Recombinant proteins

Abstract

The present disclosure addresses the problem of providing a method capable of detecting endotoxin. In addition, the present disclosure also addresses the problem of providing an endotoxin detection reagent having thermal stability. The present disclosure provides a recombinant Factor C protein having a prescribed amino acid sequence, a polynucleotide encoding the same, an endotoxin detection reagent comprising the same, and methods for producing the same. Also provided are: a recombinant Factor C protein having a prescribed amino acid substitution; a polynucleotide encoding the same; an endotoxin detection reagent comprising the same; and methods for producing the recombinant Factor C protein and the polynucleotide.

Description

Technical Field

[0001] This invention relates to a recombinant protein. More specifically, this invention relates to a recombinant protein for the determination of, for example, endotoxins. Background Technology

[0002] Endotoxins are lipopolysaccharides that make up the cell walls of Gram-negative bacteria. Endotoxins are highly stable substances, making them difficult to remove or inactivate when they are introduced during the manufacturing and use of pharmaceuticals, medical devices, and dialysis solutions. Endotoxins are known to be representative pyrogenic substances; even trace amounts (ng or pg) of endotoxin in the blood due to contamination with medication can cause fever in the recipient or animal, and can lead to highly fatal diseases such as sepsis-related intravascular coagulation. Therefore, in the fields of injectables, medical devices, biopharmaceuticals, regenerative medicine products, and dialysis solutions, it is crucial that products be endotoxin-free (pyrogen-free), and the market demands technologies for rapid and accurate determination of endotoxin contamination.

[0003] The current mainstream method for endotoxin determination is the horseshoe crab (LAL) assay. The LAL assay is a test method based on the reaction between endotoxin and Limulus amebocyte lysate (LAL). Known methods include gelation, turbidimetry, colorimetry, and fluorescence assays (see, for example, Patent Documents 1 and 2). Reagents used for determination with LAL are described as LAL reagents, lysate reagents, or horseshoe crab reagents, all of which have the same meaning.

[0004] The principle used for determining endotoxins using LAL is as follows: Figure 1 The diagram illustrates this. Endotoxin causes Factor C, the enzyme precursor, to be converted into Activated Factor C. Activated Factor C acts as a hydrolase, converting Factor B, also an enzyme precursor, into Activated Factor B. Activated Factor B is also a hydrolase, converting the thrombin precursor (procoagulase) into activated thrombin (coagulase). Thrombin is a hydrolase. Methods include utilizing its hydrolytic activity to hydrolyze peptide-labeled synthetic matrices, and determining the products or disappearances using turbidimetric methods, chromogenic matrix methods, fluorescent matrix methods, and luminescent matrix methods.

[0005] Examples of species in the genus *Limulus*, *Tachypleus*, and *Carcinoscorpius* include the American horseshoe crab (*Limulus polyphemus*), the Chinese horseshoe crab (*Tachypleus tridentatus*), the southern horseshoe crab (*Tachypleus gigas*), and the round-tailed horseshoe crab (*Carcinoscorpius rotundicauda*). Horseshoe crab amoeboid cell lysates are a finite biological resource. On the other hand, the demand for LAL reagents is increasing, and from a sustainability perspective, a continued reliance on horseshoe crab amoeboid cell lysates as a source of LAL reagents is not preferable.

[0006] Patent document 3 describes a recombinant protein from horseshoe crabs and the DNA encoding it. Patent documents 4-11 describe recombinant proteins.

[0007] Non-Patent Literature 1 describes recombinant Factor C as a synthetic alternative to horseshoe crab cell lysate for endotoxin detection, used in the storage of horseshoe crabs. While recombinant Factor C is commercially available, the authors of Non-Patent Literature 1 point out that because it does not replace LAL reagents with recombinant Factor C, and because the disclosed recombinant Factor C is protected by an exclusive patent, the pharmaceutical industry is reluctant to rely on a single supplier for endotoxin detection reagents. Therefore, the existence of recombinant Factor C does not mean that other options are unnecessary.

[0008] An endotoxin detection reagent with low environmental impact and stable supply is needed. Furthermore, an endotoxin detection reagent with thermal stability is also required.

[0009] Existing technical documents Patent documents Patent Document 1: International Publication No. 1995 / 014931 Patent Document 2: Japanese Patent Application Publication No. 2009-150903 Patent Document 3: International Publication No. 2018 / 074498 (Patent No. 6927993) Patent Document 4: U.S. Patent No. 5,712,144 Patent Document 5: U.S. Patent No. 5,716,834 Patent Document 6: U.S. Patent No. 5,858,706 Patent Document 7: U.S. Patent No. 5,985,590 Patent Document 8: U.S. Patent No. 6,645,724 Patent Document 9: International Publication No. 2008 / 004674 Patent Document 10: Japanese Patent Publication No. 2014-510898 Patent Document 11: International Publication No. 2014 / 092079 Non-patent literature Non-patent literature 1: PLoS Biol. 2018 Oct; 16(10): e2006607. Summary of the Invention

[0010] In a particular embodiment, the subject of this disclosure is to provide a recombinant Factor C protein that differs from known substances, in order to at least partially address existing problems, including concerns about stable supply in the pharmaceutical industry.

[0011] Furthermore, in a particular embodiment, the objective of this disclosure is to provide a recombinant Factor C protein with thermal stability.

[0012] In order to solve the aforementioned problem, the inventors conducted repeated and dedicated research, and as an example, they prepared a recombinant Factor C with an amino acid sequence having sequence number 3, which can be used as a substitute for Factor C or its recombinant form from horseshoe crab (Limulus polyphemus), and completed the present invention comprising it as an embodiment.

[0013] Furthermore, through repeated research, the inventors discovered that by introducing a specified amino acid substitution into recombinant FactorC having an amino acid sequence of sequence number 3, the thermal stability of recombinant FactorC was surprisingly improved, and the present invention comprising these was completed as an embodiment.

[0014] This disclosure includes the following implementation methods.

[0015] [1] A Factor C protein that has more than 95% amino acid sequence identity with sequence number 3.

[0016] [2] A polynucleotide encoding the protein described in Embodiment 1.

[0017] [3] An endotoxin detection reagent comprising the protein described in Embodiment 1.

[0018] [4] A cell comprising the polynucleotide described in Embodiment 2.

[0019] [5] A method for manufacturing Factor C protein includes: culturing the cells described in Embodiment 4; and obtaining the Factor C protein described in Embodiment 1.

[0020] [6] A method for manufacturing an endotoxin detection reagent includes: culturing the cells described in Embodiment 4; and obtaining the Factor C protein described in Embodiment 1.

