Site and kit for detecting deramanib-resistant mycobacterium tuberculosis

Abstract

The invention discloses a site and a kit for detecting deramanib-resistant mycobacterium tuberculosis, and belongs to the technical field of drug-resistant strain detection. According to the invention, four candidate sites closely linked with deramanib are provided; through a prokaryotic expression vector, Cas13a protease with activity is obtained through successful expression and purification, and the purity is 95%; a Cas13a-sgRNA skeleton vector is provided, and a sequence containing any to-be-recognized site can be added; the sgRNA is obtained through reverse transcription of crDNA in a Cas13a-sgRNA skeleton vector, a CRISPR / Cas13a technology constructed by the method can be combined with fluorescence detection and paper chromatography detection technologies, visual detection of mutation sites of the deramanian drug-resistant gene is achieved, the method is simple and easy to operate, large, expensive and precise instruments and equipment are not needed, the time needed by detection is short, heat preservation at 37 DEG C is only needed for 60 min, and the detection efficiency is high. The kit is low in cost, high in sensitivity and strong in specificity, and the sensitivity can reach 100 aM.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of drug-resistant strain detection, and in particular to a site for detecting Mycobacterium tuberculosis resistant to delamanid and a kit. BACKGROUND

[0002] Tuberculosis (TB) is a major chronic infectious disease that has attracted worldwide attention, and its pathogen is mainly Mycobacterium tuberculosis (MTB). At present, the standard treatment regimen for drug-sensitive TB is a 6-month anti-TB drug treatment, and the drugs include rifampicin, isoniazid, ethambutol and pyrazinamide, which can not only rapidly control the proliferative, dormant or persistent state of MTB, but also can prevent MTB from acquiring drug resistance to a certain extent during the treatment. However, the increasing multi-drug and extensively drug-resistant (MDR / XDR) MTB strains have greatly reduced the efficacy of anti-TB drugs, and researchers have developed new oral drugs including nitroimidazole-delamanid (DLM) and diarylquinoline-bedaquiline (BDQ) to treat multi-drug resistant TB patients.

[0003] For drug-resistant TB patients, the long-term safety of the bedaquiline-delamanid combination regimen is good, and for patients with poor prognosis or multi-drug resistance, delamanid can be used as an effective second-line drug to combat drug-resistant TB, and like bedaquiline, it can be used in combination with other anti-TB drugs to treat drug-resistant TB patients, providing a first-line hope. However, the drug has produced drug-resistant strains in the clinical application of only one year. Therefore, early detection of delamanid-resistant Mycobacterium tuberculosis strains is crucial for guiding clinical treatment and the efficacy of TB treatment.

[0004] Phenotypic drug susceptibility testing is the preferred method for diagnosing drug-resistant TB, but phenotypic drug susceptibility testing needs to be performed within 12 weeks. The method based on bacterial culture, although highly accurate, has the problems of time-consuming, low throughput and poor sensitivity. Molecular diagnostic methods include MTB DRplus, loop-mediated isothermal amplification (LAMP), linear probe assay (LPA), GeneXpert and whole genome sequencing (WGS), which have the advantages of high specificity and sensitivity, but these methods require professional instruments and operators, are time-consuming, expensive and can only diagnose single drug-resistant mutation sites, which limit the application range of these methods.

[0005] Therefore, it is urgent to develop a detection method that can conveniently and quickly detect as many drug-resistant gene mutations as possible. SUMMARY

[0006] The application aims to provide a site for detecting drug-resistant Mycobacterium tuberculosis and a kit, to lay a foundation for further developing a rapid, convenient, highly specific and high-sensitivity MTB drug resistance mutation detection kit, and to provide guidance for clinical medication treatment of MDR / XDR-TB.

[0007] To achieve the above-mentioned purpose, the application provides a Cas13a-sgRNA skeleton vector, a CRISPR DNA primer is synthesized by using a universal sequence, and the synthesized CRISPR DNA primer is connected to a Topo vector.

[0008] Preferably, the universal sequence is shown as SEQ ID NO. 16; the sequence containing the specific mutation site is located at the 3rd or 4th position of the 5 ′ end of the CRISPR DNA primer, and a mismatch site is added at the 5th or 6th position.

[0009] Preferably, the sequence of the CRISPR DNA primer is shown as SEQ ID NO. 1-8.

[0010] An sgRNA is obtained by reverse transcription of the above-mentioned Cas13a-sgRNA skeleton vector.

[0011] A kit for detecting a mutation site, the kit comprising the above-mentioned Cas13a-sgRNA skeleton vector or sgRNA.

[0012] Application of the kit for detecting a mutation site as described above in the detection of a mutation site, the application process being combined with or not combined with fluorescence detection or paper chromatography detection.

[0013] 4 sites for detecting drug-resistant Mycobacterium tuberculosis, the 4 sites being a ddn Trp88STOP site of a ddn gene, a Lys250STOP site of a fbiA gene, a fbiC Val318Ile site and a fbiC Cys98Tyr site of a fbiC gene.

[0014] Preferably, the primer sequences for amplifying the ddn Trp88STOP site of the ddn gene are shown as SEQ ID NO. 1 and SEQ ID NO. 2 respectively; the primer sequences for amplifying the Lys250STOP site of the fbiA gene are shown as SEQ ID NO. 3 and SEQ ID NO. 4 respectively; the primer sequences for amplifying the fbiC Val318Ile site of the fbiC gene are shown as SEQ ID NO. 5 and SEQ ID NO. 6 respectively; and the primer sequences for amplifying the fbiC Cys98Tyr site are shown as SEQ ID NO. 7 and SEQ ID NO. 8 respectively.

[0015] A kit for detecting the four sites of the above-mentioned Mycobacterium tuberculosis resistant to delamanid, wherein the sgRNA sequences are shown as SEQ ID NO. 18-25, respectively.

[0016] Preferably, the kit comprises a fluorescent detection reagent or a paper chromatography detection reagent.

[0017] The crRNA sequence provided by the present application is placed at the 3 ′ end of the backbone sequence, and the drug resistance mutation point is placed at the 3rd or 4th position of the 5 ′ end of the crRNA, and a mismatch site is added at the 5th or 6th position to improve the targeting specificity of CRISPR / Cas13a. The Cas13a-crRNA system can recognize the target gene and activate both “cis-cleavage” and “trans-cleavage” activities. The “cis-cleavage” activity can specifically cleave the gene sequence of the DLM drug resistance mutation site, while the “trans-cleavage” activity can achieve high sensitivity and high specificity detection of the DLM drug resistance mutation site by non-specific cleavage of the ssRNAFAM-BHQ1 fluorescent reporter.

