6), and the empty vector pGreenII 62-SK is used as a negative control. When injecting kiwi, the middle column region of the fruit is avoided, and the fruit is divided into front, back, left, and right four regions. Among them, the front and back regions are respectively set as the empty vector control group and the experimental group, and the left and right regions are also set as the empty vector control group and the experimental group. After injection, the kiwi is placed in a dark environment at 20°C for 5 days, and then the fruit samples are collected and stored in a-80°C refrigerator. The kiwi overexpressing AcMYB73 / AcMYB108 is identified by qRT-PCR (the primers refer to Table 1), and the contents of AsA (ascorbic acid) and T-AsA (total ascorbic acid) are detected (the detection method refers to Example 2). As shown in Figure 15As shown in Figure A, in kiwifruit overexpressing AcMYB73, AsA and T-AsA reached 770 mg / kg FW and 920 mg / kg FW, respectively, significantly increased by 35% and 25% compared to the empty vector control group (p<0.01); Figure 15 As shown in Figure B, in kiwifruit overexpressing AcMYB108, AsA and T-AsA reached 720 mg / kg FW and 860 mg / kg FW, respectively, which were significantly increased by 10% and 20% compared with the empty vector control group (p<0.01). These results indicate that AcMYB73 and AcMYB108 regulate the AsA metabolic pathway and promote AsA accumulation in kiwifruit.

[0187] Furthermore, the relative expression levels of the AsA metabolic gene in kiwifruit overexpressing AcMYB73 / AcMYB108 were detected by qRT-PCR. The qRT-PCR primers for the AsA metabolic gene in kiwifruit are shown in Table 15 below, with AcActin as the internal reference gene.

[0188] Table 15. Primers for qRT-PCR of AsA metabolic gene

[0189]

[0190]

[0191] The results of qRT-PCR detection of the AsA synthesis gene are as follows: Figure 16 As shown. In Figure 16 In group A, compared with the control group, transient overexpression of AcMYB73 in kiwifruit significantly upregulated the transcriptional levels of AsA synthesis genes such as AcPMI, AcPMM, AcGPP, and AcGAlUR (p<0.001). Furthermore, AcMYB73 significantly promoted the expression of genes such as AcGME1, AcGGP1, AcGAlDH, and AcGAlLDH (p<0.01). AcMYB73 also showed a relatively significant promoting effect on genes such as AcPGI2, AcGME2, and AcGGP2 (p<0.05). Notably, the expression level of AcMIOX ​​was downregulated in fruits overexpressing AcMYB73, while the expression levels of AcPGI1 and AcGMP genes did not show significant differences. Figure 16B shows that in the kiwi fruit transiently overexpressing AcMYB108, the transcription levels of genes such as AcPGI1, AcPGI2, AcPMM, AcGPP and AcGAlUR are significantly up-regulated (p<0.001), and at the same time, the expression of AcGGP1 is also significantly increased (p<0.01). In addition, AcMYB108 significantly promotes the expression of genes such as AcPMI, AcGME1, AcGME2 and AcGAlLDH (p<0.05). However, the expression levels of AcGMP, AcGGP2, AcGAlDH and AcMIOX genes do not show significant differences.

[0192] The results of qRT-PCR detection of AsA cycle and degradation genes are shown in Figure 17 The regulation of AsA degradation and cycle related genes in kiwi fruit overexpressing AcMYB73 and AcMYB108 has similar overall trends, but there are differences in some target genes. Both significantly up-regulate the transcriptional abundance of AcDHAR and AcMDHAR (p<0.05), and significantly inhibit the expression of AcAO (p<0.05). In the fruits overexpressing AcMYB73 and AcMYB108, the transcription level of AcGR does not change significantly; overexpression of AcMYB73 has no significant effect on the transcription level of AcAPX, while overexpression of AcMYB108 significantly reduces its transcription level (p<0.05).

[0193] 2. Kiwi callus genetic transformation

[0194] In the above transient transformation experiment, there is interference of unstable gene expression and short-term effect, therefore, the present experiment further confirms that overexpression of AcMYB73 / AcMYB108 gene can positively regulate the content of ascorbic acid through kiwi callus genetic transformation experiment.

[0195] The method for constructing AcMYB73-pRI101 and AcMYB108-pRI101 carrier plasmid in the kiwi callus genetic transformation experiment refers to the LUC / REN dual luciferase experiment of Example 4. The primers for amplifying the target genes are shown in Table 16.

[0196] Table 16. Primers for kiwi callus genetic transformation

[0197]

[0198] The constructed stable expression vectors AcMYB73-pRI101 and AcMYB108-pRI101 are transferred into GV3101 strain. The positive strains after colony PCR are activated and used for genetic transformation of kiwi callus. The specific method is as follows:

[0199] (1) Preparation of bacterial culture: Inoculate 1 mL of liquid LB medium containing the corresponding antibiotic with the positive strain obtained by colony PCR and incubate at 28℃ and 220 rpm for 12-15 h; inoculate 1 mL of bacterial culture into 50 mL of liquid LB medium containing the corresponding antibiotic and incubate at 28℃ and 220 rpm for 12 h; centrifuge the cultured bacterial culture at 6000 rpm for 8 min to collect the bacteria, retaining only the bacterial precipitate; wash the bacteria with ddH2O at 6000 rpm for 8 min and collect the bacterial cells again, then add MS liquid co-medium (MS 4.43 g L). -1 +30g sucrose -1 +6-BA 0.4mg L -1 +2,4-D 1.5mg L -1 + Acetyleugenol 0.1 mmol / L -1 pH 6.0), adjust OD 600 =0.8-1.0, incubate at 28℃ and 180rpm for 2-3 hours.

[0200] (2) In a clean bench, use tweezers to crush the fluffy and soft wild-type kiwi callus and transfer it to the above-mentioned infection solution. Incubate at 28°C and 180 rpm for 30 min. Remove excess infection solution and use sterile filter paper to absorb the residual bacterial solution on the surface of the callus. Then transfer it to a callus propagation medium containing 0.1 mM acetylsuccinone and incubate in the dark at 24°C for 2 days.

[0201] (3) After co-culturing for 2 days, the callus tissue was transferred to a solid propagation medium containing resistance (30 mg / L). -1 Kana+200mg L -1 (Cef), make sure to spread the callus flat on the culture medium, culture it at room temperature in the dark, and observe its growth.

[0202] (4) After new callus grows in about a month, it is transferred to a new solid propagation medium containing resistance for propagation. After screening for 2-3 generations, three plants that overexpress AcMYB73 / AcMYB108 genes were identified by qRT-PCR. The content of AsA (ascorbic acid) and T-AsA (total ascorbic acid) was detected (the detection method is the same as in Example 2), and the relative expression level of AsA metabolic gene was detected by qRT-PCR. The control group was wild-type callus (WT).

[0203] The AsA and T-AsA contents of the three plants that overexpressed the AcMYB73 / AcMYB108 genes are as follows: Figure 18As shown, compared with wild-type callus (WT), the expression level of AcMYB73 was significantly upregulated in lines OE2, OE3, and OE5, demonstrating successful transcriptional expression; AsA content increased by 15-27% compared to wild-type, while T-AsA content increased by 26-33%. Similarly, in lines OE2, OE3, and OE4, which overexpress AcMYB108, the transcription level of AcMYB108 also showed significant differences compared to WT, indicating that the construction of the transgenic system was effective; AsA content increased by 20-25%, and T-AsA content increased by 16-37%. These results indicate that overexpression of both AcMYB73 and AcMYB108 in kiwifruit callus can significantly promote the bioaccumulation of AsA.

[0204] The relative expression levels of the AsA metabolic gene in three plants overexpressing the AcMYB73 gene are as follows: Figure 19 As shown, compared to the wild type, in kiwi callus overexpressing AcMYB73, the expression levels of AcPGI2 and AcGPP were significantly downregulated, while the expression levels of AcGAlDH and AcMIOX ​​showed no significant difference. The expression levels of other AsA synthesis genes (such as AcPGI1, AcPMI, AcPMM, AcGMP, AcGME1, AcGME2, AcGGP1, and AcGGP2) were significantly increased. Among AsA circulating genes, the transcriptional levels of AcDHAR, AcMDHAR, and AcGR were significantly increased. Among AsA degradation-related genes, the transcriptional abundance of AcAO was significantly decreased.

[0205] The relative expression levels of the AsA metabolic gene in three plants overexpressing the AcMYB108 gene are as follows: Figure 20 As shown, compared with wild type, the expression levels of AcPGI1, AcPMI, AcPMM, AcGME1, AcGGP1, AcGGP2, AcGAlDH, and AcMIOX ​​were significantly increased, and the overall expression level of AcGME2 was increased. Furthermore, the expression levels of AcPGI2 and AcGPP were significantly downregulated, while the expression level of AcGMP showed no significant difference. For AsA cycle-related genes, overexpression of AcMYB108 significantly promoted the expression of AcDHAR and AcMDHAR, but the transcriptional level of AcGR was significantly downregulated. Among AsA degradation genes, the overall transcriptional abundance of AcAO was reduced.

[0206] Overall, overexpression of AcMYB73 / AcMYB108 had varying degrees of effect on the expression of genes related to AsA synthesis, circulation, and degradation in kiwifruit callus, especially with a significant upregulation of AsA synthesis genes, while the changes in some circulation and degradation genes showed different trends.

[0207] Therefore, by means of genetic transformation, the AcMYB73 / AcMYB108 gene is overexpressed in plants, so as to significantly improve the synthesis efficiency of ascorbic acid in plant cells and inhibit the degradation thereof, and finally realize the directional accumulation of ascorbic acid content in plant tissues. The application is suitable for genetic improvement of kiwifruit and other horticultural crops (such as tomato, strawberry, citrus, etc.), and can be used for cultivating new varieties of functional fruits and vegetables with high ascorbic acid content, improving the nutritional quality and antioxidant capacity of agricultural products, and has broad prospects in the development of functional foods and the upgrading of agricultural industry.