[0021] [7] An endotoxin detection method includes: a step of contacting the protein described in Embodiment 1 or the reagent described in Embodiment 3 with a sample; and a step of detecting endotoxins.

[0022] This specification includes the disclosure of Japanese Patent Application No. 2023-055723, which forms the basis of the priority claim of this application.

[0023] As an effect of the present invention, hydrolytic enzymes can be obtained without relying on horseshoe crab amoeboid cell lysates. Attached Figure Description

[0024] Figure 1 This is a schematic diagram related to the principle of endotoxin assay using LAL. Detailed Implementation

[0025] In some embodiments, this disclosure provides a recombinant Factor C protein having an amino acid sequence identity of 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 95.5% or more, 96% or more, 96.5% or more, 97% or more, 97.5% or more, 98% or more, 98.5% or more, 99% or more, or 99.5% or more with sequence number 3.

[0026] In some embodiments, this disclosure provides a recombinant Factor C protein having an amino acid sequence formed by the substitution, deletion, or addition of one or more amino acids in sequence number 3. In this specification, "one or more" of the substitution, deletion, or addition of amino acids can be 1 to 20, for example 1 to 19, 1 to 18, 1 to 17, 1 to 16, 1 to 15, 1 to 14, 1 to 13, 1 to 12, 1 to 11, 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, for example 1 or 2.

[0027] (Benchmark sequence) In this specification, unless otherwise specified, sequence number 3 is used as the reference sequence to define the positions of the sequences. Sequence number 3 is the novel recombinant Factor C protein provided in this disclosure.

[0028] In this specification, "wild type" refers to the morphology that is most abundant in nature within a homogeneous population.

[0029] In this specification, the correspondence of amino acid positions can be easily determined, for example, by comparing the amino acid sequences of various Factor Cs using existing amino acid homology analysis software, such as GENETYX (manufactured by GENETYX Corporation). For example, the amino acid position of Factor C corresponding to position X of the amino acid sequence of sequence number 3 can be determined by comparing the amino acid sequence of Factor C with the amino acid sequence of sequence number 3.

[0030] In some implementations, a mutation can be artificially introduced into the recombinant Factor C of sequence number 3. This can be achieved by artificially introducing a mutation into the sequence of the gene encoding the recombinant Factor C.

[0031] Mutations can be introduced artificially for certain specific effects, or they can be introduced randomly or unintentionally. Mutations introduced for specific effects include, for example, the addition, deletion, and modification of sequences to enhance the expression level of Factor C, the addition, deletion, and modification of sequences to improve the purification efficiency of Factor C protein, and various variations that impart practically preferred properties to the Factor C protein.

[0032] In this specification, the identity of amino acid sequences and gene sequences can be calculated using programs such as maximum matching or homology search in GENTYX (manufactured by GENTYX Corporation), or multiple alignments in CLUSTAL W, or pairwise alignments based on BLAST. When aligning two or more Factor C sequences to calculate amino acid sequence identity, the positions of identical amino acids within those two or more Factor C sequences can be examined. Based on this information, identical regions within the amino acid sequence can be identified. For two or more amino acid sequences, the identity % refers to the percentage calculated when aligning two or more amino acid sequences using BLAST (BLASTP) or similar methods, with the total number of amino acids in the comparable region as the denominator and the number of positions occupied by identical amino acids as the numerator. Therefore, generally, in cases where no identity is found in two or more amino acid sequences, such as when an amino acid sequence has a C-terminal addition sequence with no identity, this non-identical region cannot be aligned and therefore cannot be used for identity % calculation.

[0033] Furthermore, the positions of similar amino acids in two or more Factor C sequences can be examined. For example, CLUSTALW can be used to align multiple amino acid sequences. In this case, sometimes the Blosum62 algorithm is used to align multiple amino acid sequences, and amino acids that are identified as similar are called similar amino acids. In the variants disclosed herein, amino acid substitutions can be based on substitutions between such similar amino acids. Through such alignment, for multiple amino acid sequences, regions that are identical in the amino acid sequences and positions occupied by similar amino acids can be examined. Based on this information, homologous regions (also known as highly conserved regions) in the amino acid sequence can be identified.

[0034] (High-throughput screening) Factor C can also be screened using high-throughput methods to obtain functional recombinant Factor C variants. For example, libraries of transformed or transduced strains with Factor C genes containing introduced variants can be screened using microtiter plates or droplet-based microfluidics. As an example, one approach is to construct a library of variant genes encoding the variants and then screen large populations of variant Factor C using phage display (e.g., Chem. Rev. 105(11): 4056-72, 2005), yeast display (e.g., Comb Chem High Throughput Screen. 2008; 11(2): 127-34), bacterial display (e.g., Curr Opin Struct Biol 17: 474-80, 2007), etc. In addition, see Agresti et al, "Ultrahigh-throughput screening in drop-based microfluidics for directed evolution" Proceedings of the National Academy of Sciences 107 (9): 4004-4009 (Mar, 2010). The description of this literature regarding ultrahigh-throughput screening methods for Factor C variant screening is incorporated herein by reference. Libraries can be constructed using, for example, error-prone PCR. Alternatively, saturation mutagenesis can be used to introduce variants by targeting the regions, locations, or corresponding regions and locations described in this specification, thereby constructing a library. Approximately ten million variants can be obtained by transforming the library into suitable cells such as electrocompetent EBY-100 cells. Yeast cells transformed with this library can then be sorted. Polydimethoxysiloxane (PDMS) microfluidic devices fabricated using standard soft lithography methods can also be used. Monodisperse droplets can be formed using flow focusing devices. Droplets containing individual variants can be used with appropriate sorting devices. When screening cells, the presence or absence of Factor C activity can be utilized. A reaction solution can be used, for example, a solution that emits light when Factor C is applied. Light emission can be measured using, for example, 96-well, 192-well, 384-well, and 9600-well plates and a plate reader. Alternatively, a colorimetric or fluorescence system can be used instead of light emission for detection. Mutation introduction and screening can be repeated multiple times. Mutations referred to here include amino acid substitutions, insertions, deletions, and / or additions.

[0035] For example, introducing 1 to 10 variants into Factor C (e.g., serial number 3) confirms activity. Then, based on the confirmed active recombinant Factor C variants, further introducing 1 to 10 variants confirms their activity. A series of high-throughput screenings (e.g., the method described above for obtaining and screening approximately ten million variants) can be repeated 2 to 5 rounds, 10 to 15 rounds, 20 to 30 rounds, 40 to 50 rounds, for example. By repeatedly performing high-throughput screenings, for example, introducing 1 to 5 variants per round, for example, 10 rounds, from the perspective of the initial Factor C, more than 10, 50, or even 100 variants can be introduced, and active variants can be obtained rapidly. Furthermore, by repeating 20 rounds, from the perspective of the initial Factor C, more than 20, 100, or even 200 variants can be introduced, and active variants can be obtained rapidly. The same applies to 30-wheel, 40-wheel, and 50-wheel configurations. This operation can be performed using automated devices or by repeatedly following a standard procedure.