[0018] The CRISPR / Cas13a-based detection method provided by the present application can be controlled at 37℃, so that the detection system is more simple and rapid. In addition, the detection results can be conveniently read by a smart phone technology or a small detection device. It is proved that the CRISPR / Cas13a-based detection system has high specificity, can accurately identify the drug resistance mutation point in the DLM drug resistance mutation gene, and the difference is significant (P<0.001). In clinical application, the detection system provided has high sensitivity and specificity for mutations of fbiCVal318Ile, fbiCCys98Tyr, ddn Trp88STOP and fbiA Lys250STOP, and no off-target effect is observed in the presence of other sequences (such as M. smegmatis, C. glutamicum or E. coli). The cost of the detection reaction is estimated to be about $0.7, which can be further reduced when mass-produced.

[0019] Therefore, the detection site and kit for detecting Mycobacterium tuberculosis resistant to delamanid provided by the present application have the following specific technical effects:

[0020] (1) The present application determines that the four selected sites are closely linked to delamanid resistance by mutating four candidate delamanid-resistant sites, then introducing them into Mycobacterium aurum, and determining the MIC value of the bacteria containing the mutation sites to delamanid;

[0021] (2) The application successfully expresses and purifies the active Cas13a protease by using the pET28a-LbCas13a prokaryotic expression vector, and the purity of the obtained LbCas13a protein is 95%;

[0022] (3) The application provides a Cas13a-sgRNA skeleton vector, and a sequence containing any to-be-recognized site can be added; sgRNA is obtained by reverse transcription of crDNA in the Cas13a-sgRNA skeleton vector, and the CRISPR / Cas13a technology constructed in this way can quickly and conveniently detect the mutation site of the delamanid-resistant gene, and has high sensitivity and strong specificity;

[0023] (4) The application can realize visual detection of the mutation site of the delamanid-resistant gene by combining the CRISPR / Cas13a technology with fluorescence detection and paper chromatography detection technology, and the method is simple and easy to operate, does not need large, expensive and precise instruments and equipment, and has short detection time, only needs 37 DEG C incubation for 60 min, low cost, high sensitivity and strong specificity, and the sensitivity can reach 100 aM.

[0024] The technical solutions of the application will be further described in detail below with the help of the accompanying drawings and examples. BRIEF DESCRIPTION OF DRAWINGS

[0025] In order to more clearly illustrate the technical solutions of the embodiments of the application, the drawings needed to be used in the description of the embodiments of the application will be briefly introduced as follows, and obviously, the drawings in the following description can also be used to obtain other drawings without creative labor for those skilled in the art.

[0026] Figure 1 is the single colony sequencing alignment result of the overnight culture in the embodiment 1 of the application; wherein A is the ddn gene mutation site; B is the fbiAC gene mutation site; C is the fbiC gene mutation site;

[0027] Figure 2 is the growth curve of the bacteria in the embodiment 2 of the application; wherein A is the acid-fast staining result of Mau; B is the gram staining result of Mau; C is the MIC determination result of wild-type Mau under the action of INH, RIF and DLM; D is the MIC determination result of the four Mau carrying drug-resistant plasmids;

[0028] Figure 3 is the pET28a-LbCas13a prokaryotic expression vector structure diagram and the gel map after agarose gel electrophoresis in the embodiment 3 of the application; wherein A is the pET28a-LbCas13a prokaryotic expression vector structure diagram; B is the gel map after agarose gel electrophoresis;

[0029] Figure 4 is the SDS-PAGE result of the supernatant after removing impurities by using a 0.45 μm filter in Example 4 of the present application, and the SDS-PAGE result of the purified Cas13a protein by using a Ni 2+ affinity column; wherein A is the SDS-PAGE result of the supernatant after removing impurities by using a 0.45 μm filter, M represents a protein marker, lane 1 is the uninduced bacterial liquid, lanes 2-5 are the bacterial liquids after induction by 0.2 mM, 0.5 mM, 0.8 mM, and 1 mM IPTG respectively, lanes 6-7 are the supernatant and the precipitate after ultrasonic crushing of the bacterial liquid after induction by 0.2 mM IPTG, lanes 8-9 are the supernatant and the precipitate after ultrasonic crushing of the bacterial liquid after induction by 0.5 mM IPTG, lanes 10-11 are the supernatant and the precipitate after ultrasonic crushing of the bacterial liquid after induction by 0.8 mM IPTG, and lanes 12-13 are the supernatant and the precipitate after ultrasonic crushing of the bacterial liquid after induction by 1 mM IPTG; B is the SDS-PAGE result of the purified Cas13a protein by using a Ni 2+ affinity column; wherein lane 1 is the bacterial liquid before induction, lane 2 is the bacterial liquid after induction, lane 3 is the precipitate after centrifugation after crushing the bacteria, lane 4 is the supernatant after centrifugation after crushing the bacteria, lane 5 is the flow-through liquid, lane 6 is the protein eluted by the washing liquid, lane 7 is the protein eluted by the washing buffer 1, lane 8 is the protein eluted by the washing buffer 2, lane 9 is the protein eluted by the washing buffer 3, lane 10 is the protein eluted by the washing buffer 4, and lane 11 is the protein after ultrafiltration of the eluate;

[0030] Figure 5 is the activity detection result of the purified Cas13a protein in Example 5 of the present application; wherein N is a negative control; 1 is the purified Cas13a protein; and 2 is a commercial Cas13a protein;

[0031] Figure 6 is the structure diagram of the Cas13a-sgRNA backbone vector in Example 6 of the present application;

[0032] Figure 7 is the detection principle schematic diagram of the CRISPR / Cas13a system in Example 8 of the present application;

[0033] Figure 8 is the detection result in Example 8 of the present application; A is the fluorescence signal detection result of the fbiCCys98Tyr site changing with time; B is the fluorescence signal detection result of the fbiCVal318Ile site changing with time; C is the fluorescence signal detection result of the fbiALys250STOP site changing with time; and D is the fluorescence signal detection result of the ddnTrp88STOP site changing with time;

