Application of soybean GmANN13 gene in improving saline-alkaline resistance of plants

Abstract

The invention belongs to the field of gene engineering, and relates to application of a soybean saline-alkaline tolerant gene GmANN13. The soybean annexin gene GmANN13 is applied to gene engineering for improving the saline-alkaline tolerance of soybeans. The invention discloses application of the soybean annexin gene GmANN13 in cultivation of saline-alkaline tolerant soybean varieties. The invention also discloses application of an expression vector containing the soybean annexin gene GmANN13 in cultivation of saline-alkaline tolerant soybean varieties. Stable transformation and saline-alkaline tolerance researches of soybean hairy roots, arabidopsis thaliana and soybeans show that the soybean GmANN13 responds to induction of saline-alkaline stress, and the saline-alkaline tolerance of plants can be improved by overexpressing the gene in the soybeans. Therefore, when the plant saline-alkaline tolerance related protein coding gene GmANN13 is transferred into crops through a genetic engineering means, a new variety of transgenic plants with saline-alkaline stress tolerance can be obtained.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of genetic engineering and relates to application of a soybean GmANN13 gene in improving plant salt-alkali tolerance. BACKGROUND

[0002] Soybean is an important economic crop, rich in oil and protein, and is an important source of human food, animal feed and biodiesel raw materials. It is also used as a raw material for many human health and industrial products. Salt stress is one of the abiotic stresses that significantly reduces soybean yield. Soybean is a moderately salt-tolerant crop, and when the salt content in the soil is higher than 5 dS / m, the yield of soybean is significantly reduced. Therefore, it is of great significance to mine soybean salt-tolerant genes, analyze the salt-tolerant mechanism, and breed soybean salt-tolerant varieties to improve soybean yield.

[0003] Annexins is a highly conserved multi-gene family in plants, animals and fungi, which consists of a carboxyl (C) terminal conserved core containing a four-fold repeat sequence (I-IV) known as "annexin repeat", which has a typical Ca 2+ binding site. Plant annexins are involved in important biological processes such as cytoskeleton organization, cell secretion, maintenance of cell homeostasis, ion channel formation, and regulation of plant response to stress and signal transduction. Early studies have shown that annexins are related to plant abiotic stress response. Some transcriptome studies have found that drought, aluminum or heavy metal treatment can regulate the expression of annexins. The expression of 8 Arabidopsis annexins is regulated by various abiotic stresses. Recently, it has been found that heterologous expression of Brassica annexin homolog AnnBj1 of AnnAt1 can improve the resistance of transgenic tobacco plants to drought and other biotic and abiotic stresses. However, little is known about the function of soybean annexins. SUMMARY

[0004] The purpose of the present application is to provide the application of soybean annexin gene GmANN13 to overcome the above-mentioned deficiencies of the prior art.

[0005] The purpose of the present application can be achieved by the following technical solutions.

[0006] The soybean annexin gene GmANN13, wherein the nucleotide sequence of the GmANN13 gene is shown in SEQ ID NO. 1.

[0007] The protein encoded by the annexin gene GmANN13 has an amino acid sequence of SEQ ID NO. 2.

[0008] The expression vector containing the soybean annexin gene GmANN13.

[0009] The application of the soybean annexin gene GmANN13 in genetic engineering for improving the salt and alkali tolerance of plants.

[0010] The plant is preferably soybean or Arabidopsis.

[0011] The application of the soybean annexin gene GmANN13 in breeding salt and alkali tolerant soybean varieties.

[0012] The application of the expression vector containing the soybean annexin gene GmANN13 in breeding salt and alkali tolerant soybean varieties.

[0013] The application of the expression vector containing the soybean annexin gene GmANN13 in genetic engineering for improving the salt and alkali tolerance of plants.

[0014] The plant is preferably soybean or Arabidopsis.

[0015] Beneficial effects:

[0016] The plant salt and alkali tolerance related protein coding gene GmANN13 open reading frame provided by the application has a length of 951bp, and codes a protein composed of 316 amino acids. The coded protein contains an ANX domain highly homologous to other annexins, and is located on the cytoplasmic membrane. The application preliminarily predicts the role of GmANN13 in salt and alkali stress through bioinformatics analysis, tissue expression and expression pattern analysis under salt and alkali stress; subcellular localization of GmANN13 is performed; through soybean hairy root, Arabidopsis, soybean stable transformation and salt and alkali tolerance research, it is shown that soybean GmANN13 responds to the induction of salt and alkali stress, and overexpression of the gene in soybean can improve the salt and alkali tolerance of the plant. Therefore, the plant salt and alkali tolerance related protein coding gene GmANN13 is transferred into crops through genetic engineering, and a new salt and alkali tolerant transgenic plant variety can be obtained. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 Phenotype of wild type (Col) and GmANN13 overexpression Arabidopsis after 18 days of salt treatment

[0018] Col: wild type Arabidopsis (Col-0); OE#2, OE#3 and OE#4 are GmANN13 overexpression Arabidopsis lines, and the scale bar is 1.5cm.