[0036] Mutations can be introduced at any position from the first to the last amino acid in the full-length amino acid sequence of Factor C. However, regions important to enzyme function, such as the active site, matrix recognition site, endotoxin recognition site, and their vicinity, are excluded. Factor C is widely used in industry, and those skilled in the art are familiar with regions important to enzyme function, including its active site, matrix recognition site, and endotoxin recognition site. In a specific embodiment, for example in the full-length sequence of Factor C, firstly, one or more mutations can be introduced into positions 1-10. Then, based on a confirmed recombinant Factor C variant, one or more mutations are introduced into positions 11-20 to confirm activity. This operation can be repeated n times (n≤102). For example, in the 102nd time, one or more mutations can be introduced into positions 1011-1019. Regions important to enzyme function or regions that do not wish to be modified can be skipped as appropriate. For example, position 966 of sequence number 3 or its corresponding position can be skipped. Therefore, except for regions important for enzyme function, any mutation can be introduced into any position in the full-length sequence. Furthermore, recombinant Factor C variants with 5 or more, 10 or more, 20 or more, 30 or more, 40 or more, 50 or more, 60 or more, 70 or more, 80 or more, 90 or more, 100 or more, 110 or more, 120 or more, 130 or more, 140 or more, 150 or more, 160 or more, 170 or more, 180 or more, 190 or more, or for example, 200 or more, mutations compared to, for example, sequence number 3, can be rapidly obtained and exhibit activity. In some embodiments, mutations that would cause Factor C activity to disappear are not introduced. In some embodiments, no mutations are generated at positions corresponding to positions 966, 809, 865, 26, 61, 62, and 63 of sequence number 3. In some embodiments, positions 1-25 of sequence number 3 can be deleted.

[0037] Variations can be introduced randomly or through a deliberate design. In some embodiments, variations introduced through a deliberate design or randomly can be conserved amino acid substitutions. Conserved amino acid substitutions include amino acid substitutions that give the unsubstituted amino acid similar chemical properties to the substituted amino acid (e.g., Stryer et al., Biochemistry, 5th ed., 2002, pp. 44-49). For example, conserved amino acid substitutions can be selected from the group consisting of: (i) substitutions of basic amino acids with different types of basic amino acids; (ii) substitutions of acidic amino acids with different types of acidic amino acids; (iii) substitutions of aromatic amino acids with different types of aromatic amino acids; (iv) substitutions of nonpolar aliphatic amino acids with different types of nonpolar aliphatic amino acids; and (v) substitutions of polar uncharged amino acids with different types of polar uncharged amino acids. Basic amino acids can be selected, for example, from arginine, histidine, and lysine. Acidic amino acids can be, for example, from aspartic acid or glutamic acid. Aromatic amino acids can be selected, for example, from phenylalanine, tyrosine, and tryptophan. Nonpolar aliphatic amino acids can be selected from, for example, glycine, alanine, valine, leucine, methionine, proline, and isoleucine. Polar, uncharged amino acids can be selected from, for example, serine, threonine, cysteine, asparagine, and glutamine. Regarding conserved amino acid substitutions, the chemical properties of the unsubstituted and substituted amino acid residues are similar. Furthermore, in the three-dimensional structure of the protein, the sites of conserved amino acid substitutions are located at the same positions. Therefore, variants with such conserved amino acid substitutions are likely to retain their three-dimensional structure and possess activity.

[0038] In some embodiments, variations introduced through careful design or randomly include substitution with a functionally similar amino acid. Tables of functionally similar amino acids are well known in the art. In some embodiments, in substitution with a functionally similar amino acid, the unsubstituted amino acid and the substituted amino acid may correspond to any of the following defined amino acid classifications: 1) Glycine (G), alanine (A); 2) Aspartic acid (D), glutamic acid (E); 3) Asparagine (N), glutamine (Q); 4) Arginine (N), Lysine (K), Histidine (H); 5) Isoleucine (I), Leucine (L), Valine (V), Proline (P); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), threonine (T); and 8) Cysteine ​​(C), Methionine (M).

[0039] In contrast to conserved amino acid substitution, non-conserved amino acid substitution is the substitution of an amino acid by any amino acid other than the conserved substitutions (i) to (v) described above. In some embodiments, the amino acid substitution may be a non-conserved amino acid substitution. In this case, for example, it can be confirmed whether the protease activity is maintained before and after the introduction of the non-conserved amino acid substitution. If activity is confirmed, the non-conserved amino acid substitution can be used.

[0040] In some implementations, amino acid substitution can be substitution to similar amino acids (similarity substitution). In this specification, unless otherwise specified, substitution to similar amino acids refers to substitutions to amino acids that are evaluated as positive or neutral (0) in the amino acid substitution matrix used in the ClustalW software and Blosum62 algorithm (e.g., see S. Heinkoff and JG Henikoff, Proc. Natl. Acad. Sci. USA, Vol. 89, pp. 10915-10919, 1992, particularly Figure 2 therein and Thompson, Nucleic Acid Research, 1994, Vol. 22, No. 22, pp. 4673-4680). This matrix is ​​generated from approximately 2000 aligned sequence segments of more than 500 related proteins. Furthermore, even starting from a single matrix, even using a subset of the proteome, approximately the same scores can be achieved through repeated application. Therefore, this substitution matrix is ​​considered to be universal. This is the most widely used method, which takes advantage of the evolutionary correlation of homologous sequences. Therefore, a variant resulting from the introduction of a similar substitution into a factor C is likely to be active.

[0041] In some embodiments, the conserved amino acid substitutions or substitutions by functionally similar amino acids are not located in regions important to enzyme function, such as the enzyme's active site, matrix recognition site, coenzyme recognition motif, and their vicinity; therefore, they do not significantly affect enzyme activity. In other embodiments, although the conserved amino acid substitutions or substitutions by functionally similar amino acids are located in the enzyme's active site, matrix recognition site, coenzyme recognition motif, and their vicinity, they have essentially no impact on enzyme activity.