[0034] Figure 9is the paper chromatography detection result of the fbiCCys98Tyr resistance site in Example 9 of the present application; wherein A is a detection principle schematic diagram, + is a positive detection result, and - is a negative detection result; B is the paper chromatography detection result of the fbiCCys98Tyr site, N is a negative control, 1 is the paper chromatography detection result of fbiC wild, 2 is the paper chromatography detection result of fbiCCys98Tyr resistance site 20 min, 3 is the paper chromatography detection result of fbiCCys98Tyr resistance site 40 min, 4 is the paper chromatography detection result of fbiCCys98Tyr resistance site 60 min, and 5 is the paper chromatography detection result of fbiCCys98Tyr resistance site 90 min;

[0035] Figure 10 is the paper chromatography detection result of the biCVal318Ile site, fbiALys250STOP site resistance site and ddnTrp88STOP site in Example 9 of the present application; wherein A is the fluorescence signal detection result of the fbiCVal318Ile site changing with time; B is the fluorescence signal detection result of the fbiALys250STOP site changing with time; and C is the fluorescence signal detection result of the ddnTrp88STOP site changing with time;

[0036] Figure 11 is the specific detection result in Example 10 of the present application; wherein 1 in part A is the M.smegmatis+fbiC98 mixed system, 2 is the C.glutamicum+fbiC98 mixed system, and 3 is the E.coli+fbiC98 mixed system; 1 in part B is the M.smegmatis+fbiC318 mixed system, 2 is the C.glutamicum+fbiC318 mixed system, and 3 is the E.coli+fbiC318 mixed system; 1 in part C is the M.smegmatis+fbiA250 mixed system, 2 is the C.glutamicum+fbiA250 mixed system, and 3 is the E.coli+fbiA250 mixed system; 1 in part D is the M.smegmatis+ddn88 mixed system, 2 is the C.glutamicum+ddn88 mixed system, and 3 is the E.coli+ddn88 mixed system;

[0037] Figure 12The sensitivity detection results in Example 10 of the present application; A is the sensitivity of CRISPR / Cas13a in the mixed system for detecting fbiC Cys98Tyr; B is the sensitivity of CRISPR / Cas13a in the mixed system for detecting fbiC Val318Ile; C is the sensitivity of CRISPR / Cas13a in the mixed system for detecting fbiA Lys250STOP; D is the sensitivity of CRISPR / Cas13a in the mixed system for detecting ddn Trp88STOP; * represents P<0.05, ** represents P<0.01, *** represents P<0.001, **** represents P<0.0001, and ns represents no statistical significance. DETAILED DESCRIPTION

[0038] The technical solutions of the present application are further described below through the drawings and examples.

[0039] In order to make the purpose, technical solutions and advantages of the present application more clear, thorough and complete, the technical solutions of the present application are described clearly and completely below through the drawings and examples. The following detailed description is a description of the examples, which aims to provide further detailed description of the present application. Unless otherwise specified, all technical terms used in the present application have the same meaning as generally understood by those skilled in the art to which the present application belongs.

[0040] The instruments and reagents used in the examples are obtained through commercial channels; the method steps not described in detail in the examples are conventional technical means in the art.

[0041] Example 1

[0042] The ddn Trp88STOP site of the ddn gene, the Lys250STOP site of the fbiA gene, the fbiC Val318Ile and fbiC Cys98Tyr sites of the fbiC gene were mutated, as follows:

[0043] (1) Obtain the nucleotide sequence information of 15 bp before and after the ddn Trp88STOP site of the ddn gene, the Lys250STOP site of the fbiA gene, the fbiC Val318Ile and fbiC Cys98Tyr sites of the fbiC gene from the NCBI GenBank database (http: / / www.ncbi.nlm.nih.gov / pubmed / ), and send the sequence information to a company for sequence synthesis, i.e. obtain the wild type sequence of the ddn Trp88STOP site of the ddn gene, the Lys250STOP site of the fbiA gene, the fbiC Val318Ile and fbiC Cys98Tyr sites of the fbiC gene.

[0044] The Hind III enzyme cutting sites were inserted at both ends of the ddn, fbiA and fbiC genes, and then the pUC57 or Topo vector was inserted respectively to obtain recombinant plasmids ddn_wild_pUC57, fbiA_wild_Topo and fbiC_wild_Topo.

[0045] (2) According to the nucleotide sequence information of 15 bp before and after the ddn Trp88STOP site of the ddn gene, the Lys250STOP site of the fbiA gene, and the fbiC Val318Ile and fbiC Cys98Tyr sites of the fbiC gene, primers were designed: one adjacent to the 5' end and the other in the opposite direction of the 3' end. The primer sequences of the ddn Trp88STOP site of the ddn gene are shown in SEQ ID NO. 1 (where the underlined sequence is the T7 promoter sequence) and SEQ ID NO. 2; the primer sequences of the Lys250STOP site of the fbiA gene are shown in SEQ ID NO. 3 and SEQ ID NO. 4; the primer sequences of the fbiC Val318Ile site of the fbiC gene are shown in SEQ ID NO. 5 and SEQ ID NO. 6; and the primer sequences of the fbiC Cys98Tyr site are shown in SEQ ID NO. 7 and SEQ ID NO. 8. The primer sequence information was sent to a company for synthesis of primers.

[0046] (3) The recombinant plasmid obtained in step (1) was used as a template, and the primers (sequences shown in SEQ ID NO. 1-SEQ ID NO. 8) obtained in step (2) were used to configure the system according to the instructions of the full-site gold point mutation kit to perform PCR. The PCR amplification program was 94℃, 5min; 94℃, 30s, 55℃, 30s, 72℃, 50s, 25 cycles; 72℃, 10min. 5μL of the amplified product was subjected to agarose gel electrophoresis, and 1μL of DMT enzyme was added to the electrophoresis band that matched the expected amplified product, mixed thoroughly, and incubated at 37℃ for 1 hour.