[0019] Figure 2Fresh weight of wild type (Col) and GmANN13 gene overexpression Arabidopsis under salt stress for 18 days. Col: wild type Arabidopsis (Col-0); OE#2, OE#3, OE#4: Arabidopsis lines overexpressing. Data are means ± standard deviation of three biological replicates (n = 3 x 9). Capital letters above the error bars for each treatment condition represent that there is no significant difference at the 0.01 level under Duncan's test, and different capital letters represent significant difference.

[0020] Figure 3 Salt-tolerant phenotype of transgenic soybean chimera plants

[0021] A: Fluorescence signal map of soybean hairy chimera transformed with empty vector (EV) and GmANN13 overexpression vector; scale bar = 5 mm; GFP: soybean hairy chimera transformed with empty vector (EV); GmANN13: soybean hairy chimera transformed with GmANN13 overexpression vector. B: Phenotype of soybean hairy chimera transformed with GmANN13 overexpression vector and empty vector (EV) under 0 mM Hoagland nutrient solution and 30 mM NaHCO3+80 mM NaCl Hoagland nutrient solution treatment for 5 days; scale bar = 2 cm; 35S:GFP-CK: empty control group; 35S:GFP-T: empty treatment group; 35S:GmANN13-GFP-CK: GmANN13 overexpression vector control group; 35S:GmANN13-GFP-T: GmANN13 overexpression vector treatment group.

[0022] Phenotype after 5 days of Hoagland nutrient solution treatment; scale bar = 2 cm; 35S:GFP-CK: empty control group; 35S:GFP-T: empty treatment group; 35S:GmANN13-GFP-CK: GmANN13 overexpression vector control group; 35S:GmANN13-GFP-T: GmANN13 overexpression vector treatment group.

[0023] Figure 4 Relative water content of leaves of transgenic soybean chimera plants

[0024] CK represents 0 mM Hoagland nutrient solution; T represents 30 mM NaHCO3+80 mM NaCl Hoagland nutrient solution; relative water content of leaves of soybean chimera plants transformed with GFP empty vector and GmANN13 overexpression vector after 5 days of treatment; GFP4-CK, GFP4-T, GmANN13-CK, GmANN13-T represent the relative water content of leaves of soybean hairy plants transformed with GFP empty vector and GmANN13 overexpression vector after 5 days of treatment under 0 mM (CK) and 30 mM NaHCO3+80 mM NaCl (T) conditions, respectively; data represent the mean ± standard deviation of three biological replicates (n = 3 x 3). Capital letters above the error bars represent that there is no significant difference at the 0.01 level under Duncan's test at each time point, and different capital letters represent significant difference.

[0025] Figure 5T3 generation GmANN13 overexpression soybean and WT under control (CK) and salt stress (200 mM NaCl) treatment for 16 days

[0026] A: Phenotype of GmANN13 overexpression soybean and WT under control (CK) and salt stress (200 mM NaCl) treatment for 16 days; B: Relative expression of GmANN13 in WT and OE#17; OE#17: GmANN13 overexpression soybean line 17; WT: Tianlong No. 1. Data are means ± standard deviation of three replicates (n = 3 x 3); ** represents significant difference between overexpression plants and empty vector plants at 0.01 level (student's t-test).

[0027] Figure 6 Effect of GmANN13 overexpression on salt tolerance of stable soybean lines

[0028] A: Chlorophyll content of GmANN13 overexpression and WT control soybean plants after 14 days of 0 mM and 200 mM NaCl treatment; B: Fresh weight of GmANN13 overexpression and WT control soybean plants after 16 days of 0 mM and 200 mM NaCl treatment. Data are means ± standard deviation of three replicates (n = 3 x 3). ** represents significant difference between overexpression plants and empty vector plants at 0.01 level (student's t-test). DETAILED DESCRIPTION