[0042] The recombinant Factor C may include the deletion of amino acids compared to its original sequence. In typical embodiments, the amino acid deletion is not located in regions important to enzyme function and therefore does not significantly affect enzyme activity. In some embodiments, the deletion may be a short deletion of 1 to 2 amino acids. In some embodiments, when comparing the amino acid sequences of one Factor C with those of other Factor Cs, if an amino acid is missing in one sequence, that deletion can be introduced into the other Factor C. Since both Factor Cs exhibit activity, such a deletion is unlikely to significantly affect enzyme activity.

[0043] Recombinant Factor C may also include cases where additional amino acids are inserted compared to the pre-mutated sequence. In typical embodiments, the amino acid insertion is not located in regions important to enzyme function, such as the active site, matrix recognition site, coenzyme recognition motif, or their vicinity, and therefore does not significantly affect enzyme activity. In some embodiments, the insertion can be 1 to 4 amino acids. In some embodiments, if an amino acid insertion is found in one Factor C sequence when comparing it with the amino acid sequences of other Factor C sequences, the inserted amino acid can be introduced into the other Factor C. Since both Factor C sequences exhibit activity, such an insertion is unlikely to significantly affect enzyme activity.

[0044] Examples of amino acid insertions can be given. For instance, when comparing sequence number 3 with Factor C from other sources, only one amino acid (lysine) is present at position 433 between positions 432 and 434 of sequence number 3, while two amino acids are present at the corresponding position in Factor C from the other source. Therefore, it is believed that even if any single amino acid is inserted between positions 432 and 434 of sequence number 3, it is unlikely to significantly affect the enzyme activity.

[0045] Recombinant Factor C may also include cases where additional amino acids have been added compared to the pre-mutated sequence. In typical embodiments, the amino acid addition is performed at the N-terminus or C-terminus of Factor C without significantly affecting enzyme activity. In some embodiments, 1 to 6 amino acids, 1 to 5 amino acids, or for example, 1 to 4 amino acids may be added. Examples of addition include short segments of histidine residues (e.g., 2 to 6 histidine residues) used to assist in the purification of Factor C, but this is not a limitation. Furthermore, examples of addition include the addition of a signal peptide to assist in the expression of Factor C, but this is not a limitation. Known signal sequences or their functional equivalents may be cited as examples of signal peptides.

[0046] Mutations in Factor C can be introduced in a manner that does not disrupt two-dimensional structures and structural motifs such as α-helical structures and β-sheet structures. Regions of two-dimensional structures can be determined using, for example, two-dimensional structure prediction algorithms. Examples of such prediction algorithms include NetSurfP-2.0, but are not limited to this. The same applies to other structural motifs such as nests and niches. Factor C has an EGF-like domain, three Sushi domains, one LCCL domain, one C-type lectin domain, two other Sushi domains, and a trypsin domain from its N-terminus to its C-terminus. Mutations in Factor C can be introduced in a manner that does not disrupt these domains and higher-order structures.

[0047] Unless otherwise specified, the amino acid residues or amino acid sequence motifs essential for the activity of Factor C are not substituted. In certain embodiments, although conserved or similar amino acid substitutions can be made at these positions, activity is confirmed for the substituted variants. Unless otherwise specified, amino acid deletions or insertions are not made before or after the amino acid residues essential for the activity of Factor C. The positions before or after the amino acid residues essential for the activity of Factor C refer to one or two positions closer to the N-terminus or one or two positions closer to the C-terminus than the essential amino acid residue. In certain embodiments, although amino acid deletions or insertions can be made before or after the amino acid residues essential for the activity of Factor C, activity is confirmed for the substituted variants in such cases. The activity of the variant can be routinely confirmed, for example, by high-throughput screening.

[0048] Factor C possesses a catalytic triplet composed of serine, histidine, and aspartic acid (or glutamic acid). In Serial No. 3, serine at position 966, histidine at position 809, and aspartic acid at position 865 constitute the catalytic triplet. The amino-terminal amino acid of Factor C participates in endotoxin recognition. In Serial No. 3, arginine at position 1 participates in endotoxin recognition. Factor C possesses an endotoxin-recognizing motif, namely the arginine-tryptophan-arginine motif (RWR). In Serial No. 3, arginine at positions 61, 62, and 63 constitute the endotoxin-recognizing motif. In this disclosure, these positions are not modified unless otherwise specified. In certain embodiments, although these positions can be modified, activity is confirmed for the modified variants. In certain embodiments, the amino-terminal amino acid can be either lysine or arginine. One or both arginines in the arginine-tryptophan-arginine motif (RWR) can be replaced with lysine, or tryptophan can be replaced with tyrosine or phenylalanine. Additionally, positions 1-25 of Factor C are removed in the mature protein and are considered the signal sequence, which is cleaved during Factor C production. In sequence number 3, methionine at position 1 through serine at position 25 constitute the signal sequence.

[0049] In some embodiments, the recombinant Factor C of this disclosure has Factor C activity. The presence or absence of Factor C activity can be determined according to, for example, the method described in the embodiments.

[0050] (Polynucleotides) In some embodiments, this disclosure provides a polynucleotide encoding recombinant Factor C (hereinafter also referred to as the "recombinant Factor C gene"). The sequence of the polynucleotide can be readily determined based on the amino acid sequence of recombinant Factor C. For example, the polynucleotide encoding the amino acid sequence of sequence number 3 could be the polynucleotide of sequence number 4, but is not limited thereto.

[0051] In some implementations, the polynucleotide encoding recombinant Factor C may include, for example, (i) The nucleotide sequence encoding active Factor C has, in terms of full length, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, more preferably 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more of sequence identity with respect to the nucleotide sequence of sequence number 4; (ii) In the nucleotide sequence of sequence number 4, one or more nucleotides are substituted, deleted, or added to encode the nucleotide sequence of active factor C; or (iii) Select the nucleotide sequence of the group consisting of sequence number 4.

[0052] To obtain the nucleotides encoding these Factor Cs, common gene cloning methods are typically used. For example, chromosomal DNA or mRNA can be extracted from tissues or cells of horseshoe crabs capable of producing Factor C using conventional methods. Furthermore, cDNA can be synthesized using the mRNA as a template. Using the obtained chromosomal DNA or cDNA, libraries of chromosomal DNA or cDNA can be created.

[0053] Next, based on the amino acid sequence of Factor C, a suitable probe DNA is synthesized. Using this probe DNA, a polynucleotide encoding Factor C is selected from a library of chromosomal DNA or cDNA. Alternatively, based on the amino acid sequence, a suitable primer DNA is prepared. The DNA containing the target nucleotide fragment encoding Factor C is amplified by a suitable polymerase chain reaction (PCR) method, such as 5'RACE or 3'RACE. By ligating these DNA fragments, a full-length DNA containing the nucleotide encoding the target Factor C can be obtained.