[0047] SEQ ID NO. 1: AGAAGAACCCGATGTAGTACCTCAAC

[0048] SEQ ID NO. 2: TACATCGGGTTCTTCTCCGCGCCGCC

[0049] SEQ ID NO. 3: CCGATCATCGGCGAATAGCCGTTGCG

[0050] SEQ ID NO. 4: ATTCGCCGATGATCGGCGAGTAGCCG

[0051] SEQ ID NO.5:GATTACCTGGCGACGATTGCGGTGGC

[0052] SEQ ID NO.6:TCGTCGCCAGGTAATCCTCGATTCCG

[0053] SEQ ID NO.7:CGGTCACCCGGTTATACCGGGACAAT

[0054] SEQ ID NO.8:TATAACCGGGTGACCGGGATAAACAC

[0055] (4) Transform the product after incubation into E. coli DH5α competent cells, then add 250 μL LLB liquid medium to the cells, and culture at 37℃ and 200 r. pm / min for 1 h with shaking. Then spread it evenly on solid LB medium plates containing 100 μg / mL Amp antibiotic, and incubate upside down in a 37℃ incubator for 12-16 h until single colonies grow.

[0056] Single colonies were picked and added to 10 mL of LB liquid medium containing 100 μg / mL Amp. The culture was carried out overnight at 37°C and 200 rpm. After the culture was completed, the culture was aliquoted into 3 portions in a clean bench. One portion was sent to the company for sequencing, and the other two portions were mixed with an equal volume of glycerol and stored at -20°C.

[0057] Sequencing results as follows Figure 1 As shown, the mutations at the ddn Trp88STOP, fbiA Lys250STOP, fbiCVal318Ile, and fbiCCys98Tyr sites were successfully performed.

[0058] Example 2

[0059] The following investigation was conducted to determine whether the ddn Trp88STOP, fbiA Lys250STOP, fbiCVal318Ile, and fbiC Cys98Tyr sites were linked to DLM resistance:

[0060] (1) The recombinant plasmid with correct sequencing and successful drug resistance mutation in Example 1 and the pMV261 plasmid vector were simultaneously digested with HindIII. After agarose gel electrophoresis of the digestion products, the correctly sized bands were recovered using the kit gel. Then, the gel recovered products of the four target fragments with four different drug resistance mutation sites of the three gene fragments ddn, fbiA and fbiC were ligated with the gel recovered product of pMV261 plasmid at 16°C overnight using T4 ligase according to the attached instructions.

[0061] The ligation product was transformed into E. coli DH5α competent cells, which were incubated at 37°C in an incubator for bacteria overnight.

[0062] (2) The MIC of Delamanid on M. aurum was determined by resazurin method, as follows:

[0063] M. aurum (Mau) strain was plated on 7H10 solid medium containing 10% OADC by streak plate method, and then incubated at 37°C in an incubator for bacteria for 5-7 days until single colonies were grown. Then, a single colony was inoculated into 10 mL of 7H9 liquid medium, and incubated at 37°C, 200 r.p.m. in a shaker until the OD 600 value was 0.6-0.8. Mau was transferred into 7H9 medium at a ratio of 1:1000. Two 96-well plates were taken, and 100 μL of the mixture of Mau and 7H9 medium was added to each well in the outermost row. In B2 and F2 wells, 2.56 μL of Delamanid drug (concentration of 10 mg / mL) and 184.88 μL of Mau bacterial solution diluted by 0.1% 7H9 medium were added, and 90 μL of Mau bacterial solution diluted by 0.1% 7H9 medium was added to the other wells. 100 μL of the mixture in B2 was transferred into B3 well containing 100 μL of 7H9 medium and mixed, and 100 μL of the mixture in B3 was transferred into B4 well and mixed, and so on until B11 well, and the same method was used for F row. After the sample addition was completed, the 96-well plate was incubated at 37°C in an incubator for bacteria for 5 days, and then taken out, 10 μL of 10% resazurin solution was added to each well and mixed, and then placed back into the 37°C incubator for constant temperature treatment for 8 h.

[0064] After the time, observation, photography and detection of the OD 600 value of each well of the 96-well plate by using an enzyme-labeled instrument were performed, and the growth curve of the bacteria was drawn. The results are shown in Figure 2 Table 1. MIC of Delamanid on M. aurum. The MIC of wild type Mau to Delamanid was 0.78 μg / mL, and the MIC of Mau carrying fbiCCys98Tyr or fbiCVal318Ile plasmid was 12.5 μg / mL, and the MIC of Mau carrying fbiALys250STOP or ddn Trp88STOP plasmid was greater than 25 μg / mL. It was shown that ddn Trp88STOP, fbiALys250STOP, fbiCVal318Ile and fbiCCys98Tyr sites were linked to DLM resistance.

[0065] Example 3

[0066] The Cas13a prokaryotic expression vector was constructed, and the specific steps were as follows:

[0067] (1) The LbCas13a gene (the protein sequence after translation is shown as SEQ ID NO. 9) sequence was codon-optimized to be suitable for expression in the host bacteria E. coli BL21(DE3). The CDS sequence of the codon-optimized LbCas13a gene is shown as SEQ ID NO. 10. The primers LbCas13a PCR-F (the sequence is shown as SEQ ID NO. 11) and LbCas13a PCR-R (the sequence is shown as SEQ ID NO. 12) for amplifying the LbCas13a gene were designed and synthesized, and the optimized LbCas13a gene sequence was amplified.

[0068] SEQ ID NO. 9:

[0069]

[0070] SEQ ID NO. 10:

[0071] ATGCAGATTGGCAAGGTTCAAGGGCGGACGATCAGCGAATTCGGCGATCC

[0072] GGCGGGGGGGCTCAAACGCAAGATCAGCACCGATGGCAAGAACCGCAAG

[0073] GAGCTGCCCGCTCATCTGTCAAGCGATCCTAAGGCGCTGATCGGGCAGTGG

[0074] ATTTCCGGGATCGACAAGATCTATCGCAAGCCCGACAGCCGGAAGTCGGAT

[0075] GGTAAAGCGATCCATAGCCCGACCCCATCCAAGATGCAGTTCGACGCGCGT

[0076] GACGACCTTGGCGAGGCGTTCTGGAAGCTGGTGTCAGAGGCGGGGCTGGC

[0077] GCAAGACAGCGACTACGATCAGTTCAAACGCCGACTGCACCCCTATGGTG

[0078] ACAAGTTCCAACCTGCCGACTCCGGCGCGAAGTTGAAATTCGAAGCGGAT

[0079] CCGCCCGAGCCACAGGCGTTCCACGGGCGCTGGTATGGCGCGATGTCGAA

[0080] ACGCGGGAATGATGCCAAAGAGCTTGCTGCGGCGCTTTACGAGCATCTGCA

[0081] TGTCGATGAAAAGCGCATTGACGGGCAACCAAAGCGGAACCCCAAGACCG

[0082] ACAAATTTGCGCCCGGCCTGGTGGTGGCGCGGGCATTGGGGATAGAGAGT

[0083] TCGGTTCTGCCGCGCGGCATGGCGCGGCTGGCGCGGAATTGGGGCGAGGA

[0084] GGAAATTCAAACCTATTTCGTGGTCGATGTAGCGGCTTCGGTGAAGGAGGT

[0085] GGCGAAAGCCGCAGTGAGTGCTGCGCAAGCGTTCGACCCGCCGCGACAG

[0086] GTGAGCGGACGATCCCTGTCGCCAAAGGTCGGCTTTGCCCTTGCCGAGCAT

[0087] CTGGAGCGCGTGACCGGATCGAAGCGCTGCTCTTTCGACCCCGCTGCGGG

[0088] GCCCAGCGTGCTGGCGCTGCATGACGAGGTGAAGAAAACCTACAAGCGCC

[0089] TTTGTGCGCGCGGCAAGAATGCCGCGAGAGCGTTTCCCGCCGACAAGACG

[0090] GAGCTGCTCGCCCTGATGCGGCATACGCATGAAAACCGGGTGCGCAACCA

[0091] GATGGTCCGGATGGGGCGTGTGTCCGAATATCGGGGACAGCAAGCGGGCG

[0092] ATCTTGCGCAGAGCCATTACTGGACCTCGGCCGGACAGACCGAAATCAAG

[0093] GAATCCGAGATCTTTGTTCGGCTGTGGGTGGGGGCCTTTGCGCTGGCCGGG

[0094] CGGTCGATGAAGGCCTGGATCGACCCGATGGGCAAGATCGTCAATACCGAG

[0095] AAAAATGACCGTGATCTGACCGCCGCGGTCAATATTCGGCAGGTGATCTCG

[0096] AACAAGGAGATGGTCGCCGAGGCGATGGCGCGGCGTGGCATCTATTTCGG

[0097] GGAAACGCCCGAACTGGACCGACTGGGTGCCGAAGGGAACGAGGGCTTT

[0098] GTCTTCGCGCTGTTGCGCTATCTGCGCGGTTGCCGGAACCAGACCTTTCAC

[0099] CTTGGTGCCCGGGCTGGTTTTCTCAAGGAAATCCGAAAAGAACTGGAAAA

[0100] GACCCGGTGGGGAAAGGCGAAGGAGGCAGAGCATGTCGTCCTGACGGAC

[0101] AAGACAGTCGCCGCGATCCGCGCCATCATCGACAATGATGCAAAGGCGTTG

[0102] GGGGCGCGCCTGCTTGCCGATCTGTCCGGTGCTTTCGTGGCGCATTATGCAT

[0103] CGAAAGAGCATTTCTCGACACTTTATTCCGAGATCGTCAAAGCGGTGAAGG

[0104] ATGCGCCCGAAGTCTCCTCCGGGCTGCCGCGGCTCAAGCTATTGCTGAAGC

[0105] GGGCAGATGGTGTGCGCGGTTATGTGCATGGCCTGAGAGACACACGCAAA

[0106] CATGCATTTGCCACCAAGCTGCCCCCGCCCCCCGCCCCTCGAGAACTTGAC

[0107] GATCCCGCGACGAAGGCGCGTTACATCGCCCTGTTGCGGCTTTACGACGGG

[0108] CCATTCCGCGCCTACGCTTCTGGCATTACCGGAACGGCGCTTGCCGGACCT

[0109] GCGCGCGCGCCAAGGAAGCGGCAACCGCGCTGGCGCAAAGCGTGAACG

[0110] TCACGAAGGCGTATTCCGACGTAATGGAAGGGCGCACGAGCCGGTTGCGC

[0111] CCCCCGAACGATGGCGAAACGCTGCGCGAATATCTCAGCGCCTTGACCGGC

[0112] GAAACCGCGACCGAGTTCCGGGTGCAGATCGGGTACGAGTCCGACTCGGA

[0113] AAACGCCCGCAAACAGGCGGAATTCATCGAGAACTATCGCCGCGACATGC

[0114] TTGCCTTCATGTTCGAGGATTACATCAGGGCCAAGGGCTTTGACTGGATATT

[0115] GAAGATCGAGCCGGGCGCGACGGCGATGACCCGCGCGCCCGTCCTGCCCG

[0116] AGCCGATCGATACGCGGGGCCAATACGAGCATTGGCAAGCGGCGCTCTATC

[0117] TGGTGATGCATTTCGTTCCGGCCAGCGATGTCTCGAACCTGCTGCACCAGT

[0118] TGCGCAAATGGGAGGCGCTTCAGGGCAAATATGAACTGGTCCAGGACGGT

[0119] GACGCCACGGATCAGGCGGACGCGAGGCGCGAGGCGCTTGATCTCGTCAA

[0120] GCGCTTCCGCGATGTGCTGGTGTTGTTCCTCAAGACCGGCGAGGCCCGGTT

[0121] CGAGGGCCGCGCAGCGCCTTTCGATCTGAAGCCGTTTCGGGCGCTCTTTGC

[0122] CAACCCGGCCACCTTTGACCGGCTCTTCATGGCCACACCCACAACCGCGC

[0123] GCCCTGCCGAAGATGACCCCGAGGGGGACGGTGCGTCCGAGCCGGAACTG

[0124] CGTGTCGCGCGCACCTTGCGCGGTTTGCGCCAGATCGCGCGCTACAACCAT

[0125] ATGGCGGTTCTGAGCGATCTTTTCGCAAAGCACAAAGTGCGGGACGAAGA

[0126] GGTGGCCCGCTTGGCCGAGATCGAAGACGAGACGCAGGAAAAGTCACAG

[0127] ATCGTGGCAGCCCAGGAACTGCGCACCGACCTGCACGACAAGGTGATGAA

[0128] GTGTCACCCAAAAACGATTTCCCCCGAGGAGCGGCAAAGTTACGCTGCGG

[0129] CGATCAAGACCATCGAGGAACACCGGTTTCTGGTCGGACGGGTCTATCTGG

[0130] GTGATCATCTGCGCCTGCACCGGTTGATGATGGACGTGATCGGACGCCTGA

[0131] TCGACTATGCCGGGGCTTATGAACGTGACACCGGAACTTTCCTCATAAACG

[0132] CGAGCAAGCAGTTGGGAGCAGGCGCCGATTGGGCTGTCACCATCGCAGGG

[0133] GCAGCCAATACCGACGCGCGCACCCAAACCCGCAAAGACCTTGCGCATTT

[0134] CAATGTGCTTGACCGCGCGGATGGCACGCCAGACCTGACCGCTCTGGTCA

[0135] ACCGGGCGCGCGAGATGATGGCCTATGACCGCAAGCGCAAGAATGCGGTG

[0136] CCGCGCTCGATCCTCGATATGCTGGCACGACTTGGGCTGACGCTGAAATGG

[0137] CAGATGAAAGATCACCTTCTGCAAGACGCGACGATCACTCAGGCCGCCATC

[0138] AAGCACCTCGACAAGGTCAGGCTGACAGTTGGCGGGCCGGCGGCGGTGA

[0139] CAGAGGCCCGTTTCAGCCAAGACTACCTCCAGATGGTGGCGGCCGTCTTCA

[0140] ATGGCAGCGTCCAGAATCCAAAGCCACGCCGCCGGGATGACGGGGACGCA

[0141] TGGCACAAGCCCCCCAAACCCGCGACCGCGCAAAGCCAGCCAGATCAAA

[0142] AACCGCCCAACAAGGCACCCTCTGCGGGCTCCCGTCTTCCGCCCCCGCAG

[0143] GTGGGGGAAGTCTACGAGGGCGTGGTGGTTAAGGTGATCGACACCGGATC

[0144] TTTGGGGTTTCTTGCTGTCGAGGGCGTTGCGGGGAACATTGGCCTGCACAT

[0145] TTCCAGGCTGAGAAGGATCCGCGAAGATGCCATCATCGTCGGGCGGCGCTA

[0146] TCGGTTCCGGGTGGAAATCTATGTCCCGCCGAAAAGTAACACGTCGAAGCT

[0147] GAATGCCGCCGATCTGGTGCGGATCGACTGA

[0148] SEQ ID NO. 11: CTCGAGTTCCAGGGCCTTGTACTCGAACATG