[0208] 3. Effect of silencing AcMYB73 / AcMYB108 gene on ascorbic acid in kiwifruit

[0209] In the experiment, gene interference vectors were constructed to verify the effect of silencing AcMYB73 / AcMYB108 gene on ascorbic acid in kiwifruit.

[0210] The experimental method for silencing AcMYB73 / AcMYB108 gene in kiwifruit is the same as the above-mentioned method for overexpressing AcMYB73 / AcMYB108 gene in kiwifruit, but the vectors are different. In the experiment, TRV1 and TRV2 were used as vectors. The gene fragments of AcMYB73 and AcMYB108 were amplified by PCR (the nucleotide sequence of the gene fragment of AcMYB73 is shown as SEQ ID NO. 20, and the nucleotide sequence of the gene fragment of AcMYB108 is shown as SEQ ID NO. 21) and connected to the TRV2 vector. The amplification primers are shown in Table 17.

[0211] Table 17. Primers for silencing gene experiment of kiwifruit

[0212]

[0213] The amplified target genes were connected to the TRV2 vector to obtain TRV2-AcMYB73 and TRV2-AcMYB108. The kiwifruit fruits injected with TRV1+TRV2 (mixed ratio 1:1) infection solution were used as the negative control group, and the kiwifruit fruits injected with TRV1+TRV2-AcMYB73 (mixed ratio 1:1) and TRV1+TRV2-AcMYB108 (mixed ratio 1:1) infection solution were used as two experimental groups. The kiwifruit in which the AcMYB73 / AcMYB108 gene was silenced in the experimental groups was identified by qRT-PCR technology, the contents of AsA (ascorbic acid) and T-AsA (total ascorbic acid) were detected (the detection method is referred to Example 2), and the relative expression amount of AsA metabolic genes was detected by qRT-PCR.

[0214] The AsA and T-AsA contents of kiwifruits with successfully silenced AcMYB73 / AcMYB108 genes are shown in Figure 21 Fig. 1. In the fruits with silenced AcMYB73 (A), the AsA and T-AsA reached 610 mg / kg FW and 680 mg / kg FW, respectively, which were significantly lower than the control group by 15% and 24% (p<0.01). In the fruits with silenced AcMYB108 (B), the AsA and T-AsA reached 630 mg / kg FW and 760 mg / kg FW, respectively, which were significantly lower than the control group by 17% and 20% (p<0.01). These results indicated that silencing AcMYB73 or AcMYB108 genes inhibited the accumulation of AsA in kiwifruit fruits. Figure 21 Figure 21 The relative expression levels of AsA synthesis-related genes in kiwifruits with successfully silenced AcMYB73 / AcMYB108 genes are shown in Fig. 2.

[0215] Fig. 2A shows that silencing AcMYB73 significantly affected the expression of AsA synthesis-related genes in kiwifruit fruits. Compared with the control group, silencing AcMYB73 significantly inhibited the transcription levels of AcGGP1 and AcMIOX (p<0.001), and significantly down-regulated the expression of AcGME1 and AcGAlLDH (p<0.01). For the genes of AcPGI1, AcPMI, AcPMM, AcGMP, AcGME2 and AcGGP2, silencing AcMYB73 showed a relatively significant inhibitory effect (p<0.05). Notably, the expression of AcGAlUR was up-regulated in the silencing treatment, while the transcription levels of AcPGI2, AcGPP and AcGAlDH did not change significantly. Figure 22 Fig. 2B shows that silencing AcMYB108 significantly affected the expression of AsA synthesis-related genes in kiwifruit fruits. Compared with the control group, silencing AcMYB108 significantly inhibited the transcription level of AcPMM (p<0.001), and significantly down-regulated the expression of AcPGI1, AcGGP1, AcGGP2, AcGAlLDH and AcGAlUR (p<0.01). For the genes of AcPGI2, AcPMI, AcGME2 and AcGPP, silencing AcMYB108 showed a relatively significant inhibitory effect (p<0.05). In addition, the transcription levels of AcGMP, AcGME1, AcGAlDH and AcMIOX did not change significantly. Figure 22 Figure 22 The relative expression levels of AsA cycle and degradation genes in kiwifruits with successfully silenced AcMYB73 / AcMYB108 genes are shown in Fig. 3.

[0216] Fig. 3A shows that silencing AcMYB73 significantly affected the expression of AsA cycle and degradation-related genes in kiwifruit fruits. Compared with the control group, silencing AcMYB73 significantly inhibited the transcription levels of AcPGI1, AcPGI2, AcPMI, AcPMM, AcGMP, AcGME1, AcGME2, AcGPP, AcGAlDH, AcGAlUR and AcMIOX (p<0.001). Notably, the expression of AcGGP1 and AcGGP2 was up-regulated in the silencing treatment. Figure 23 Fig. 3B shows that silencing AcMYB108 significantly affected the expression of AsA cycle and degradation-related genes in kiwifruit fruits. Compared with the control group, silencing AcMYB108 significantly inhibited the transcription levels of AcPGI1, AcPGI2, AcPMI, AcPMM, AcGMP, AcGME1, AcGME2, AcGPP, AcGAlDH, AcGAlUR and AcMIOX (p<0.001). Notably, the expression of AcGGP1 and AcGGP2 was up-regulated in the silencing treatment.As shown, the effects of silencing AcMYB73 and AcMYB108 genes on AsA degradation and cycle-related genes were shown. Compared with the control group, silencing AcMYB73 and AcMYB108 both significantly promoted the expression of AcDHAR and AcAO (p<0.05), while significantly inhibited the transcriptional abundance of AcMDHAR (p<0.05). In addition, the transcriptional level of AcGR did not change significantly in the two groups; silencing AcMYB73 significantly improved the transcriptional level of AcAPX (p<0.01), while silencing AcMYB108 had no significant effect on the transcriptional level. It is worth noting that in the results of the transient overexpression experiment of kiwifruit in this embodiment ( Figure 16 and Figure 17 ), the results of the genetic transformation experiment of kiwifruit callus ( Figure 19 ), and the results of the LUC / REN dual luciferase experiment in Example 4 ( Figure 9 ), overexpression of AcMYB73 / AcMYB108 genes also increased the relative expression of AcDHAR, so it can be seen that AcMYB73 / AcMYB108 has no regulatory effect on AsA cycle gene AcDHAR.

[0217] Therefore, constructing the interference vector of AcMYB73 / AcMYB108 gene can significantly reduce the ascorbic acid content of kiwifruit and verify the function of the two transcription factors in regulating the ascorbic acid content of kiwifruit.

[0218] Combined with the results of the transient overexpression experiment of kiwifruit in this embodiment ( Figure 16 A and Figure 17 A), the results of the genetic transformation experiment of kiwifruit callus ( Figure 19 ), the gene silencing experiment ( Figure 22 A and Figure 23 A), and the results of the LUC / REN dual luciferase experiment in Example 4 ( Figure 9) analysis can be obtained that by increasing the gene expression of AcMYB73 (overexpression), the expression levels of AsA synthesis genes AcPGI2, AcPMI, AcGME1, AcGGP1, AcGAlLDH and AsA cycle gene AcMDHAR can be increased, and the expression level of AsA degradation related gene AcAO can be reduced. It should be noted that the down-regulation of AcPGI2 expression in the genetic transformation experiment of kiwi callus can be due to the influence of the common regulation of other genes in the callus itself. According to the results of the kiwi transient overexpression experiment and the LUC / REN dual luciferase experiment, overexpression of AcMYB73 indeed can increase the expression of AcPGI2. By silencing the AcMYB73 gene to reduce its expression, the expression levels of AsA synthesis genes AcGGP1, AcMIOX, AcGME1, AcGAlLDH, AcPGI1, AcPMI, AcPMM, AcGMP, AcGME2, AcGGP2 and AsA cycle gene AcMDHAR can be reduced, and the expression of AsA degradation related genes AcAO and AcAPX can be increased.

[0219] In combination with the results of the kiwi transient overexpression experiment of the present embodiment ( Figure 16 B and Figure 17 B), the results of the genetic transformation experiment of kiwi callus ( Figure 20 ), the results of the gene silencing experiment ( Figure 22 B and Figure 23 B) and the results of the LUC / REN dual luciferase experiment of Example 4 ( Figure 9 ) analysis can be obtained that by increasing the gene expression of AcMYB108 (overexpression), the expression levels of AsA synthesis genes AcPGI2, AcGME1, AcGME2, AcGGP1 and AsA cycle gene AcMDHAR can be increased, and the expression level of AsA degradation related gene AcAO can be reduced. By silencing the AcMYB108 gene, the expression levels of AsA synthesis genes AcPMM, AcPGI1, AcGGP1, AcGGP2, AcGAlLDH, AcGAlUR, AcPGI2, AcPMI, AcGME2, AcGPP and AsA cycle gene AcMDHAR can be reduced, and the expression of AsA degradation related gene AcAO can be increased.

[0220] Although the present application is disclosed as above, the present application is not limited thereto. Any person skilled in the art can make various changes and modifications without departing from the spirit and scope of the present application, and therefore the protection scope of the present application should be subject to the scope defined by the claims.