[0054] Given that the nucleotide sequence encoding Factor C is known, this nucleotide sequence can be artificially synthesized. Such artificial gene synthesis services are provided by companies such as Integrated DNA Technologies.

[0055] (Method for creating the Factor C gene) The modification of the Factor C gene can be carried out by any known method corresponding to the desired variant. That is, methods that can be widely used include: contacting and acting an agent as a mutagen with DNA integrated with the Factor C gene or a recombinant of the gene; ultraviolet irradiation; genetic engineering methods; or methods that drive protein engineering methods, etc.

[0056] Examples of agents that can be used as mutagens for the above-mentioned mutation treatments include hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine, nitrite, sulfurous acid, hydrazine, formic acid, or 5-bromouracil.

[0057] The conditions for contact and action can be tailored to the type of reagent used, and are not particularly limited as long as they can actually induce the desired mutation in the Factor C gene. Generally, contact and action at a reagent concentration of 0.5–12 M and a reaction temperature of 20–80°C for at least 10 minutes, preferably 10–180 minutes, is preferred to induce the desired mutation. Even under ultraviolet irradiation, the conventional method can be followed as described above.

[0058] As a driving force for protein engineering, a method called site-specific mutagenesis can generally be used.

[0059] In addition to the gene modification methods mentioned above, the desired modified Factor C gene can also be directly synthesized through organic synthesis or enzyme synthesis.

[0060] The base sequence of the Factor C gene can be confirmed, for example, using the AppliedBiosystems 3730xl DNA analyzer (made by Thermo Fisher Scientific).

[0061] (Vector, host cell) In some embodiments, this disclosure relates to vectors containing the aforementioned polynucleotides. Operationally, these Factor C genes are preferably ligated into various vectors using conventional methods. Examples of vectors include plasmids, but other vectors such as phages, granules, and any other vector known to those skilled in the art can also be used. The type of vector can be selected based on the host cell; specifically, for example, pET16-b or pkk223-3 are preferred.

[0062] In some embodiments, this disclosure relates to host cells containing the aforementioned polynucleotides or vectors. The host cell is not limited to any particular type and may be bacteria such as Escherichia coli and Bacillus subtilis, yeast cells, insect cells, animal cells (e.g., mammalian cells), or plant cells, with bacterial cells such as Escherichia coli being preferred.

[0063] (Transformation and transduction) The Factor C gene obtained as described above is integrated into vectors such as bacteriophages, granules, or plasmids for prokaryotic or eukaryotic cell transformation using conventional methods. Transformation is then performed on the host corresponding to each vector using conventional methods. For example, using microorganisms belonging to the genus *Escherichia coli*, such as the obtained recombinant DNA, as hosts, transformation or transduction can be performed on strains such as *E. coli* k-12 or *E. coli* B, preferably *E. coli* JM109, *E. coli* DH5α, *E. coli* BL21, and *E. coli* BL21(DE3), resulting in different strains. As a method for transferring the recombinant vector into such host cells, for example, when the host cell is a microorganism belonging to *Escherichia coli*, a method for transferring recombinant DNA in the presence of calcium ions can be used. Electroporation can also be further used. Furthermore, the Factor C gene may have undergone codon optimization based on the expression host.

[0064] (The production method of recombinant Factor C) In some embodiments, this disclosure relates to a method for producing recombinant Factor C, including a step of culturing the aforementioned host cells. Culturing can be carried out by various known methods, including solid-state culture, preferably liquid culture.

[0065] The production method may include: a step of culturing the host cells under conditions capable of expressing recombinant Factor C protein; and an arbitrary step of isolating recombinant Factor C from the culture or culture medium. The conditions for expressing recombinant Factor C protein refer to the transcription and translation of the Factor C gene to produce a polypeptide encoded by that gene.

[0066] In addition, as a culture medium for culturing the aforementioned host cells, a culture medium obtained as follows is used: when using eukaryotic cells such as yeast or fungi, one or more inorganic salts such as sodium chloride, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, magnesium sulfate, magnesium chloride, ferric chloride, ferric sulfate, or manganese sulfate are added to one or more nitrogen sources such as yeast extract, tryptone, peptone, meat extract, corn extract, or soybean or wheat bran extract, and sugar raw materials, vitamins, etc. are added as needed to obtain the culture medium.

[0067] When using mammalian cells as host cells, commonly used culture media for mammalian cells can be used, such as DMEM medium (Sigma), RPMI 1640 medium (Sigma), and ExpiCHO™ Expression Medium (Thermo Fisher Scientific). Mammalian cells can be cultured at, for example, 35°C to 38°C or 36°C to 38°C with a supply of 5% to 8% CO2, through static or suspension culture.

[0068] When using insect cells as host cells, commonly used insect cell culture media can be used, such as Sf-900 (trademark) medium (Thermo Fisher Scientific), Sf-900 (trademark) II medium (Thermo Fisher Scientific), Sf-900 (trademark) III medium (Thermo Fisher Scientific), Gibco (trademark) TC-100 insect medium (Thermo Fisher Scientific), Schneider's insect medium (Sigma-Aldrich), Grace's insect medium (Sigma-Aldrich), TNM-FH insect medium (Sigma-Aldrich), and Express Five (trademark) SFM medium (Thermo Fisher Scientific). Commonly used insect cells for recombinant protein expression include IPLB-Sf9, IPLB-Sf21, IPLB-SF+, High-Five (trademark), Schneider S2, and BmN, but are not limited to these. Well-known cell lines can be used, such as those from silkworms (Bombyx mori), cabbage moths (Mamestrabrassicae), fall armyworms (Spodoptera frugiperda), white-spotted moths (Trichoplusia ni), and Drosophila melanogaster, such as cell lines from Drosophila embryos or from silkworm embryos.

[0069] There are no particular restrictions on the culture conditions for insect cells; commonly used conditions for insect cell culture can be used. Furthermore, these commonly used conditions can be appropriately modified. Culture can be carried out at, for example, 25–30°C, 26–29°C, or 27–28°C, by shaking or static incubation.

[0070] There are no particular limitations on the methods used to express proteins using insect cells as hosts; common methods for recombinant protein expression can be employed. For example, insect cells can be infected with viruses that integrate genes encoding the target protein. Examples of viruses used for insect cell transformation include well-known viruses such as baculoviruses, nucleopolyhedroviruses (NPVs), AcNPV (Autographa californica NPV), and BmNPV (Bombix mori NPV). Nucleic acids can be introduced into viruses using conventional methods, such as homologous recombination using transfer vectors. Examples of transfer vectors include pPSC8 (ProteinSciences), pVL1393 (Pharmingen), and pFastBac (Invitrogen). Furthermore, recombinant proteins can be expressed by introducing a vector integrating a gene encoding the target protein into insect cells and integrating that gene onto the host chromosome. Examples of suitable vectors include, but are not limited to, any well-known insect vectors such as the pAc series, pVL series, pIZ series, pIZ / V5-His vector (Thermo Fisher Scientific), or pIZT / V5-His vector (Thermo Fisher Scientific).