[0149] SEQ ID NO. 12: CATATGATGAAAGTGACCAAGGTCGACG

[0150] (2) The amplification product and pET28a vector plasmid were respectively treated with Xho I and Nde I double enzyme digestion, and then the enzyme digestion products were subjected to agarose gel electrophoresis. The target DNA fragment was recovered by using a kit according to the attached instructions. The gel recovery product of the target fragment was connected using T4 DNA ligase at 16°C overnight.

[0151] (3) The ligation product was transformed into E. coli DH5a competent cells, and then coated on LB solid medium containing 50 μg / mL kanamycin, and incubated in a 37°C constant temperature bacterial incubator overnight.

[0152] (4) The next day, three single clone colonies were randomly picked for colony PCR with primers Cas13a-PCR-F / Cas13a-PCR-R (sequences are shown in SEQ ID NO. 13 and SEQ ID NO. 14, respectively). The PCR product was subjected to agarose gel electrophoresis, and the results are shown in FIG. 13B. A single band was obtained, and the fragment size was consistent with the expected size. After shaking the single clone verified by PCR, half was stored in the refrigerator at -20°C, and the other half was sent to the company for sequencing. The sequence was consistent with the expected vector, indicating that the pET28a-LbCas13a prokaryotic expression vector was successfully constructed (as shown in FIG. 13A). Figure 3 Figure 3

[0153] SEQ ID NO. 13: CTCGAGTTCCAGGGCCTTGTACTCGAACATG

[0154] SEQ ID NO. 14: CATATGATGAAAGTGACCAAGGTCGACG

[0155] Example 4

[0156] Expression and purification of Cas13a protein, as follows:

[0157] (1) Induce Cas13a protein expression.

[0158] ​​① After the bacteria containing the correct pET28a-LbCas13a prokaryotic expression vector in Example 3 were propagated, the plasmid was extracted, and then the heat shock method was used to transform E. coli BL21(DE 3) competent cells, which were then coated on LB agar plates containing 50 μg / mL kanamycin and incubated overnight in a 37°C incubator.

[0159] ② 5 mL of the overnight incubated bacteria were added to 1 L of LB liquid medium containing 50 μg / mL kanamycin, and the optical density (OD 600nm ) was measured. Then, the culture was incubated at 37°C and 300 r.p.m. until the OD 600 was 0.4-0.6, and then the culture was transferred to 4°C for 30 min, and 0.5 M IPTG was added to a final concentration of 0, 0.2, 0.5, 0.8, and 1 mM, respectively, to induce expression, and the culture was incubated in a pre-cooled 21°C biological shaker at 200 r.p.m. for 16 h. After ultrasonic disruption, the culture was centrifuged at 4°C and 10,000 g for 40 min, and the supernatant was collected and passed through a 0.45 μm filter to remove impurities in the supernatant. The supernatant was then subjected to SDS-PAGE with 1x SDS as the running buffer, and Coomassie brilliant blue staining was performed, and the gel was observed on a BioRad Digital Gel Imaging System. The culture without the addition of IPTG was used as a control.

[0160] The results are shown in Fig. A, which shows that the optimal induction concentration of LbCas13a is 0.2 mM. Figure 4

[0161] (2) Purification of Cas13a protein.

[0162] The culture was induced by adding 0.2 mM IPTG at 21°C and 200 r.p.m. for 16 h, and the other methods and steps were exactly the same as in step (1). The supernatant after passing through a 0.45 μm filter was purified using a Ni 2+ affinity column, and 20 μL of the purified sample was subjected to SDS-PAGE gel electrophoresis and staining.

[0163] The results are shown in Fig. B, which shows that the obtained Cas13a protein has high purity, and the purity is greater than 95% by gray scale analysis of the electrophoretogram. Figure 4

[0164] Example 5

[0165] The purified Cas13a protein in Example 4 was subjected to activity detection, as follows:

[0166] ​​Three detection systems were prepared by using the kit respectively: 1) adding purified LbCas13a protein, fluorescent reporter and enzyme-free water; 2) replacing the purified LbCas13a protein in 1) with the same volume of LbCas13a protein buffer; 3) replacing the purified LbCas13a protein in 1) with an equal amount of commercially available LbCas13a protein.

[0167] The Cas13a protein activity was detected under LED blue light, ultraviolet light and natural light respectively, and the results are shown in Figure 5 The purified LbCas13a protein compared with the commercial LbCas13a protein showed that the purified Cas13a protein prepared in Example 1 had good natural enzyme activity.