[0029] Example 1 Cloning and identification of soybean GmANN13 and gene

[0030] The experimental material was soybean (Glycine max (L.) Merr.) local variety Zhongdou No. 8, provided by the Germplasm Research Lab of National Soybean Improvement Center, Nanjing Agricultural University. In this study, 26 soybean annexin genes were identified from multiple tissues of soybean through Arabidopsis homologous comparison, and a soybean annexin gene that was dominantly expressed in each tissue was selected, named GmANN13, and a primer was designed to further clone the full-length sequence of GmANN13 gene cDNA. The specific method is as follows: The root tip of Zhongdou No. 8 was crushed in liquid nitrogen, and total RNA was extracted using the plant total RNA extraction kit RNAprep Pure Plant Kit (Tiangen Biotech, China). 5 μg of total RNA was reverse transcribed using the reverse transcription kit PrimeScript™ RT Master Mix kit (TaKaRa, Japan) according to the kit method, and the obtained cDNA fragments were used as templates. F1: ATGGCAGATCTCAAGTCTACATTCTT and R1:

[0031] The primers for amplifying the GmANN13 open reading frame are shown in SEQ ID NO. 3 and SEQ ID NO. 4. The 50 μl PCR reaction system is as follows: 2 μl cDNA (0.05 μg), 2 μl (10 μM) of the upstream and downstream primers, 5 μl 10 x PCR buffer, 1 μl dNTP (10 mM), and 2 U Taq DNA polymerase, and the volume is made up to 50 μl with ultrapure water. The reaction is performed on a Bio-RAD PTC200 PCR instrument, and the program is as follows: 94 °C pre-denaturation for 5 min; 94 °C denaturation for 50 s, 58 °C annealing for 50 s, 72 °C extension for 1 min, for a total of 35 cycles; then 72 °C extension for 10 min, and 4 °C storage. After the PCR product is recovered and sequenced, sequence analysis is performed, and the results show that the open reading frame sequence of the gene is shown in SEQ ID NO. 1, the full length is 951 bp, and it encodes 316 amino acids shown in SEQ ID NO. 2.

[0032] Example 2 Obtaining of the transgenic Arabidopsis thaliana strain and phenotype identification

[0033] According to the GmANN13 gene CDS sequence and the MCS information of the plant expression vector pTF-101, two restriction endonuclease enzyme cleavage sites of Asc I and Pac I are selected, and the GmANN13 gene of Zhongdou No. 8 is cloned by designing the amplification primers according to the one-step cloning method. The one-step cloning primer F2 is 5'-TCTAGAGGATCTCGAGGCGCGCCATGGCGACACTTAAGGTTCCTC-3', and the one-step cloning primer R2 is 5'-ATTCGAGCTCACTAGTTAATTAATCAAGCATCATCATGTCCTAAAAGC-3'. Then, the GmANN13 gene is inserted into the MCS of the plant expression vector pTF-101 by the method of restriction endonuclease enzyme cleavage and one-step cloning primer ligation. Then, the pTF-101-GmANN13 vector is introduced into Agrobacterium rhizogenes EHA101, and the Arabidopsis Col-0 WT plant is transformed by the flower immersion method. The T0 generation Arabidopsis seeds harvested in the early stage are sterilized by washing with filtered 0.9% sodium hypochlorite and 75% ethanol for three times, and then washed with sterilized ultrapure water for three times. Then, the Arabidopsis seeds are placed in a 4°C refrigerator for 2-3 days for vernalization. Then, the Arabidopsis seeds are uniformly scattered on the sterilized vermiculite nutrient soil (vermiculite:nutrient soil = 1.5:1) for culture. After three weeks, 70 mg / L of glufosinate is sprayed for screening, and the spraying is performed once a week. The Arabidopsis that still grows normally without wilting is moved to new vermiculite nutrient soil for culture, and the T1 generation Arabidopsis seeds are obtained by breeding. The received T1 generation Arabidopsis seeds are sowed on the 1 / 2MS culture medium containing 20 mg / L of glufosinate after the same disinfection. After about one week of growth, it can be found that the transgenic Arabidopsis can grow normally on the culture medium containing glufosinate, and the cotyledon is also greener. However, the non-transgenic Arabidopsis cannot grow normally, and the cotyledon appears wilting and yellowing, and even cannot germinate. The Arabidopsis that grows normally on the glufosinate plate is moved to the vermiculite nutrient soil (vermiculite:nutrient soil = 1.5:1) for continuous culture. The received Arabidopsis seeds are continuously grown and screened on the culture medium containing glufosinate until the seeds of each strain are grown on the culture medium containing glufosinate after sowing, and the transgenic Arabidopsis is preliminarily identified as homozygous. The Arabidopsis plant that is preliminarily identified as homozygous transgenic is taken to extract DNA from the leaf at the bolting stage for PCR detection. The Arabidopsis with the same size of amplified target fragments is selected for breeding to carry out the next experiment.