[0071] When using eukaryotic cells such as yeast or fungi as the host, an initial pH adjustment of the culture medium to pH 7-9 is appropriate. When using eukaryotic cells such as yeast or fungi, culture is preferably carried out at a temperature of 20-42°C, preferably around 25-37°C, for 4-24 hours using methods such as aerated and stirred submerged culture, shaking culture, and static culture; more preferably, culture is carried out at a temperature around 25-37°C for 8-16 hours using methods such as aerated and stirred submerged culture, shaking culture, and static culture. Examples of yeasts include those belonging to the genera *Zygosaccharomyces*, *Saccharomyces*, *Pichia*, and *Candida*. Examples of fungi include those belonging to the genera *Aspergillus* or *Tricoderma*. Examples of plant cells include plant cells transformed with *Agrobacterium*. Examples of mammalian cells include CHO and HEK293.

[0072] After culturing, Factor C can be collected from the culture using common enzyme collection methods. When using eukaryotic cells such as yeast or fungi, the cells can be ultrasonically destroyed or ground using conventional methods; the enzyme can be extracted using lysozymes such as cell wall enzymes; or lysed by shaking or placing the cells in the presence of toluene to release the enzyme outside the cells. The solution can then be filtered, centrifuged to remove the solid portion, and, if necessary, nucleic acids can be removed using streptomycin sulfate, protamine sulfate, or manganese sulfate. After adding ammonium sulfate, alcohol, acetone, etc., the solution can be fractionated, and the precipitate collected to obtain crude Factor C. When using mammalian or insect cells, the culture medium, culture supernatant, or cell fragment extract obtained by disrupting the cells using conventional methods can be used. Sometimes nucleic acids can be removed, and sometimes precipitation operations such as ammonium sulfate precipitation can be performed to obtain crude Factor C.

[0073] To further refine Factor C enzyme from the crude Factor C enzyme described above, various methods can be employed, such as gel filtration using dextran gel, Superdex, or supergel; adsorption-dissolution using ion exchange carriers, hydrophobic carriers, or hydroxyapatite; electrophoresis using polyacrylamide gels; sedimentation methods such as sucrose density gradient centrifugation; affinity chromatography; and fractionation using molecular sieve membranes or hollow fiber membranes, or combinations thereof. These methods can yield refined Factor C enzyme. In this way, the desired Factor C can be obtained. Factor C can be cleaved into sugar chains or used directly without such cleavage.

[0074] The produced Factor C can be used in the endotoxin detection reagents or methods for detecting endotoxins described in this specification. If the produced Factor C has relatively high heat resistance, the storage properties of this enzyme are relatively improved, which can facilitate the production of detection reagents and kits that are superior to existing Factor C in terms of both distribution and storage.

[0075] (Endotoxin test reagent) In some embodiments, this disclosure provides an endotoxin detection reagent comprising recombinant Factor C. In addition to recombinant Factor C, the endotoxin detection reagent may also contain other components commonly found in existing reagents, such as buffers, stabilizers, and synthetic matrices. The form of the reagent is not particularly limited, and examples include, for example, lyophilized powder or liquid reagents.

[0076] When a sample contains endotoxins, Factor C is converted by the endotoxins into activating Factor C. Activating Factor C can hydrolyze the labeled peptide matrix. The hydrolyzed label can be detected by turbidimetric methods, chromogenic matrix methods, fluorescent matrix methods, and luminescent matrix methods. Therefore, endotoxins in the sample can be detected.

[0077] Endotoxins can be any substance, whether natural or chemically synthesized, as long as they are recognized as a matrix by the Factor C used. Furthermore, any known endotoxin derivative can also be used.

[0078] In some embodiments, this disclosure provides an endotoxin detection kit. The endotoxin detection kit may include endotoxin detection reagents and, if necessary, instructions for use, standard substances, syringes, needles, specimen sampling equipment, etc.

[0079] (Methods for detecting endotoxins) In some embodiments, this disclosure relates to a method for detecting endotoxins, including the use of recombinant Factor C. The method may include: a step of contacting a sample with recombinant Factor C; and a step of detecting a marker generated from a synthetic matrix.

[0080] In some embodiments, the recombinant Factor C protein having the sequence of Serial Number 3, or the recombinant Factor C protein having an amino acid sequence identity of 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 95.5% or more, 96% or more, 96.5% or more, 97% or more, 97.5% or more, 98% or more, 98.5% or more, 99% or more, or 99.5% or more, with 99% or more amino acid sequence identity, may further have amino acid substitutions. Examples of positions where amino acids may be substituted include, but are not limited to, positions corresponding to positions 423, 557, 669, 970, 973, 425, 605, 832, 833, 842, 876, 897, 914, 930, 955, 977, and 1013 of Serial Number 3. Recombinant Factor C variants having one or more of these amino acid substitutions can have amino acid sequence identity with Serial No. 3 of 79% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, for example 95% or more, 95.5% or more, 96% or more, 96.5% or more, 97% or more, 97.5% or more, 98% or more, 98.5% or more, 99% or more, or 99.5% or more.

[0081] In some embodiments, recombinant Factor C may have the following amino acid substitutions, but the substituted amino acids are not limited to these. For convenience, a variant having any of the following variations is sometimes referred to as the single mutant Mon.

[0082] [Table 1]

[0083] (Multiple variants) In some embodiments, the recombinant Factor C may have 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, for example 16 or more, for example 17 of the above-mentioned amino acid substitutions.

[0084] In some embodiments, recombinant Factor C may have the following amino acid substitutions. The parentheses indicate that any one of the amino acids can be substituted. For example, "S973(V,I,L)" means that the position corresponding to position 973 of sequence number 3 can be Val, Ile, or Leu.

[0085] [Dou, the Dual Mutant] L970(A,V) / F557(L), L970(A,V) / F669(Y), L970(A,V) / S973(V,I,L), L970(A,V) / W832(F), L970(A,V) / K897Q, L970 (A,V) / S930(D,E,K)、F557(L) / F669(Y)、F557(L) / S973(V,I,L)、F557(L) / W832(F)、F557(L) / K897Q、F557(L) / S930 (D,E,K), F669(Y) / S973(V,I,L), F669(Y) / W832(F), F669(Y) / K897Q, F669(Y) / S930(D,E,K), S973(V,I,L) / W832(F ), S973(V,I,L) / K897Q, S973(V,I,L) / S930(D,E,K), W832(F) / K897Q, W832(F) / S930(D,E,K), K897Q / S930(D,E,K).