[0168] Example 6

[0169] The construction and verification of the Cas13a-sgRNA backbone vector are as follows:

[0170] (1) A universal sequence with NcoI and KpnI enzyme digestion sites at both ends (the sequence is shown as SEQ ID NO. 15) was designed and synthesized by a company, wherein the underlined sequence is a T7 promoter and the non-underlined sequence is a direct repeat sequence. A CRISPR DNA (crDNA) primer was synthesized using the universal sequence, wherein the 28nt of the original spacer sequence is located at the 3' end and the universal sequence is located at the 5' end. The obtained crDNA primer was connected into a Topo vector using T4 DNA ligase, and sequencing verification successfully obtained a Cas13a-sgRNA backbone vector consistent with the target sequence (the structure is shown as Figure 6 The Cas13a-sgRNA backbone vector was stored at -20°C for standby use.

[0171] SEQ ID NO. 15:

[0172] TAATACGACTCACTATAGG GATTTAGACTACCCAAAAAACGAAGGGACTAAAAC

[0173] SEQ ID NO. 16: GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC

[0174] Example 7

[0175] The sgRNA was synthesized as follows:

[0176] (1) The sgRNA was designed according to the following principles:

[0177] ① The sgRNA sequence should be reverse complementary to the transcribed RNA of the target sequence, and the sgRNA cannot overlap with the PCR primer; ② The spacer sequence is 28 bases (the sequence is the complementary sequence of the 5' end of the corresponding site); ③ Preventing the formation of secondary structure of self-activating RNA, connecting the spacer sequence with the backbone sequence (such as SEQ ID NO. 17) to form sgRNA; ④ The 3rd or 4th site of the 5' end of the sgRNA is complementary to the drug resistance detection mutation site; ⑤ The 5th or 6th site of the 5' end of the sgRNA is set as an artificial mismatch site to increase the detection specificity. After the sgRNA sequence is determined, it is sent to the company for synthesis.

[0178] SEQ ID NO. 17: GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC The secondary structure of RNA refers to the local folding form of the internal part of the RNA molecule, which is determined by the hydrogen bond interaction between the bases. The interaction force between such secondary structures plays a key role in regulating the function and activity of RNA. The foldable secondary structure can change the three-dimensional conformation of RNA, thereby affecting the interaction and binding capacity of RNA with other biological macromolecules. Therefore, the formation and stability of RNA secondary structure are closely related to the function and activity of RNA.

[0179] The Cas13a prepared in Example 4 has specific binding to the four drug resistance sites fbiCCys98Tyr, fbiCVal318Ile, fbiALys250STOP and ddnTrp88STOP, indicating high sensitivity to the four drug resistance sites and the mismatch site

[0180] (3) Design and synthesize primers for amplifying the target site sequences of ddnTrp88STOP, fbiALys250STOP, fbiCVal318Ile and fbiCCys98Tyr. The primers for amplifying the ddnTrp88STOP target site are shown in SEQ ID NO. 18 and SEQ ID NO. 19; the primers for amplifying the fbiALys250STOP target site are shown in SEQ ID NO. 20 and SEQ ID NO. 21; the primers for amplifying the fbiCVal318Ile target site are shown in SEQ ID NO. 22 and SEQ ID NO. 23; and the primers for amplifying the fbiCCys98Tyr target site are shown in SEQ ID NO. 24 and SEQ ID NO. 25.

[0181] SEQ ID NO. 18: CGGAGAAGAACCCGATGTAGTACCTCAAC

[0182] SEQ ID NO.19:TACATCGGGTTCTTCTCCGGCCGCCCTT

[0183] SEQ ID NO.20:TCGCCGATCATCGGCGAATAGCCGTTGCG

[0184] SEQ ID NO.21:ATTCGCCGATGATCGGCGAGTAGCCGACG

[0185] SEQ ID NO.22:TCCCGGTCACCCGGTTATACCGGGACAAT

[0186] SEQ ID NO.23:TATAACCGGGTGACCGGGATAAACACCTT

[0187] SEQ ID NO.24:GAGGATTACCTGGCGACGATTGCGGTGGC

[0188] SEQ ID NO.25:TCGTCGCCAGGTAATCCTCGATTCCGGCA

[0189] (4) Using the primers designed in step (3), and the Cas13a-sgRNA backbone vector constructed in Example 6 as a template, the system was prepared according to the instructions attached to the Taq enzyme and PCR amplification was performed. The PCR amplification program was: 94℃ for 5 min; 94℃ for 30 sec, 55℃ for 30 sec, 72℃ for 10 sec, 30-35 cycles; 72℃ for 10 min.

[0190] The amplified product verified by agarose gel electrophoresis was used for in vitro transcription using an RNA synthesis kit according to the accompanying instructions. The transcription product was sgRNA.

[0191] Example 8

[0192] The detection results were evaluated by analyzing the fluorescence signal intensity of DLM resistance target sites using the CRISPR / Cas13a system combined with the ssRNAFAM-BHQ1 fluorescent reporter method, as detailed below:

[0193] The sequence information was sent to the company for synthesis of the ssRNAFAM-BHQ1 fluorescent reporter. The reaction system was prepared using the kit as shown in Table 1. After thorough mixing, the mixture was incubated at 37°C for 60 min. The reaction system was then imaged using ultraviolet light and LED blue light from a gel imaging device, and the fluorescence intensity of the reaction system was observed under natural light.

[0194] Table 1 Reaction System

[0195]

[0196]

[0197] The detection principle schematic diagram is shown in Figure 7 The Cas13a protein specifically recognizes and cuts the target ssRNA under the guidance of gRNA, and uses the "bypass activity" characteristics of Cas13a protease to non-specifically cut the ssRNA reporter carrying a visual fluorescent group.

[0198] The detection results are shown in Figure 8 The CRISPR / Cas13a has specific recognition and cutting for four DLM drug resistance mutation sites fbiC Cys98Tyr, fbiC Val318Ile, fbiA Lys250STOP and ddn Trp88STOP, and can better activate the Cas13a protein for non-specific cutting of bypass activity. The difference between wild type and mutant fluorescence signals is significant.