[0221] SEQUENCE LISTING

[0222] SEQ ID NO. 1

[0223] Nucleotide sequence of AcMYB73:

[0224] ATGTCGACGAGGAAGGATGTGGATCGGATCAAGGGGCCGTGGAGCCCCGAAGAGGACGAGCTGTTGCAGAGGCTT

[0225] GTGGGGCGGCACGGGGCGAGGAACTGGTCGCTGATAAGCAAATCGATACAGGGGCGGTCGGGAAAGTCGTGCCGG

[0226] CTGCGATGGTGCAACCAGCTGTCGCCGCAGGTTGAGCACCGGCCGTTCACGGCGGAGGAGGACGACACCATCGTC

[0227] CGCGCTCACGCCAAGTTCGGCAACAAGTGGGCCACCATCGCCCGCCTCCTCTCTGGCCGCACCGACAACGCCATCA

[0228] AGAACCACTGGAACTCCACTCTCAAGCGCAAGTGCTCGTCCATGTCCGACGACTTCGCTTTCTCCGACGAGCAGCC

[0229] TTTGAAGAGATCCGCCAGCGTCGGAGCAGGCCCCAACGGGTCGGGTCCGTATCCGAACCCAGGAAGCCCATCCGGA

[0230] TCCGACTTGAGCGACTCCCGTGCTCCTACCCCTTACGTATTCAGGCCAGTGCCGATTCACTGCGCCTCCTTAGCAGCA

[0231] TCGCATCAGATCGATACGGCGTCGTTAATTCCCGATCCCCCCACTTCTCTTAGCCTGTCCTTACCTGGATCCGGTTCAG

[0232] CTGACCCGCCGGATCTGGTACTCGGATCCAATCAAGTCACCAGCCCCACTCCGGCGGTACCGGTCGCAGCTCCGCC

[0233] GCCGCCGTCGTCGATAGAGAGACCGTTCTTCAGTGAGGATTTCATGTCTGTGTTGCAGGAGATGATCAGGAACGAA

[0234] GTGAGGAACTACATGTCTGGGATTGAGCACAAGGGTTTGCGCTTTCAAGCCGAAGCGATTACGAATTCCCTTGTCAA

[0235] GAGAATTGGCATTAGCAAGATCGATCCGTGA

[0236] SEQ ID NO.2

[0237] Nucleotide sequence of AcMYB108:

[0238] ATGGAGATTGAAGATGGAGTCGTTTGCAACCAAAGTGAAGAAGAGATCCTGGGCTTGAGGAGAGGCCCATGGACC

[0239] GTTGAAGAAGACGTGACCCTCATGAATTACATCGCCAAGCATGGTGAAGGTCGCTGGAATTCGCTTGCTCGCTCTGC

[0240] TGGTCTGAGGAGAACAGGAAAGAGCTGTAGATTAAGGTGGCTCAACTATTTACGCCCCGATGTTCGACGTGGAAATA

[0241] TTACCCTCGAAGAACAACTTCTCATTCTTGAACTTCATTCTCGCTGGGGCAATCGGTGGTCTAAAATTGCTCAACACT

[0242] TGCCTGGAAGGACAGACAATGAGATCAAAAATTACTGGCGAACTCGTGTTCAAAAGCACGCCAAACAGCTTAAATG

[0243] TGACGTCAACAGCAAGCAATTCAAGGACACCATGCGTCACCTTTGGATTCCTAGGCTCGTCGAGAGAATTCAGGCT

[0244] GCCACAACCACTACCGCCATTCCCAACAACATGAACATGAGCTCCGACCAAGTGTTGGTGCCGCCACCGGAGAATT

[0245] CTAGCACGGCAGCATCATCAGACTCGTTTGGGACACAGATTTCACCGATTTCAAGCATGACTGATTATTACAACGATC

[0246] CGGTGAACAATCACTGTAACCAGGATTACGACCTAGTGAATCAGATCCATTACGTACCGGATTCCCTAACCAGCCCCT

[0247] ATGGTTACTTTCACGGTGGGTTAGACTTCCAAGCCATGGAGCAGACCCCGCAGTGGTTTGGGTCCGGGAATACATCA

[0248] GACAATTTATGGAATGTTGAGGACATTTGGTTCCTACAGCAGCAGCTAAACATGTGA

[0249] SEQ ID NO.3

[0250] Nucleotide sequence of AcPGI1:

[0251] ATGGCGTCGATTTCAGGCCTCTGCTCTTCTTCATCCACACTTAAGCCCGAGAAATTCACCCCCAAGTCAACTCCGTAT

[0252] TCATCGTCTGCAAGAGAATCGATCGCATTCCCCTACCGATCGAAGCTCTTCGACCGATCCCGCGATCGAGCTTCGATT

[0253] GTCTCCGCAAAATCTGTCGCTCGAGACTTTCCGGCGAGCCTATCGAAGGTGAACAGCGAGTCTCCGGAGGCGAAGA

[0254] AGGGGCTGGAGAAGGACCCGGCGGAGCTGTGGCGGAGATACGTCGACTGGCTGTACCAGCATAAGGAACTGGGGC

[0255] TGTATTTGGACGTGAGTCGTGTCGGGTTCACTGACGAATTCGTGGCGGAGATGGAGCCGAAGTTTCAGGCGGCTTT

[0256] CCGAGCCATGAAGGAGCTCGAGAAGGGAGCGATTTCGAATCCTGATGAAGGGCGAATGGTCGGGCACTACTGGCTT

[0257] AGAAACTCTAAGCTCGCACCGAATTCGTACCTCATGTTGAAGATCGAGAACACGCTCGAAGCCCTGTGCGAGTTTTC

[0258] GAACGACGTCGTCAGTGGTAAGATTAAGCCCCCGTCCTCACCAGAGGGTCGATTTACGCATGTACTCTCTGTTGGAA

[0259] TTGGAGGTTCTTCCCTTGGACCACAGTTTGTTGCAGAGGCGTTGGCTCCGGATAATCCTCCTCTCAAGATAAGGTTC

[0260] ATTGACAATACGGATCCAGCTGGTATTGATCATCAGATTGCTCAGCTTGGCCCTGAGTTGGCTTCCACACTAGTAATT

[0261] GTGATATCAAAGAGTGGAGGTACTCCAGAAACTAGAAATGGTTTATTGGAAGTACAAAAGGCTTTCCGTGAAGCTG

[0262] GGTTGGATTTTGCAAAACAGGGTGTTGCTATAACACAAGAGAATTCATTGTTAGACAACACTGCGAGAATTGAGGG

[0263] GTGGTTAGCTAGATTTCCAATGTTTGACTGGGTGGGTGGTAGAACTTCAGAAATGTCAGCAGTTGGTCTTCTTCCAG

[0264] CAGCACTTCAGGGAATTGACATTAAAGAAATGCTTGCTGGTGCATCATTGATGGACGAGGCAAATAGGACCACTGTG

[0265] GTGAGGAACAACCCTGCAGCATTGCTAGCTTTATGCTGGTATTGGGCTTCTGACGGAGTAGGATCCAAGGATATGGT

[0266] GGTTCTTCCTTACAAGGACAGCTTATTATTATTTAGTAGGTATTTGCAGCAGCTGGTCATGGAATCACTTGGGAAGGA

[0267] GTTTGACCTGGATGGTAATCGGGTGAATCAGGGACTTACTGTTTATGGAAATAAAGGGAGCACAGATCAGCATGCCT

[0268] ACATCCAACAACTGAGGGAGGGTGTGCATAACTTCTTTGCTACGTTTATTGAAGTCCTACGTGATAGACCCCCTGGC

[0269] CATGATTGGGAGCTTGAACCAGGAGTCACATGCGGTGACTACCTGTTTGGTATGTTGCAGGGAACAAGGTCGGCTTT

[0270] GTATGCCAATGATAGGGAGTCCATTACGGTCACCGTGCAAGAAGTGACACCTAGATCAGTAGGGGCATTAGTAGCAC

[0271] TGTATGAGCGAGCAGTTGGAATTTATGCATCACTGGTCAACATTAATGCTTACCATCAACCCGGTGTGGAAGCTGGG

[0272] AAAAAAGCAGCAGGAGAAGTGCTAGCTTTACAGAAGCGGGTTCTATCAGTACTCAACGAGGCCAGCTGTAAAGAA

[0273] CCTGTTGAACCATTGACACTTGATGAAGTAGCCGAGCGTTGCCACGCTCCTGAAGATATTGAGATGATTTACAAGATT

[0274] ATGGCGTCTGTTTCTGGCCTCTGCTCCTCTTCATCAACGTTCAAACCGGATAAATTCACGCGAAAATCGACACTGTTT

[0275] CCTCGGGGAGTGCAATGTTGATGATATGTACGCATAA

[0276] SEQ ID NO.4

[0277] Nucleotide sequence of AcPGI2:

[0278] ATGGCGTCTGTTTCTGGCCTCTGCTCCTCTTCATCAACGTTCAAACCGGATAAATTCACGCGAAAATCGACACTGTTT

[0279] TCTCCAATTGGAAGAGAATCGATCGCATTCCTCAACCGATCGAAGTTCTTAGAGCGATCGAGCTTCTCGGCTCAGTG

[0280] CGTGGCTGGCGAAGTTCCGGTGAGTTTGTCGGCGGCGAAAAACGGATCGCCCGCGGAGAAACGGCTGTTGCAGAA

[0281] GGATCCGAGAGAGCTGTGGCGGAGATACGTTGACTGGTTTTATCAGCACAAGGAGTTAGGGTTGTATTTGGATGTGA

[0282] GTCGGGTCGGGTTCACGGACGAGTTCGTGGCGGAGATGGAGCCGAGGTTTCAGGCGGCTTTTGGAGCCATGGAGG

[0283] AGCTGGAGAAGGGCGCGATTGCCAATCCGGATGAAGGGAGAATGGTCGGGCACTATTGGCTCAGGAACCCTAGTCT

[0284] CGCGCCGAAGTCGTTCCTGAAGTTGCAGATCGAGAACGCGCTTGAAGCCGTGTGCAATTTCGCGGACGATGTCGTC

[0285] AGGGGTAAGATTAAACCCCCATCCTGCCCGGAAGGTCGCTTTACGCATGTACTTTCTGTTGGAATTGGAGGCTCTGC

[0286] CCTTGGACCTCAGTTTGTTGCAGAGGCATTAGCTCCTGATAATCCTCCTCTCAAGATAAGGTTCATTGATAATACAGA

[0287] TCCTGCTGGCATTGATCATCAGATTGCGCAGCTTGGCCCTGAATTGGCTTCTACGCTTGTGATAGTGATCTCAAAGAG

[0288] TGGTGGTACTCCTGAAACTAGAAATGGTTTATTGGAAGTACAGAAGGCTTTCCGTGAAGCTGGCCTGGATTTCTCAA

[0289] AACAGGGCGTTGCTATTACACAAGAAAATTCTTTACTAGACAATACTGCAAGAATTGAGGGTTGGTTAGCTAGATTT

[0290] CCCATGTTTGACTGGGTGGGTGGTAGAACTTCTGAAATGTCTGCAGTTGGTCTACTTCCAGCAGCACTTCAGGGAAT

[0291] TGATATTAAAGAAATGCTTGCTGGTGCATCATTGATGGACAAGGCAAATAGGACCACTGTGGTTAGGAATAACCCTG

[0292] CGGCATTGCTAGCTTTATGCTGGTATTGGGCTTCTGATGGTGTAGGATCCAAGGATATGGTCGTTCTTCCTTACAAGG

[0293] ACAGCCTATTATTATTTAGTAGGTATTTACAGCAGCTGGTCATGGAATCACTTGGGAAGGAATTTGACTTGGATGGTA

[0294] ATCGGGTGAATCAGGGGCTTAGTGTCTATGGGAATAAAGGGAGCACAGATCAGCATGCCTACATCCAACAACTGAG

[0295] GGAGGGTGTGCCCAATTTCTTTGCGACGTTCATTGAAGTACTACGTGATAGACCCCCTGGCCATGATTGGGAGCTTG

[0296] AACCTGGCGTCACATGCGGTGACTATCTGTTCGGAATGCTACAGGGAACAAGATCTGCTTTGTATTCTAATGATCGGG

[0297] AGTCCATTACGGTTACGGTGCAAGAAGTGACACCAAGATCAGTTGGGGCACTAATAGCACTGTATGAACGAGCTGTT

[0298] GGGATTTATGCCTCACTGGTTAACATTAACGCTTATCATCAACCTGGGGTGGAAGCTGGGAAAAAAGCAGCTGGAGA

[0299] AGTTCTAGCTCTCCAAAAACGGGTCCTTGCAGTACTCAATGAGGCCAGCTGTAAAGAGCCTGTAGAACCATTAACCC

[0300] TCGATGAAGTAGCCGAGCGCTGCCATGCTCCGGAAGATATTGAGATGATTTTCAAGATAATTGCTCACATGGCTGCCA

[0301] ATGACAGAGCACTTATCGCCGAAGGCAGCTGCGGTTCACCTCGCAGCATCAAAGTTTACCTCGGAGAGTGCATTGTT

[0302] GACTTGTAA

[0303] SEQ ID NO. 5

[0304] Nucleotide sequence of AcPMI:

[0305] ATGGAGGCTAATGGCTCGGCGAGTCGGAGGAGCGTTCGGAGACTGAGATGCTCGGTGAAGAACTACGATTGGGGTC

[0306] GAATCGGGCGAGAAGCGAGGGTTGCGGGGCTGTTCTCGCTGAATTCGGGGGTTGACACGGACGAAGACAAGCCTT

[0307] ATGCGGAGTTTTGGATGGGCACTCACGAGTCTGGAGCGTCATTTTTGGTTGAGAGCAGCGAGGATGAAGCGTCGAT

[0308] TGGTTCGGAGACTGAGGGTTTGAGTTTGAAGTCGTGGATTGCGAAAAACCCTGATGTGCTTGGGGAAAAGGTTGTT

[0309] CAGAAGTGGGGTGCTAATCTTCCTTTCTTGTTCAAGGTACTTTCAGTTGCAAAGGCCTTGTCTATACAGGCACACCCT

[0310] GACAAGGAATTGGCTGTGACTCTGCATAAGATGCGGCCTGATGTTTTCAAGGATGATAACCACAAGCCTGAAATGGC

[0311] TTTGGCATTGACAGAGTTCGAAGCCCTTTGTGGGTTTATTAGTCTTGAGGAACTTAAGGATGTTCTTCAAAATGTTCC

[0312] GGAGCTTGCAGAAGCGGTTGGCACTGAATGTGCTAATCAAGTGTTATACATCAGTAGTCAAGATGGGGAGGAGAAA

[0313] GTAAAAGAAGTTCTACAGTCAATGTTCACCGAACTCATGTCTGCTAGCAAGGATGTGATTTCGAAAGCCTTATCCAA

[0314] ATTGAAAACTCGGCTCGACATGGCGAGTGAGGTGAGGCAGTTGACGGATAAGGAACAGCTAGTAGTGCGGTTAGAA

[0315] ACACAGTATCCATCGGATGTGGGTGTCCTAGCAAGCTTCCTTTTTAACTACGTGAAGCTTAATCCAGGGGAAGCATT

[0316] GTATCTAGGGGCAAATGAACTTCATGCCTATTTAAAGGGTGAGTGTATCGAATGCATGGCAACTTCAGACAACGTTGT

[0317] ACGTGCTGGCTTAACTCCGAAGGAACGCGATGTCCAAATTCTTTGTTCCATGCTCACATACAAACAGGGCTTTCCTA

[0318] AAATTTTGGAAGGAGTTCCTTTAAATCCATACACCCGACGGTACCTCCCTCCTTTCGATGAATTTGAAGTTGATCGCT

[0319] GCATTCTTCCCCAGGGGGCATCTTCTGTTTTTCCACCATCCCCCGGGCCCTCTATTTTTGTGGTCATTGAGGGCGAGG

[0320] GAACAATGCATGCAAAATCTTTTGAAGATATAGTTAGAGAGGGTGATGTTCTATTCGCCCCTGCAAATACCGATATCA

[0321] ACGTGACAACAGCATCTGAATTACATATATATAGAGCCGGCATTAATAGCAGGTTCTTTTAASEQ ID NO. 6

[0322] Nucleotide sequence of AcPMM:

[0323] ATGCTACTCGGACACTCATCCAGCATCTCAGATCTGCTTCAGCCTCTGGATTCGCATTATATTCCCCGCTCGCCTCCTT

[0324] TTCGTCACCAAATTTCCCTCAGCATACTGAAAATGGAAGCAAGGAAGCCTGGAGTGATTGCTCTATTTGACGTTGAT

[0325] GGGACTCTTACAGCTCCACGAAAGGCGGCTACTCCTGGTATGCTGAACTTCATGCGGGAACTTCGGAAGGTTGTTAC

[0326] GATTGGTGTTGTTGGAGGGTCTGACCTTGTTAAGATATCGGAGCAGCTTGGGAAATCAGTGATAAATGACTACGATT

[0327] ACGCATTTTCGGAAAATGGTCTTGTGGCCTATAAAGACGGGAAGCTCATTGGAACTCAGAGCTTGAAGTCGCATCTT

[0328] GGAGAAGAAAAACTGAAGGAGTTAATTAATTTTACGCTACATTACATTGCTGATTTGGATATACCAATAAAGAGAGG

[0329] AACATTTATAGAGTTCCGAAGCGGTATGCTCAATGTATCACCAATTGGCCGAAACTGCAGCCAGGAAGAAAGGGATG

[0330] AGTTTGAAAGATATGACAAGGTCCACAACATACGCCCCAAGATGGTGTCTGTGCTCCGTGAAAAATTCTCACACCTT

[0331] AACCTCACCTTTTCCATAGGGGGACAAATAAGTTTCGATGTGTTCCCTCAGGGTTGGGACAAGACTTATTGTTTGAG

[0332] ATACCTGGATGATTTTCATGAAATCCACTTCTTTGGAGACAAAACTTACAAGGGAGGAAATGACTTCGAGATATATGA

[0333] ATCCGAGCGAACAATGGGTCATACAGTTACCAGCCCGGAAGACACAGTACAGCAGTGTACCGATCTCTTCCTATCCA

[0334] AGCAAGTCTGA

[0335] SEQ ID NO.7

[0336] Nucleotide sequence of AcGMP:

[0337] ATGAAGGCTCTTATTCTAGTTGGAGGTTTTGGAACTCGGCTGAGGCCGTTGACCCTTAGTGTTCCAAAGCCACTTGT

[0338] TGAATTTGCTAACAAACCTATGATCTTGCACCAGATTGAGGCTCTCAAGGCAATCGGAGTGACTGAAGTGGTTCTAG

[0339] CTATCAATTACCAACCAGAGGTGATGTTGAACTTCTTGAAGGATTTTGAGACAAAACTTGGAATCAAGATCATGTGC

[0340] TCACAAGAGACTGAGCCACTCGGCACTGCTGGTCCTCTGGCTCTGGCTAGGGACAAACTGATAGATGATTCCGGTG

[0341] AGCCATTTTTCGTTCTTAACAGTGATGTTATCAGTGAATACCCCCTCAAAGAGATGATCGAATTCCATAAATCCCATGG

[0342] AGGTGAAGCTTCCATAATGGTGACTAAGGTTGCCGAGCCATCAAAATACGGTGTGGTGGTTACGGAAGAATCAACT

[0343] GGGCAAGTCGAGAGATTTGTAGAAAAACCTAAAATATTCGTGGGTAACAAGATCAATGCCGGGATTTACTTGCTGGA

[0344] CCCATCTGTTCTTGATCGAATTGAACTGAGGCCCACCTCAATTGAAAAAGAGATCTTCCCAAAAATCGCAGCAGAGA

[0345] AAAAGCTTTACGCCATGGTTTTACCAGGCTTTTGGATGGACATTGGACAGCCGAGGGATTACATCACTGGCCTCAGA

[0346] CTTTACCTAGACTCGTTGAGAAAGAAATCTTCGTCTAGATTGGCTACTGGACCTCATGTTGTGGGCAATGTTCTGGTG

[0347] GACGAGACCTCAAAAATCGGAGAAGGGTGTTTGATTGGGCCTGATGTTGCAATTGGCCCGGGCTGTGTGGTTGAGT

[0348] CAGGAGTTCGACTCTCTCGCTGCACTATTATGCGTGGAGTCCGCATCAAGAAACATGCATGCATTTCCAGTAGTATCA

[0349] TTGGCTGGCACTCCACCGTCGGCCAGTGGGCCCGTGTGGAGAACATGACCATTCTCGGAGAGGACGTTCACGTCTG

[0350] TGACGAAATTTACAGCAACGGAGGAGTAGTTCTGCCCCACAAAGAGATAAAATCTAGCATTTTGAAACCAGAAATA

[0351] GTTATGTGA

[0352] SEQ ID NO.8

[0353] Nucleotide sequence of AcGME1:

[0354] ATGGGAAGCACCAGTGAATCTAACTACGGATCGTACACCTATGAGAATCTCGAGAGGGAACCCTACTGGCCGGAGG

[0355] CGAAGCTCCGCATCTCCATTACTGGAGCCGGTGGGTTCATTGCCTCGCACATTGCAAGGCGACTGAAGGGCGAGGG

[0356] GCATTACATCATTGCTTCTGACTGGAAGAAAAACGAGCACATGACCGAGGACATGTTTTGTCACGAGTTCCATCTCG

[0357] TTGATCTCAGGGTGATGGACAACTGCTTGAAAGTCACGACCGGAGTCGATCATGTGTTCAATCTTGCTGCTGATATG

[0358] GGTGGTATGGGATTCATTCAGTCCAACCACTCGGTCATTATGTATAACAACACGATGATCAGCTTCAACATGCTTGAA

[0359] GCAGCTAGGGTCAATGGTGTTAAGAGGTTCTTTTATGCTTCTAGCGCTTGTATTTATCCTGAATTTAAGCAGTTGGAC

[0360] ACTAATGTGAGCTTGAAGGAGTCTGATGCTTGGCCCGCTGAGCCTCAAGATGCTTATGGTTTAGAGAAGCTTGCAAC

[0361] CGAGGAATTATGCAAGCACTACACCAAGGACTTTGGCATTGAATGTAGGATTGGAAGGTTTCATAACATTTATGGAC

[0362] CTTTTGGCACATGGAAAGGTGGAAGGGAGAAAGCCCCTGCTGCATTCTGCAGAAAGACCCTTACCTCCACTGATAG

[0363] GTTTGAGATGTGGGGAGATGGTCTGCAAACCCGATCTTTCACCTTCATTGATGAATGTGTCGAAGGTGTCCTAAGAT

[0364] TGACAAAATCAGACTTCAGAGAACCAGTGAATATAGGAAGCGATGAGATGGTCAGCATGAATGAGATGGCCGAGAT

[0365] CGTTCTCAGCTTCGAGGACAAGAAGCTGCCCATCCATCACATTCCTGGCCCAGAGGGGGTCCGTGGTCGAAACTCG

[0366] GACAACACCCTGATTAAGGAGAAGCTTGGGTGGGCCCCAACTATGAAACTGAAGGATGGGCTGAGGTTCACATACT

[0367] TCTGGATCAAGGAGCAACTTGAGAAAGAGAAGGCTCAGGGCATCGATCTGTCAACTTATGGATCGTCAAAAGTTGT

[0368] GGGAACGCAAGCCCCGGTTCAGTTGGGCTCTCTTCGTGCTGCTGATGGCAAAGAATGASEQ ID NO. 9

[0369] Nucleotide sequence of AcGME2:

[0370] ATGGGAAGCACCGGTGAATCTAACTACGGATCATACACCTATGAGAACCTCGAGAGGGAACCCTACTGGCCGGAGG

[0371] CGAAGCTCCGCATCTCCATAACTGGAGCCGGGGGGTTCATTGCCTCGCACATTGCAAGGCGACTGAAGGGCGAGGG

[0372] GCATTACATCATTGCTTCTGACTGGAAGAAAAACGAGCACATGACCGAGGACATGTTCTGTCACGAATTCCATCTTG

[0373] TTGATCTCAGGGTGATGGACAACTGCTTGAAAGTCACAACCGGAGTTGATCATGTGTTCAATCTTGCTGCTGATATG

[0374] GGTGGGATGGGCTTCATTCAGTCCAATCACTCAGTCATTATGTATAACAACACAATGATCAGCTTCAACATGCTTGAA

[0375] GCTGCTAGGGTCAATGGTGTTAAGAGGTTCTTTTATGCTTCTAGCGCTTGTATTTACCCTGAATTTAAGCAGTTGGAC

[0376] ACAAATGTGAGCTTGAAGGAATCTGATGCTTGGCCCGCTGAGCCTCAAGATGCTTATGGTTTAGAGAAGCTTGCAAC

[0377] CGAGGAGTTATGCAAGCACTACACCAAGGACTTTGGCATTGAATGTAGGATTGGACGGTTTCACAACATCTATGGAC

[0378] CTTTTGGCACATGGAAAGGTGGGAGGGAGAAAGCCCCTGCTGCATTCTGCAGAAAGACCCTTACCTCCACTGATAG

[0379] GTTTGAGATGTGGGGAGACGGTCTGCAAACCCGATCTTTCACCTTCATTGATGAATGTGTCGAAGGTGTCCTAAGAT

[0380] TGACGAAGTCAGACTTCAGAGAACCAGTGAATATCGGAAGTGATGAGATGGTCAGCATGAATGAGATGGCCGAGAT

[0381] CGTTCTCAGCTTCGAGAACAAGAAGCTGCCCATCCATCACATTCCGGGCCCAGAGGGCGTCCGTGGACGAAACTCG

[0382] GACAACACCCTGATTAAGGAGAAGCTTGGGTGGGCCCCAACTATGAAACTGAAGGATGGGCTGAGATTCACATACT

[0383] TTTGGATCAAGGAACAACTTGAGAAAGAGAAGGCTCAGGGCATCGATCTGTCGACTTATGGGTCATCAAAAGTTGT

[0384] GGGAACGCAAGCCCCGGTTCAGTTGGGCTCTCTTCGTGCTGCTGATGGCAAAGAATGASEQ ID NO. 10

[0385] Nucleotide sequence of AcGGP1 :

[0386] ATGTTGAAGATCAAGAGGGTTCCGACTGTTGTTTCCAATTTCCAAAAGGATGAGGCCGACGACGGCGCTCGATCTG

[0387] GCGGTGGTTGCGGCCGAAACTGCCTCCAGAAGTGTTGCATTCAAGGGGCAAAGCTACCTCTGTATGCTTTCAAGAG

[0388] GGTGAATGAGGTTGTTGGTGAAAAGGGTGTGCTTGCCCTCGACAACGAAGAGGCTCCTGTTGCTTTCTTGGATTCA

[0389] CTTCTCCTCGGGGAGTGGGAGGATCGTGTGCAGAGAGGACTCTTTCGTTACGATGTCACTGCTTGCGAAACCAAGG

[0390] TTATTCCGGGAGAGTATGGCTTCATTGCGCAGCTGAACGAGGGTCGTCACCTTAAGAAGAGGCCAACTGAGTTTCGT

[0391] GTTGATAAGGTCCTGCAGCCCTTCGATGGGAGCAAATTCAACTTCACTAAAGTTGGACAGGAAGAGGTTCTGTTCC

[0392] AGTTTGAAGCAAGCAACGACAACGAAGTCCAGTTCTTCCCAAATGCACCTGTTGATGTTGAGAATTCTCCCAGTGTT

[0393] GTGGCCATCAATGTTAGTCCTATTGAATATGGTCACGTACTTCTCATCCCTTCGATTCTTGAATGCCTGCCTCAAAGGA

[0394] TTGACAGGGAGAGCTTCTTGCTTGCTCTTCACATGGCAGCAGAAGCTGGAAACCCGTACTTCCGATTGGGTTACAAC

[0395] AGCTTGGGTGCATTTGCCACTATCAATCACCTTCATTTCCAGGCTTATTACTTAGCCGTGCCCTTCCCTATCGAGAAGG

[0396] CTCCCACTAGGAAGATAACTACTCTGAATGGTGGGGTGAAAATCTCTGAGCTGCTAAATTATCCAGTCAGAGGGCTT

[0397] GTTTTCGAGGGTGGAAATACTCTGGAAGATTTGTCCAATGCCGTCTCTGATTCCAGCATTTGCCTTCAAGGCAACAA

[0398] CATACCTTACAATGTGCTTATCTCCGATTCTGGAAAGCGTATCTTTCTTTTACCGCAGTGTTACGCTGAGAAACAGGC

[0399] TCTTGGAGAAGTGAGTTCTGAGCTTCTGGACACACAAGTGAACCCGGCAGTGTGGGAAATCAGCGGACATATGGTT

[0400] TTGAAGAGGAAGGAGGACTATGAGGAGGCGTCTGAAGGAAATGCTTGGAGGCTCCTTGCTGAGGTCTCCCTTTCGG

[0401] AGGAGAGGTTCGAAGAAGTCAAGGCATTGATCTTTGAAGCCATCTCTTGTGCTGATGATGGAAGCGGCAGCACAGC

[0402] TGAGAACTTGCTTGAGGAGCCAGATGACAATCCTCAATCTCGTGAAGAAGCAAATGATGCCCTTAACAAAGGCTCC

[0403] CACTGTGGTATGGTGCCGGGAAAGCAAGAATGCCTAGTTCAGCACTGA

[0404] SEQ ID NO. 11

[0405] Nucleotide sequence of AcGGP2:

[0406] ATGTTGAAGATCAAGAGGGTTCCGACTGTTGTCTCCAATTTCCAAAAGGATGAGGCCGAGGACGGCGCTCGATCCG

[0407] GCGGTGGTTGCGGCCGAAACTGCCTCCAGAAGTGTTGCATTCAAGGGGCAAAGCTACCTCTGTATGCTTTCAAGAG

[0408] GGTGAAAGAGGTTGTTGGTGAAAAGGGTTTGCTTGCCGTCGACGACGAAGAGGCTCCTGTTGCTTTCTTGGATTCA

[0409] CTTCTTCTCGGGGAGTGGGAGGATCGTGTGCAGAGAGGACTCTTTCGCTACGATGTCACTGCTTGCGAAACCAAGG

[0410] TTATTCCAGGAGAGTATGGCTTCATTGCGCAGCTGAACGAGGGTCGTCACCTTAAGAAGAGGCCAACTGAGTTTCGT

[0411] GTTGACAAGGTCCTGCAGCCCTTCGATGAGAGCAAATTCAATTTCACTAAAGTTGGACAGGAAGAGGTGCTGTTCC

[0412] AGTTTGAAGCAAGCGACGACAATGAAGTCCAGTTCTTCCCAAATGCACCTGTTGATGTTGAGAATTCTCCCAGTGTT

[0413] GTGGCCATCAATGTTAGTCCTATTGAATATGGTCATGTACTTCTGATCCCTCGGATTCTTGAATGCCTGCCTCAGAGGA

[0414] TTGACAGGGAGAGCTTCTTGCTTGCTCTTCACATGGCAGCAGAAGCTGGAAACCCGTACTTCCGATTGGGTTACAAC

[0415] AGCTTGGGTGCATTTGCCACTATCAATCACCTACATTTCCAGGCTTATTACTTAGCTGTGCCCTTTCCTATCGAGAAGG

[0416] CTCCCACTAGGAAGATAACTACTCTGAATGGTGGGGTGAAAATCTCTGATCTGCTAAATTATCCAGTCAGAGGGCTT

[0417] GTTTTCGAGGGTGGAAATTCTCTGGAAGATTTGTCCAATGCCGTCTCTGATTCCAGCATTTGCCTTCAAGGCAACAA

[0418] CATACCGTACAATGTGCTTATCTCCGATTCTGGAAAGTGTATCTTTCTCTTACCGCAGTGCTACGCTGAGAAACAGGC

[0419] TCTTGGAGAAGTGAGTTCCGATCTTCTGGACACACAAGTGAACCCGGCAGTGTGGGAAATCAGCGGACATATGGTT

[0420] TTGAAGAGGAAGGAGGACTATGAGGAGGCGTCTGAAGGAAATGCTTGGAGGCTCCTTGCTGAGGTCTCCCTTTCGG

[0421] AGGAGAGGTTCGAAGAAGTCAAGGCATTGATCTTTGAAGCCATCTCTTGTGCTGATGATAGAAGTGGCAGCACGGC

[0422] TGAGAACTTGCTCGAGGAGCCAGATGACAATCCACAATCTCGCAAAGTAGCGAATGATGCCCTTAACAAAGGCTCC

[0423] CACCGAGGTATGGTGCCAGGGAAGCAAGAATGCCTAGTTCAGCACTGA

[0424] SEQ ID NO. 12

[0425] Nucleotide sequence of AcGPP:

[0426] ATGGCCAAAAACGATTCATACTCAGAGTTCCTCGCCATTGCAATCGATGCAGCGAAGGAAGCTGGAGAGGTAATCC

[0427] GCAAAGGGTTTTACCAAACCAAGCATGTGGAGCATAAGGGCCAGGTGGACTTGGTCACAGAAACTGATAAGGCGT

[0428] GTGAAGATCTCATATTCAATCATCTTAAGCTGCATTTCCCTGACCACAAGTTCATTGGTGAAGAAACCACTGCTGCTT

[0429] GTGGCATTACCGAGCTGACTGATGAACCAACATGGATTGTTGATCCTCTTGATGGGACAACTAACTTTGTGCACGGG

[0430] TACCCCTTTGTATGTGTCTCTATTGGTCTAACAATTGGAAAGGTCCCCACAGTAGGTGTCGTCTACAACCCAATTATG

[0431] AATGAGCTTTTCACCGGCATCCATGGACAAGGTGCTTTTCTCAATGGAAACCCTATAAAAGTGTCATCCCAGTCTGA

[0432] ACTCGTGAAGTCGCTCCTTAGTACTGAGGTAGGAACGAAACGTGATAAGTTAACTGTGGATGCCACTACAAATAGAA

[0433] TTAAGAGCTTACTGTTCAAGGTGAGATCCCTTCGGATGAGCGGCTCTTGTGCACTGAACCTTTGTGGGATTGCATGT

[0434] GGAAGGCTCGACGTATTCTATGAACTTGGCTTTGGGGGTCCTTGGGATGTGGCCGGTGGTGCTGTGATTGTTAAAGA

[0435] AGCTGGAGGGGTTCTGTTCGATCCTTCCGGTAAAGAGTTTGACATCAGCGCCCAGCGAATAGCAGCATCGAATCCAC

[0436] TTCTCAAGGATGCATTTATCGAGGCATTGCGAGAATCGGAATGA

[0437] SEQ ID NO. 13

[0438] Nucleotide sequence of AcGalLDH:

[0439] ATGTTCCGAACTCTCATTCTCCGGTGCTCCCTCCACCAATCCCACCACCACCACCACCACCACCACCTCAAAAC

[0440] CCTCTCCTCCTCCACCACTCCCCAAAACCCTAAAAACCCCAATCCCACTCGCCCATTTTGCTCCTCACCACCACCAC

[0441] CACCACCACCACCTCCGCCTCCGCCTCCACCACCACCGCTCGCCTCTTCCTCTTCATCGGAGCTCCGCAAGTACCTC

[0442] GGCTACTCCACCCTCCTCCTCGTCTCCGGCATCGTTACCTACTACTCCTTCCCCTTCCCCGAAAACGCCAAGCACAA

[0443] AAAAGCCCACCCCTTCCGCTACGCCCCATTGCCCGAAGATCTCCACACGGTCTCCAATTGGAGCGGGACCCACGAG

[0444] GTCCAAACTAGGACTTACCTCCAACCCGAAACCCTGCAGGAATTGGAGGAAATTGTGAAAAATGCCAATGAAAAGA

[0445] AGCAGAAGATCCGACCCGTGGGATCCGGGCTGTCGCCCAACGGTATCGGGCTGACGAGGCAGGGGATGGTGAATTT

[0446] GGCCCTCATGGATAGCGTTTTGGAGGTGGATAAGGAGAAGAAGAGGGTTAGGGTTCAGGCTGGGATCCGGGTTCAG

[0447] CAGCTGGTGGATGGGATCAAAGATTATGGGCTCACCTTGCAGAATTTCGCATCGATTCGGGAACAGCAGATTGGGGG

[0448] CATTGTTCAGGTTGGCGCACATGGCACTGGTGCAAGGTTGCCTCCTATTGACGAGCAAGTCATCAGCATGAAACTGG

[0449] TTACTCCTGCCAAGGGGACAATAGAAATTTCACGAGAGAAAGATCCAGAACTCTTCTATCTTGCTCGCTGTGGACTT

[0450] GGGGGCCTTGGAGTGGTTGCAGAAGTGACTCTTCAATGTGTTGAGAGACAAGAGCTAGTGGAGCACACATTTGTTT

[0451] CAAATATGAAGGAAATAAAGAAAACGCACAAGAAGTTGCTATCAGAGAACAAACATGTCAAGTATCTGTACATTCCA

[0452] TATACTGACACTGTTGTCGTTGTGACGTGCAACCCTGTCTCCAAATGGAAAGGTCCGCCCAAGTTTAAATCAAAATAT

[0453] AGCCATGATGAGGCTATACAGCCTGTTCGTGACCTCTACCAGGAGTCTCTGAAGAAGTACAGAGGTGAAGAAATTG

[0454] CAGCCAAACCTCTCGACAACAATGAACCAGACATAAATGATCTTTCATTTACAGAGCTGAGAGATAAACTACTTGCC

[0455] CTCGATCCTCTTAACAAAGACCATGTCGTAAAGGTCAATCAAGCTGAAGCAGAGTTCTGGACGAAGTCAGAGGGAT

[0456] ACAGATTAGGCTGGAGTGATGAGATTCTGGGTTTTGATTGTGGTGGCCAACAGTGGGTTTCAGAGACCTGTTTTCCT

[0457] GCTGGAACCTTAACAAAGCCCAGTATGAAGGATCTTCAATTCATGGAAGATGTGATGCAGCTTATAGAAAAGGAAAT

[0458] GATACCTGCACCTGCTCCTATAGAGCAGCGGTGGACGGCTCGAAGCAAAAGCCCTATGAGCCCGGCTTCAAGTGCA

[0459] GCAGAGGAAGACATTTTCTCCTGGGTTGGTATAATTATGTATCTCCCTACAATGGATCCTCGCCAGAGGAAAGAGATA

[0460] ACAGAAAAGTTCTTCCACTACAGGCGTTTGACTCAAACACAATTATGGGATCAGTATTCTGCTTACGAACATTGGGC

[0461] AAAGATTGAGGTTCCGAAGGACAAGGACGAGCTTGCAGCTCTGCAAGCAAGGTTGAGGAAGCGTTTTCCAGTGGA

[0462] TACATACAATAAAGCACGAAGTAAATTAGACCCCAATCGGATCCTTTCTAATAACATGCTGGAGAAATTGTTCCCACT

[0463] GTCCGATAAAATTTGA

[0464] SEQ ID NO. 14

[0465] Nucleotide sequence of AcGalUR:

[0466] ATGGAAATTAGTACCCACCAACAAGCTTGTCAGAAGAAAATGGGGTTTGTTCCAGAGGTGACGTTGGGCTGCTCCG

[0467] GCCAGACTAT GCCGGTGATC GGCATGGGGA CCGCCTCGTA CCCTGATGCC GGACCTGGAA ACTGCCAAGT CAGCCAT

[0468] CATCGAAGCC ATGAGAGCGG GGTAACGCCA CTTTGACACG GCCTTCGCAT ACCGTCGGAG CAGCCCCTCG GGGA

[0469] GCCATAGCTG AGGCTCTCCA TCTCGGCATC ATCAAGTCCC GCGACGAGCT CTTCATCACC ACCAAGCTC TGGTGTAG

[0470] CTTCGCCGAA CGGGACCAGA TCCTTCCTGC CATCAAAATC AGCCTCCAGA ATCTTCAGCT GGACTACGTG GATATGT

[0471] ATCTGATTC ATGGCCAGTC AGATTGACCC AACACGTAA CTAAAACCCC AATTCCAAAA GAACAAGTAG TTCCCATG

[0472] GATATGAAGA CAGTCTGGGA AGGCATGGAG GAGTGTCAGA ATCTTGGCCT CACCAGAGGC ATTGGTGTCAG TAATT

[0473] TCTCTTGCAA GAAGCTTGAA GACCTCCTCT CTTTTTGCAA AATCCCACCA GCCATCAATC AGGTGGAGAT GAACCCA

[0474] CTTTGGAAAC AAAAGGAATT GGTGGAGTTG TGCAAGGCAA AGGGTGTTCAC CTCGCAGCTT ACTCTCCTTT GGGTG

[0475] CAAATGGGA CTAATGGGGA GACAATAGAA TTGTGGAATG TGATGTCCTT GAGGAGATTC CCAAGGCTAG AGGCAA

[0476] ATCCACCGC CCAGGTGGCT CTGAGGTGGG TGTATGAGCA AGGTGCAAGT ATAATATCGA AGAGCTTCA ACAAGCAA

[0477] AGGATGAGGGAAAATCTTGATATATTTGATTGGTGTTTGACAGAGGAAGAGTCAAACAAGATAATTCAGCTCCCTCA

[0478] GCATAAAGGCGTTACCTTAGCTTCTATTTTGGGGCCCCATGATCTGGTATTGGAGATTGATGCAGATCTCTAASEQ ID NO.15

[0479] Nucleotide sequence of AcMIOX:

[0480] ATGACCATCCTCATAGATCAACCTGATTTTGGGGTTGAGGCAGAGGAGAAGAAGAAGATCCCAAACAAGGAAAATG

[0481] AATTGGTGTTGGACGATGGTTTTGTGGTGCCAGTCACCAATTCATTTGGCCACAACTTTAGGGATTATGATGCAGAAA

[0482] GCCTCAGGCAAGGAGTTGTTGAAAATTTTTACCGCGTCAATCACATTAAGCAAACCTTCGACTTCGTCAAGAGAATG

[0483] AGAGAAGAATACAGCAAATTGGACAAGGTTGAGATGAGCATATGGGAATGCTGTGAGCTTCTCAATGACGTCCACG

[0484] ACGAGAGTGATCCAGATTTGGATGAGCCTCAGATTGAGCACTTGTTGCAGACAGCTGAGGCTATTAGGAAAGACTAT

[0485] CCTGATGAAGATTGGGTCCACTTGACTGCCCTTATTCATGATCTTGGAAAGGTCCTTCTTCATCCGAGTTTTGGGGAG

[0486] CTCCCTCAGTGGGCTGTTGTGGGTGACACCTTTCCCGTGGGGTGTGCATTCGATGAAACAATAGTTCATCACAAGTA

[0487] CTTCGAGGAAAATAAGGATTATAACAATCCTGCTTACAACACCAAATATGGAGCTTATTCTGAGGGTTGTGGACTCAA

[0488] CAATGTTATGATGTCGTGGGGACATGACGACTACATGTATTTGGTGGCCAAGGAGAACAAGACAACCTTACCTTCAG

[0489] CAGCTCTGTTCATCGTCAGATACCACTCATTCTACGCTTTACATAGATCAGGAGGATATAAGCACTTAATGAATGAGG

[0490] AAGACATTGAGAATCTAAAGTGGCTCCAAGTATTTAACAAGTATGATCTATATAGCAAGAGCAAGGTGAGAATTGAC

[0491] GTCGAAAAAGTCAAGCCATACTATCTCTCTCTCATTGAAAAGTACTTCCCCGCTAAGCTGAGGTGGTGASEQ ID NO.16

[0492] Nucleotide sequence of AcMDHAR:

[0493] ATGGCAGAGAAGAGATTCAAGTACGTGATTCTCGGTGGTGGCGTCGCCGCTGGTTATGCGGCTAGAGAATTTGCCAA

[0494] TCAGGGTGTTAAGTTTGGAGAGCTTGCAATTATTTCCAAAGAGGCGGTTGCTCCTTATGAACGTCCAGCACTTAGCA

[0495] AGGCATACCTGTTTCCTGAATCACCTGCAAGACTTCCAGGGTTTCATACCTGTGTTGGAAGTGGAGGAGAGAGACT

[0496] GTTACCTGAGTGGTATGCAGAGAAAGGAATTGCATTGATCCTTGGCACAGAAATCGTGAAAGCAGATCTTGCTTCAA

[0497] AGACTCTAATCAGTGCAGCTGGAGAAATTTTCAAGTTTCATATTTTGGTCATTGCAACTGGTTCCACGGTTATAAGGT

[0498] TGACAGACTTTGGTGTACAAGGAGCTGATTCCAAAAACATCTTCTACTTGAGAGAAGTTGATGATGCTGATAAGCTT

[0499] GTAGAAGCAATTAAAGCAAAGAAAAAAGGAAAGGCTGTGATTGTTGGAGGAGGATACATCGGTCTTGAGCTAAGC

[0500] GCCGTGATGAAAATTAACAATCTTGATGTCAGCATGGTTTACCCAGAACCATGGTGCATGCCTCGGCTTTTCACAGCT

[0501] GGTATAGCTGCTTTCTATGAAGGCTATTATGCAAATAAGGGAATTCAAATTATCAAGGGAACTGTGGCTGTTGGGTTT

[0502] AACGCTGATGCAGATGGAGAGGTAAAGGAAGTAAAACTTAAGGATGGCAGGGTGCTAGAAGCGGACATCGTTGTTG

[0503] TTGGTGTTGGAGGTAGACCTCTTACAGTGTTATTCAAAGGACAGGTTGAAGAGGAGAAAGGTGGAATTAAGACTGA

[0504] CAGTTTCTTCAGAACAAGTGTTCCTGATGTTTATGCTGTGGGTGATGTTGCTACTTTCCCGATGAAAATGTATGATGA

[0505] GATGAGAAGAGTTGAGCATGTTGATCACTCCCGTAAATCTGCTGAGCATGCTGTGAAGGCTATCTTTGCAAGTGAAG

[0506] TGGGGAAGTCAGTTGACGAATACGACTACCTTCCTTACTTCTATTCCCGTTCCTTCAACCTGTCATGGCAGTTCTATG

[0507] GCGACAACGTTGGTGCCACAGTGCTATTTGGAGACAACAACCCATCATCGGAAAATCCCAAGTTCGGATCATACTGG

[0508] ATCAAAGATGGGAAGGTGGTCGGCGCTTTTCTGGAGAGTGGGACCCCGGAAGAAAACAAGGCCATTGCCAAAGTC

[0509] GCAAGGGTCCAACCCCCAGCCGAGAGTTTGGACCAATTGGCAAAAGAGGGTCTCACCTTTGCCTGCAACATTTGASEQ ID NO.17

[0510] Nucleotide sequence of AcAO:

[0511] ATGCCGCTGAATTTGGCGGCCGTCTTTTGCCTTGCGGTGTCTCTCTTCGCCGTCGTTGGGGCTGATGATCCGTACAGG

[0512] TTTTTCAATTGGAATGTAACTTATGGAGACATTTATCCACTCGGTGTTCGCCAACAGGGGATTCTAATTAATGGCCAAT

[0513] TCCCAGGTCCTGATATATACTCTGTCACCAATGATAATCTCATTATCAACGTTTTTAACAGCTTGGACGAGCCTTTTCT

[0514] TCTCTCCTGGAATGGGATCCAACAGAGGAGAAATTCTTATCAAGACGGAGTTTATGGGACGACATGTCCCATACCTC

[0515] CAGGGAAGAATTTCACGTACATTCTCCAAGTAAAGGACCAAATCGGGAGTTTCTACTACTTCCCGTCCCTTGCATTC

[0516] CACAAGGCTGCAGGTGGCTTCGGAGGTATCAGAATCCTAAGTCGCCCTAGAATTCCTGTCCCCTTCCCGGATCCGGC

[0517] AGGTGACTATACGGTTCTGATCGGAGATTGGTACAAATCTAACCACACGGATTTGAAGGCGAAGCTGGATCGAGGCA

[0518] AGAAGCTGCCTTTGGCGGATGGGATCCTCATTAATGGCCGTGGGCCTAATGGTGCTTCTTTCACTGTTGAACAAGGA

[0519] AAGACTTACAGGCTACGTATATCGAACGTTGGGCTGCAAAATTCACTGAATTTCCGAATTCAGGGCCACAGGATGAC

[0520] ACTGGTGGAGGTGGAGGGAACACACTCTGTCCAAACTAGCTACTCGTGGTTGGACGTTCATCCGGGCCAGTCCTAC

[0521] TCGGTTCTCGTCAAAGCTGATCAGCCCGCTCAGGATTACCTCGTGGCCGTGTCCACCCGTTTCACCACTGACGTCCT

[0522] CACCACCTCCGCCATTTTCCACTACAGCAACTCCGCTGGCCCAGTCTCTGGCCCACCCCCCGGTGGACCCACCATCC

[0523] AAATCGACGAGTCCTTAAACCAGGCCCGCTCTATCAGGACTAATCTTACAGCAAGTGGACCAAGGCCCAATCCACA

[0524] GGGCTCATACCACTATGGTCTCATAAACACCACCAAAACCATCAGGCTTGCCAACTCTGCAGGCCTCATCAATGGAA

[0525] AGCAAAGGTATGCAGTAAACAGTGTATCATTTGTGCCAGCGGACACCCCTCTAAAGCTTGCAGACTTCTTCACTATT

[0526] GAAGGAGTTTTCCGCGTTGGGAGTATATCCGATAACCCTACCGGTGGAGGGTTGTACCTTGACACGTCAGTTTTGGG

[0527] CGTAGACTACAGAGCATTCATCGAAATCGTGTTTGAAAACAAAGAGAACATCGTCCAAAGCTGGCACCTCGATGGT

[0528] TACTCTTTCTTTGTAGTTGGAATGGATGGAGGGTTGTGGTCGTCGGCTAGTAGAAGCCAATATAATCTTCGAGATGCA

[0529] ATTTCACGCTCCACCGTTCAGGTATATCCCAAGTCATGGACTGCTATTTATGTGGCACTTGACAATGTGGGAATGTGG

[0530] AATCTGAGATCGGAGTTTTGGGCACGACAATACCTTGGGCAGCAGCTCTACTTGCGCGTTTATACAGCATCCACTTC

[0531] GCTCAGGGATGAATTCCCCATTCCGAAGAATGCACTTCTATGTGGCAGAGCCAGTGGCCGGCACACACGACCCCTCT

[0532] AA

[0533] SEQ ID NO.18

[0534] Nucleotide sequence of AcAPX:

[0535] ATGGTTCTGCTAGAAGCTTCTCTCTCCTCTAATTCTTATTATATTATCTCACAGTCTGTTCTTGTGCTCTTCGTGTGCTG

[0536] TCCTCGTGCT AGGGCTTTTG CGTTTCTCTCT CTACTCTCTC TCTCTCTGCT CAGTCTCCGT TTCCAAAGAA CTTTA

[0537] GCTATGGCGA AGTGTTACCC GACTGTGAGT GAGGAATACC TGAAGGCTGT CGATAAGGCC AAGAGGAAAC TCAGAG

[0538] GCCTCATCGC TGAGAAGAAC TGTGCTCCGC TTATGCTGCG TCTCGCATGG CACTCTGCTG GTACTTACGA TGTGAAG

[0539] ACAAAGACTG GAGGTCCGTT CGGGACCATG AGGCACAAGC TTGAGCAAAG TCACGCGGCC AATAACGGC CTCGAC

[0540] ATCGCCGTCA GGCTACTAGA GCCCATCAAA GAACAGTTTC CAATCCTCTC CTACGGTGAC TTCTATCAGT TGGCTGG

[0541] AGTTGTTGCC GTTGAAATAC TGGAGGGCCT GATGTTCCAT TCCACCCAGG GAGGCCGGAC AAGCCAGAG CCTCCT

[0542] GTTGAAGGTC GCCTTCCTGA TGCTAACAAG GGAACTGACC ATTTGAGGGA TGTGTTGTTC AAACACATGG GCCTCTC

[0543] TGACAAGGAC ATTGTTGCTC TCTCCGGTGG CCACACCCTG GGAAGGTGCC ACAAGGAACG TTCTGGATTT GAGGGA

[0544] CCCTGGACTA CCAATCCTCT TATCTTTGAC AACTCTTACT TTAAGGAACT CCTGACTGGA GAGAAGGAA GGGCTTCT

[0545] ACAACTGCCA ACTGACAAGG CTCTACTCTG TGATCCCGTC TTCCGCCCTC TTGTTGAGAA ATATGCCGCG GATGAGG

[0546] ATGCCTTTTTTGATGATTATGCTGAAGCTCACATGAAACTCTCTGAACTGGGGTTTGCTGAATGA

[0547] SEQ ID NO. 19

[0548] Nucleotide sequence of AcDHAR:

[0549] ATGGCCGTGGAGCTCTGCGTTAAGGCCGCTTCTGGTTCTCCTGATGTTCTTGGAGACTGTCCTTTTTGCCAGAGGGT

[0550] GCAGCTGACTTTGGAGGAGAAGAATATCCCGTACAAGGTGATTCTGATCAATCTCGACGACAAGCCCCAATGGTTTT

[0551] TGGAATTGAGCCCGGAAGGGAAAGTGCCTGTGATCAAATTTGATGACAAATGGATTCCTGACTCCGATGTAATTGTT

[0552] GGCCTCATTGAAGAAAAATTCCCGGACCCTCCTCTCTCTCCTCCCCCTGAGGTCACCTCTGTCGGGTCCAAGATATT

[0553] CCTTTCTTTAATCAAGTTCTTGAAGAGCAAGGATCCCACTGATGGGACTGAGCAGGCGTTGCTTGATGAGTTGAAGG

[0554] CACTGGATGAACATCTCAAGGCACACGGACCATACGTTAATGACGAAAATATTTGCGCTGTTGACTTAAATTTGGCA

[0555] CCAAAGCTGTTCCACCTTGATGTGACTCTTGCCCATTTCAAGGGATGGAAAGTCCCCGAAAGCTTGACTCATTTCCA

[0556] CAATTACGTGAAGTTGCTCTTCTCTCGGGAGTCATTTAAGAAGACTGAGGTTGCAAAAGAATATGTGATTGCAGGAT

[0557] GGGAGCCTAAGGTCAATGCATGA

[0558] SEQ ID NO. 20

[0559] Fragment nucleotide sequence of AcMYB73 interference vector:

[0560] TTCAGGCCAGTGCCGATTCACTGCGCCTCCTTAGCAGCATCGCATCAGATCGATACGGCGTCGTTAATTCCCGATCCC

[0561] CCCACTTCTCTTAGCCTGTCCTTACCTGGATCCGGTTCAGCTGACCCGCCGGATCTGGTACTCGGATCCAATCAAGTC

[0562] ACCAGCCCCACTCCGGCGGTACCGGTCGCAGCTCCGCCGCCGCCGTCGTCGATAGAGAGACCGTTCTTCAGTGAGG

[0563] ATTTCATGTCTG

[0564] SEQ ID NO. 21

[0565] Fragment nucleotide sequence of AcMYB108 interference vector:

[0566] CGGAGAATTCTAGCACGGCAGCATCATCAGACTCGTTTGGGACACAGATTTCACCGATTTCAAGCATGACTGATTATT

[0567] ACAACGATCCGGTGAACAATCACTGTAACCAGGATTACGACCTAGTGAATCAGATCCATTACGTACCGGATTCCCTA

[0568] ACCAGCCCCTATGGTTACTTTCACGGTGGGTTAGACTTCCAAGCCATGGAGCAGACCCCGCAGTGGTTTGGGTCCGG

[0569] GAATACATCAGA

Claims

1. Use of AcMYB73 or AcMYB108 gene for preparing a preparation for regulating AsA content of kiwifruit fruit, characterized in that, The nucleotide sequence of the AcMYB73 gene is shown as SEQ ID NO. 1, and the nucleotide sequence of the AcMYB108 gene is shown as SEQ ID NO.

2.

2. Use according to claim 1, characterized in that, The ascorbic acid content in the kiwi fruit is increased by increasing the expression of the AcMYB73 or AcMYB108 gene, or is decreased by decreasing the expression of the AcMYB73 or AcMYB108 gene.

3. Use according to claim 2, characterized in that, When the expression of the AcMYB73 gene is increased, the expression level of any one or more of the AcPGI2, AcPMI, AcGME1, AcGGP1, AcGAlLDH and AcMDHAR genes can be increased, while the expression level of the AcAO gene is decreased; when the expression of the AcMYB108 gene is increased, the expression level of any one or more of the AcPGI2, AcGME1, AcGME2, AcGGP1 and AcMDHAR genes can be increased, while the expression level of the AcAO gene is decreased; when the expression of the AcMYB73 gene is decreased, the expression level of any one or more of the AcPGI1, AcPMI, AcPMM, AcGMP, AcGME1, AcGME2, AcGGP1, AcGGP2, AcGAlLDH, AcMIOX and AcMDHAR genes can be decreased, while the expression level of any one or more of the AcAO and AcAPX genes is increased; when the expression of the AcMYB108 gene is decreased, the expression level of any one or more of the AcPGI1, AcPGI2, AcPMI, AcPMM, AcGME2, AcGGP1, AcGGP2, AcGPP, AcGAlLDH, AcGAlUR and AcMDHAR genes can be decreased, while the expression level of the AcAO gene is increased.

4. Use according to claim 3, characterized in that, The nucleotide sequences of the AcPGI1, AcPGI2, AcPMI, AcPMM, AcGMP, AcGME1, AcGME2, AcGGP1, AcGGP2, AcGPP, AcGAlLDH, AcGAlUR, AcMIOX, AcMDHAR, AcAO and AcAPX are shown as SEQ ID NO. 3-18.

5. The use of an AcMYB73 or AcMYB108 gene overexpression vector for the preparation of a preparation for increasing the AsA content of kiwifruit, characterized in that, The gene overexpression vector contains the nucleotide sequence shown as SEQ ID NO. 1 or SEQ ID NO.

2.

6. Use of an AcMYB73 or AcMYB108 gene interference vector for preparing a preparation for reducing the AsA content of kiwifruit, characterized in that, The gene interference vector contains the nucleotide sequence shown as SEQ ID NO. 20 or SEQ ID NO.

21.

7. A preparation for increasing or decreasing the AsA content of kiwifruit fruits, characterized in that, The preparation for increasing the AsA content in the kiwi fruit includes an overexpression vector of the AcMYB73 or AcMYB108 gene; and the preparation for decreasing the AsA content in the kiwi fruit includes an interference expression vector of the AcMYB73 or AcMYB108 gene.

8. The formulation of claim 7, wherein, The overexpression vector contains the nucleotide sequence shown as SEQ ID NO. 1 or SEQ ID NO.

2.

9. The formulation of claim 7, wherein, The interference expression vector contains a nucleotide sequence as shown in SEQ ID NO. 20 or SEQ ID NO.

21.

10. A method of increasing or decreasing AsA content in kiwifruit fruit, characterized by, Applying the preparation as claimed in any one of claims 7 to 9 on kiwifruit fruits.

Images