[0086] [Triple Mutant] L970(A,V) / F557(L) / F669(Y), L970(A,V) / F557(L) / S973(V,I,L), L970(A,V) / F557(L) / W832(F), L970(A,V) / F557(L) / K897Q, L970(A,V) / F557(L) / S930(D,E,K), F557(L) / F669(Y) / S973(V,I,L), F557(L) / F669(Y) / W832(F), F557(L) / F669(Y) / K897Q, F557(L) / F669(Y) / S930(D,E,K), F669(Y) / S973(V,I,L) / W832(F), F669(Y) / S973(V,I,L) / K897Q, F669(Y) / S973(V,I,L) / S930(D,E,K), S973(V,I,L) / W832(F) / K897Q, S973(V,I,L) / W832(F) / S930(D,E,K), W832(F) / K897Q / S930(D,E,K).

[0087] [Quadruple mutant Qua] L970(A,V) / F557(L) / F669(Y) / S973(V,I,L), L970(A,V) / F557(L) / F669(Y) / W832(F), L970(A,V) / F557(L) / F669(Y) / K897Q, L970(A,V) / F557(L) / F669(Y) / S930(D,E,K), F557(L) / F669(Y) / S973(V,I,L) / W832(F), F557(L) / F669(Y) / S973(V,I,L) / K897Q, F557(L) / F669(Y) / S973(V,I,L) / S930(D,E,K), F669(Y) / S973(V,I,L) / W832(F) / K897Q, F669(Y) / S973(V,I,L) / W832(F) / S930(D,E,K), S973(V,I,L) / W832(F) / K897Q / S930(D,E,K).

[0088] [Quintuple mutant Pen] L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / W832(F), L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / K897Q, L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / S930(D,E,K), L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y425(F), L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y605(F), L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y833(F), L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K), L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / A876(R), L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / T914(R), L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / K955(E), L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / R977(E), L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / S1013(D), F557(L) / F669(Y) / S973(V,I,L) / W832(F) / K897Q, F557(L) / F669(Y) / S973(V,I,L) / W832(F) / S930(D,E,K), F669(Y) / S973(V,I,L) / W832(F) / K897Q / S930(D,E,K).

[0089] [Six - mutant Hex] L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / W832(F) / K897Q, L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / W832(F) / S930(D,E,K), L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / W832(F) / A876(R), L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / W832(F) / Y842(K), L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / K897Q / A876(R)、 L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / K897Q / Y842(K)ぁ L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / S930(D,E,K) / A876(R)、 L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / Y425(F)、 L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / Y605(F)、 L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / Y833(F) L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / Y842(K)ぁ L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R)、 L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / T914(R)、 L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / K955(E)ぁ L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / R977(E)ぁ L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / S1013(D)ぁ F557(L) / F669(Y) / S973(V,I,L) / W832(F) / K897Q / S930(D,E,K)ぁ F557(L) / F669(Y) / S973(V,I,L) / W832(F) / K897Q / A876(R)、 F557(L) / F669(Y) / S973(V,I,L) / W832(F) / K897Q / K897Qぁ F557(L) / F669(Y) / S973(V,I,L) / W832(F) / K897Q / S930(D,E,K), F557(L) / F669(Y) / S973(V,I,L) / W832(F) / K897Q / K955(E), F557(L) / F669(Y) / S973(V,I,L) / W832(F) / K897Q / R977(E), F557(L) / F669(Y) / S973(V,I,L) / W832(F) / K897Q / S1013(D).

[0090] [Seven - variant Hep] L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / W832(F) / K897Q / S930(D,E,K), L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / R977(E), L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / S1013(D), L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / K897Q, L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / S930(D,E,K), L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / K955(E), L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / W832(F), L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / Y425(F), L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / Y605(F), L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / Y833(F). L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / T914(R). L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / R977(E) . L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / S1013(D) . F557(L) / F669(Y) / S973(V,I,L) / W832(F) / K897Q / S930(D,E,K) / R977(E) F557(L) / F669(Y) / S973(V,I,L) / W832(F) / K897Q / S930(D,E,K) / S1013(D). F557(L) / F669(Y) / S973(V,I,L) / W832(F) / K897Q / S930(D,E,K) / K955(E) F557(L) / F669(Y) / S973(V,I,L) / W832(F) / K897Q / S930(D,E,K) / Y425(F). F557(L) / F669(Y) / S973(V,I,L) / W832(F) / K897Q / S930(D,E,K) / Y605(F). F557(L) / F669(Y) / S973(V,I,L) / W832(F) / K897Q / S930(D,E,K) / Y833(F). F557(L) / F669(Y) / S973(V,I,L) / W832(F) / K897Q / S930(D,E,K) / T914(R). F557(L) / F669(Y) / S973(V,I,L) / W832(F) / K897Q / S930(D,E,K) / R977(E) [United States Oct] L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / R977(E) / S1013(D) . L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / R977(E) / K897Q、 L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / R977(E) / S930(D,E,K)、 L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / R977(E) / K955(E)、 L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / R977(E) / W832(F)、 L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / R977(E) / Y425(F)、 L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / R977(E) / Y605(F)、 L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / R977(E) / Y833(F)、 L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / R977(E) / T914(R)、 L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / S1013(D) / K897Q、 L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / S1013(D) / S930(D,E,K)、 L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / S1013(D) / K955(E)、 L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / S1013(D) / W832(F)、 L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / S1013(D) / Y425(F)、 L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / S1013(D) / Y605(F)、 L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / S1013(D) / Y833(F)、 L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / S1013(D) / T914(R)、 F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / R977(E) / S1013(D) / K897Q、 F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / R977(E) / S1013(D) / S930(D,E,K)、 F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / R977(E) / S1013(D) / K955(E)、 [九重变异体Non] L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / R977(E) / S1013(D) / K897Q、 L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / R977(E) / S1013(D) / S930(D,E,K)、 L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / R977(E) / S1013(D) / K955(E)、 L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / R977(E) / S1013(D) / W832(F), L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / R977(E) / S1013(D) / Y425(F), L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / R977(E) / S1013(D) / Y605(F), L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / R977(E) / S1013(D) / Y833(F), L970(A,V) / F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / R977(E) / S1013(D) / T914(R), F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / R977(E) / S1013(D) / K897Q / S930(D,E,K), F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / R977(E) / S1013(D) / K897Q / K955(E), F557(L) / F669(Y) / S973(V,I,L) / Y842(K) / A876(R) / R977(E) / S1013(D) / S930(D,E,K) / K955(E).