[0199] Example 9

[0200] A simple drug resistance point mutation detection method is provided by combining the paper chromatography detection method using the convenience of CRISPR / Cas13a detection, as follows:

[0201] (1) Design a ssRNA FAM-Biotin reporter (sequence shown in SEQ ID NO. 26), which is a 6bp poly U sequence connecting FAM (5 ′ end) and Biotin (3 ′ end).

[0202] SEQ ID NO. 26: FAM-UUUUUU-Biotin

[0203] (2) The reaction system is configured by using the kit as shown in Table 2, incubated at 37°C for 60 min, then 100 μL of HybriDetect reagent buffer is added to each experimental system, a HybriDetect test paper strip is inserted into the experimental system, and the test paper strip is taken out after 1-2 min of reaction, and the detection results are observed and recorded.

[0204] Table 2 Reaction system

[0205] Reagent Name Amount Used 10x Buffer 2.1 2.5 μL RNase Inhibitor 0.5 μL LbCas13a (100 μM) 400 nM crRNA (10 μM) 400 nM SsRNA FAM-Biotin (10 μM) 6 μL Template Transcription Product 1 μL Nuclease-free water q.s. to 25 μL

[0206] The results are shown in Figure 9 and Figure 10As shown, the drug resistance site detection group was significantly thicker and darker than the wild type control and negative control. Time gradient paper chromatography was used to detect the fbiC Cys98Tyr site, and the change in detection line color was observed over time. Paper chromatography was also used to detect ddn Trp88STOP, fbiA Lys250STOP, and fbiC Val318Ile drug resistance sites. In addition, the combined paper chromatography detection technique can complete the detection of the drug resistance site of ddn in less than 1 h.

[0207] Example 10

[0208] The detection sensitivity and specificity of the CRISPR / Cas13a detection system in other bacterial genome interference were tested by fluorescence detection and paper chromatography detection methods, as follows:

[0209] (1) The ddn wild, ddn Trp88STOP, fbiA wild, fbiA Lys250STOP, fbiC wild, fbiC Val318Ile, and fbiC Cys98Tyr sequences were mixed with the M. smegmatis, C. glutamicum, and E. coli genomes at a molar concentration of 1:1. The system and method of Example 10 were used for detection, and the results are shown in Figure 11 As shown, the CRISPR / Cas13a detection system still has high specificity for drug resistance site single base mutations. Compared with the negative and wild type controls, the reaction system containing the drug resistance mutation site showed the strongest fluorescence signal, and the paper chromatography detection results were significantly different (P<0.001).

[0210] (2) To determine the sensitivity of the CRISPR / Cas13a detection system, the genomes of the mixed systems of the target sequences and M. smegmatis, C. glutamicum, and E. coli bacteria were extracted, and six concentration gradients were set. The results are shown in Figure 12 As shown, in the paper chromatography detection experiment, the CRISPR / Cas13a system can highly specifically recognize drug resistance sites, and its sensitivity can reach 100 aM, and the gray value analysis difference is significant (P<0.01).

[0211] Therefore, the application provides four candidate sites closely linked with the niddamani resistance; the active Cas13a protease is successfully expressed and purified through a prokaryotic expression vector, and the purity is 95%; a Cas13a-sgRNA skeleton vector is provided, and a sequence containing any to-be-recognized site can be added; sgRNA is obtained by reverse transcription of crDNA in the Cas13a-sgRNA skeleton vector, and the CRISPR / Cas13a technology constructed in this way can be combined with fluorescence detection and paper chromatography detection technology to realize visual detection of the mutation site of the delamanid-resistant gene, the method is simple and easy to operate, does not need expensive and precise instrument equipment, the detection time is short, only needs 37 DEG C incubation for 60 min, and is low in cost, high in sensitivity and strong in specificity, and the sensitivity can reach 100 aM.

[0212] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application, but not to limit it, although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that: it can still modify or equivalently replace the technical solutions of the present application, and these modifications or equivalent replacements also cannot make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present application.

Claims

1. A Casl3a-sgRNA backbone vector, characterized in that: The CRISPR DNA primer is synthesized according to a universal sequence, and the synthesized CRISPR DNA primer is connected to a Topo vector.

2. The Casl3a-sgRNA backbone vector of claim 1, wherein: The universal sequence is shown in SEQ ID NO. 16; the sequence containing the specific mutation site is located at position 3 or 4 at the 5' end of the CRISPR DNA primer, and a mismatch site is added at position 5 or 6.

3. The Casl3a-sgRNA backbone vector of claim 1, wherein: The sequence of the CRISPR DNA primer is shown in SEQ ID NO. 1-8.

4. An sgRNA, characterized in that: The sgRNA is reverse transcribed from the Cas13a-sgRNA backbone vector according to any one of claims 1-3.

5. A kit for detecting a mutation site, characterized by, The kit comprises the Cas13a-sgRNA backbone vector according to any one of claims 1-3 or the sgRNA according to claim 4.

6. Use of a kit for detecting a mutation site according to claim 5 for detecting a mutation site, characterized in that: The kit is used in combination with or without fluorescence detection or paper chromatography detection.

7. Four loci detected for resistance to delamanid Mycobacterium tuberculosis, characterized in that: The four sites are the ddn Trp88STOP site of the ddn gene, the Lys250STOP site of the fbiA gene, the fbiC Val318Ile site of the fbiC gene, and the fbiCCys98Tyr site of the fbiC gene.

8. The four loci for detecting resistance to delamanid of Mycobacterium tuberculosis according to claim 7, characterized in that: The primer sequences for amplifying the ddn Trp88STOP site of the ddn gene are shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively; the primer sequences for amplifying the Lys250STOP site of the fbiA gene are shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively; the primer sequences for amplifying the fbiC Val318Ile site of the fbiC gene are shown in SEQ ID NO. 5 and SEQ ID NO. 6, respectively; and the primer sequences for amplifying the fbiCCys98Tyr site are shown in SEQ ID NO. 7 and SEQ ID NO. 8, respectively.

9. A kit for detecting the four loci of Mycobacterium tuberculosis that confer resistance to bedaquiline according to claim 7 or 8, characterized in that: The sgRNA sequences are shown in SEQ ID NO. 18-25, respectively.

10. A kit of reagents for detecting four of the loci of Mycobacterium tuberculosis that are resistant to the drugs according to claim 9, characterized by the fact that: The kit comprises a fluorescence detection reagent or a paper chromatography detection reagent. The kit comprises a fluorescence detection reagent or a paper chromatography detection reagent.

Images