[0034] The overexpression Arabidopsis that is verified to be homozygous and the wild type Arabidopsis are bred and seeds are collected. Then, the harvested seeds are sterilized by washing with filtered 0.9% sodium hypochlorite and 75% ethanol for three times, and then washed with sterilized ultrapure water for three times. Then, the seeds are placed in a 4°C refrigerator for 2-3 days for vernalization.

[0035] The seeds were sowed on 1 / 2MS medium containing 0mM (CK), 100mM NaCl, and after 18 days of treatment, photos were taken and fresh weight was counted. Figure 1 , Figure 2 It can be seen that under the untreated condition, the growth of wild-type Arabidopsis and transgenic Arabidopsis is basically consistent, and there is no significant difference in fresh weight; and on the medium containing 100mM NaCl, compared with the transgenic Arabidopsis, the wild-type Arabidopsis is more obviously inhibited, and the fresh weight is significantly less than that of the GmANN13 gene overexpression line.

[0036] Example 3 Obtaining and phenotype identification of GmANN13 gene overexpression soybean hairy root chimera

[0037] According to the CDS sequence of GmANN13 gene and the MCS information of co-expression vector pBinGFP4, Kpn I and Sma I two restriction endonuclease enzyme cutting sites were selected, and the GmANN13 gene in the middle soybean 8 was cloned according to the one-step cloning method. The one-step cloning primer F3: 5'-atttacgaacgatagggtaccATG GCGACACTTAAGGTTCCTC-3', R3: 5'-gcccttgctcaccatggatccAGCATCATCAT GTCCTAAAAGCG-3', and then the GmANN13 gene was inserted into the MCS of the co-expression vector pBinGFP4 by the method of restriction endonuclease enzyme cutting and one-step cloning primer ligation. The recombinant plasmid was transformed into Agrobacterium rhizogenes K599. The seeds of Tianlong 1 soybean with round and full grains were selected, the surface of the soybean was washed with 75% ethanol for disinfection, and then washed with ultrapure water three times to remove the excess 75% ethanol for standby. The washed soybean seeds were placed in the sand cooled to room temperature after high pressure sterilization for germination. The culture conditions were 14h light / 10h darkness, and the temperature was 28℃ / 25℃. Prepare 50mL sterilized centrifuge tube, wrap the outside of the centrifuge tube with tin foil to keep the light-free environment, then fill in 40mL 1 / 2Hogland nutrient solution, and then move the plants with 3d growth and not yet unfolded cotyledon into the centrifuge tube for culture. The previously stored Agrobacterium rhizogenes empty liquid and GmANN13 overexpression liquid were transferred to YEB liquid medium, and the liquid was expanded at 28℃ and 220rpm. When the OD600 value of the liquid reached 0.6-0.8, stop, centrifuge at 5000rpm for 10min to collect the bacteria. Discard the supernatant, resuspend the bacteria at the bottom of the tube wall after centrifugation twice with 10mM MgCl2, and finally resuspend the liquid OD600 value to 0.6 for standby. The seedlings just pulled out of the sand need to adapt to the outside environment for a day, which is beneficial to their growth. Then at 1cm from the cotyledon of the seedling, a 1cm long wound is made with a 1mL syringe needle, and then the bacteria liquid is injected into the wound with a 1mL syringe and rubbed back and forth to facilitate bacterial infection, and repeated twice. The seedlings need to be cultured in the dark for the first day after infection, and can be normally cultured on the second day. From the third day, the seedlings are humidified with a humidifier for 4h in the morning and afternoon, and the nutrient solution in the centrifuge tube is maintained at 40ml, keeping a high transpiration pull in the centrifuge tube. The new roots of the wound are about 5cm long, and a small amount of main root and aerial root not in the wound is intermittently reduced. When the main root and aerial root are completely cut off, the soybean seedlings can be moved to a 1L beaker for further culture with 1 / 2Hoagland nutrient solution. After 1 week of culture in the beaker, the positive roots with green fluorescence are screened under the fluorescence stereomicroscope, and the non-positive roots are cut off. After the non-positive roots are completely cut off, the plants are cultured for about one week, and the plants with consistent growth are selected for treatment.The treatment group was cultured with 1 / 2 Hoagland nutrient solution (pH = 8.5) of 30 mM NaHCO3+80 mM NaCl; the control group was cultured with 1 / 2 Hoagland nutrient solution (pH = 5.8), and 15 seedlings were taken from each treatment, and three biological replicates were set. The changes in the phenotype of the chimera plants under salt and alkali treatment were observed and recorded, such as. Figure 3 The phenotype after 5 days of salt and alkali treatment. From Figure 3 It can be seen that under normal culture conditions, the hairy root chimera plants of the empty vector and the GmANN13 overexpression vector grow well and have no obvious difference. After 5 days of treatment with 30 mM NaHCO3+80 mM NaCl, the chimera plants of the empty vector and the GmANN13 overexpression vector appear yellowing, wilting plants become dwarf, indicating that the plants are damaged by salt and alkali stress, and the growth of the pBinGFP4:GmANN13 chimera plants is better than that of the empty vector plants under the treatment of 30 mM NaHCO3+80 mM NaCl. The empty vector plants appear severe wilting, yellowing leaves, and some plants die. It shows that the overexpression of GmANN13 gene improves the salt and alkali tolerance of soybean hairy roots.

[0038] In order to further illustrate that the chimera plants of the GmANN13 overexpression vector have certain salt and alkali tolerance, the relative water content of the leaves of the treatment group and the control group of the chimera plants was measured, as shown in Figure 4 Under normal conditions, there is no obvious difference in the relative water content of the leaves of the GmANN13 overexpression vector and the empty vector hairy root chimera plants; after 5 days of salt and alkali stress treatment, the relative water content of the leaves of the GmANN13 overexpression chimera plants is significantly higher than that of the empty vector chimera plants, indicating that the overexpression of GmANN13 improves the relative water content of the leaves of the chimera plants, and verifies that GmANN13 gene regulates the salt and alkali tolerance of soybean.

[0039] Example 4 Obtaining and phenotypic identification of soybean lines overexpressing GmANN13 gene

[0040] In order to better understand the role of soybean GmANN13 gene in soybean, the recombinant plasmid pTF-101-GmANN13 vector was used to obtain soybean lines overexpressing GmANN13 gene by Agrobacterium-mediated stable transformation of soybean. The obtained soybean transgenic positive seedlings were identified by 135 mg / L glufosinate coating and PCR amplification.

[0041] The T3 generation stable lines were treated with salt, treatment group: 200 mM NaCl in 1 / 2 Hoagland nutrient solution (pH = 5.8); control group: 1 / 2 Hoagland nutrient solution (pH = 5.8). After 14 days of treatment, the middle leaf of the three-leafed leaf of the plant was measured using the chlorophyll instrument Konica Minolta SPAD-502, and each leaf was measured three times to obtain the average value; after 16 days of treatment, the high-throughput small plant phenotype system was used to take pictures and measure the Fv / Fm value; finally, the fresh weight of the aboveground part was measured.

[0042] From Figure 5 It can be seen that the growth of GmANN13 overexpression plants is consistent with that of WT soybean plants under control conditions, while after 16 days of salt stress (200 mM NaCl) treatment, the WT plants have smaller leaves, more severe wilting, and shorter plants compared to the GmANN13 overexpression soybean plants; indicating that the overexpression of the GmANN13 gene plays a role in soybean salt stress, and improves the salt tolerance of soybean. To further show the role of GmANN13 in the salt tolerance process, the chlorophyll content and fresh weight of the aboveground part were measured for the treatment group and the control group; as shown in Figure 6 the chlorophyll content and fresh weight of the aboveground part of the GmANN13 overexpression soybean plants are significantly higher than those of the WT plants.

Claims

1. A recombinant expression vector containing a soybean annexin gene GmANN13, characterized in that, The nucleotide sequence of the soybean annexin gene GmANN13 is shown as SEQ ID NO.

1.

2. The recombinant expression vector of claim 1, wherein, The soybean annexin gene GmANN13 is inserted into the MCS of the plant expression vector pTF-101.

3. The genetic engineering application of the soybean annexin gene GmANN13 in improving the salt-tolerant ability of plants according to claim 1.

4. Use according to claim 3, characterized in that The plant is selected from soybean or Arabidopsis.

5. The application of the soybean annexin gene GmANN13 in breeding salt-tolerant soybean varieties according to claim 1.

6. The genetic engineering application of the recombinant expression vector according to claim 1 or 2 in improving the salt-tolerant ability of plants.

7. Use according to claim 6, characterized in that The plant is selected from soybean or Arabidopsis.

8. The application of the recombinant expression vector according to claim 1 or 2 in breeding salt-tolerant soybean varieties.

Images