[0091] For convenience, the set of the above variants can be referred to as set S-1.

[0092] [Mathematical Expression 1]

[0093] In some embodiments, recombinant Factor C may have the following amino acid substitutions. The amino acids in parentheses are arbitrary.

[0094] [Single mutant Mon-2] F423(L), Y425(F), Y605(F), Y833(F), Y842(K), A876(R), T914(R), K955(E), R977(E), S1013(D).

[0095] [Double mutant Dou-2] F423(L) / Y425(F), F423(L) / Y833(F), F423(L) / Y842(K), F423(L) / A876(R), F423(L) / T914(R), F423(L) / K955(E), F423(L) / R977(E), F423(L) / S1013(D), Y425(F) / Y833(F), Y425(F) / Y842(K), Y425(F) / A876(R), Y425(F) / T914(R), Y425(F) / K955(E), Y425(F) / R977(E), Y425(F) / S1013(D), Y833(F) / Y842(K), Y833(F) / A876(R), Y833(F) / T914(R), Y833(F) / K955(E), Y833(F) / R977(E), Y833(F) / S1013(D), Y842(K) / A876(R), Y842(K) / T914(R), Y842(K) / K955(E), Y842(K) / R977(E), Y842(K) / S1013(D), A876(R) / T914(R), A876(R) / K955(E), A876(R) / R977(E), A876(R) / S1013(D), T914(R) / K955(E), T914(R) / R977(E), T914(R) / S1013(D), K955(E) / R977(E), K955(E) / S1013(D), R977(E) / S1013(D).

[0096] [Triple mutant Tri-2] F423(L) / Y425(F) / Y833(F), F423(L) / Y425(F) / Y842(K), F423(L) / Y425(F) / A876(R), F423(L) / Y425(F) / T914(R), F423(L) / Y425(F) / K955(E), F423(L) / Y425(F) / R977(E), F423(L) / Y425(F) / S1013(D), Y425(F) / Y833(F) / Y842(K), Y425(F) / Y833(F) / A876(R), Y425(F) / Y833(F) / T914(R), Y425(F) / Y833(F) / K955(E), Y425(F) / Y833(F) / R977(E), Y425(F) / Y833(F) / S1013(D), Y833(F) / Y842(K) / A876(R), Y833(F) / Y842(K) / T914(R), Y833(F) / Y842(K) / K955(E), Y833(F) / Y842(K) / R977(E), Y833(F) / Y842(K) / S1013(D), Y842(K) / A876(R) / T914(R), Y842(K) / A876(R) / K955(E), Y842(K) / A876(R) / R977(E), Y842(K) / A876(R) / S1013(D), A876(R) / T914(R) / K955(E), A876(R) / T914(R) / R977(E), A876(R) / T914(R) / S1013(D), T914(R) / K955(E) / R977(E), T914(R) / K955(E) / S1013(D), K955(E) / R977(E) / S1013(D).

[0097] [四重变异体Qua - 2] F423(L) / Y425(F) / Y833(F) / Y842(K), F423(L) / Y425(F) / Y833(F) / A876(R), F423(L) / Y425(F) / Y833(F) / T914(R), F423(L) / Y425(F) / Y833(F) / K955(E), F423(L) / Y425(F) / Y833(F) / R977(E), F423(L) / Y425(F) / Y833(F) / S1013(D), Y425(F) / Y833(F) / Y842(K) / A876(R), Y425(F) / Y833(F) / Y842(K) / T914(R), Y425(F) / Y833(F) / Y842(K) / K955(E), Y425(F) / Y833(F) / Y842(K) / R977(E), Y425(F) / Y833(F) / Y842(K) / S1013(D), Y833(F) / Y842(K) / A876(R) / T914(R), Y833(F) / Y842(K) / A876(R) / K955(E), Y833(F) / Y842(K) / A876(R) / R977(E), Y833(F) / Y842(K) / A876(R) / S1013(D), Y842(K) / A876(R) / T914(R) / K955(E), Y842(K) / A876(R) / T914(R) / R977(E), Y842(K) / A876(R) / T914(R) / S1013(D), A876(R) / T914(R) / K955(E) / R977(E), A876(R) / T914(R) / K955(E) / S1013(D), T914(R) / K955(E) / R977(E) / S1013(D).

[0098] [Quintuple mutant Pen-2] F423(L) / Y425(F) / Y833(F) / Y842(K) / A876(R), F423(L) / Y425(F) / Y833(F) / Y842(K) / T914(R), F423(L) / Y425(F) / Y833(F) / Y842(K) / K955(E), F423(L) / Y425(F) / Y833(F) / Y842(K) / R977(E), F423(L) / Y425(F) / Y833(F) / Y842(K) / S1013(D), Y425(F) / Y833(F) / Y842(K) / A876(R) / T914(R), Y425(F) / Y833(F) / Y842(K) / A876(R) / K955(E), Y425(F) / Y833(F) / Y842(K) / A876(R) / R977(E), Y425(F) / Y833(F) / Y842(K) / A876(R) / S1013(D), Y833(F) / Y842(K) / A876(R) / T914(R) / K955(E), Y833(F) / Y842(K) / A876(R) / T914(R) / R977(E), Y833(F) / Y842(K) / A876(R) / T914(R) / S1013(D), Y842(K) / A876(R) / T914(R) / K955(E) / R977(E), Y842(K) / A876(R) / T914(R) / K955(E) / S1013(D), A876(R) / T914(R) / K955(E) / R977(E) / S1013(D).

[0099] [Hex-2 Hexa-variant] F423(L) / Y425(F) / Y833(F) / Y842(K) / A876(R) / T914(R), F423(L) / Y425(F) / Y833(F) / Y842(K) / A876(R) / K955(E), F423(L) / Y425(F) / Y833(F) / Y842(K) / A876(R) / R977(E), F423(L) / Y425(F) / Y833(F) / Y842(K) / A876(R) / S1013(D), Y425(F) / Y833(F) / Y842(K) / A876(R) / T914(R) / K955(E), Y425(F) / Y833(F) / Y842(K) / A876(R) / T914(R) / R977(E), Y425(F) / Y833(F) / Y842(K) / A876(R) / T914(R) / S1013(D), Y833(F) / Y842(K) / A876(R) / T914(R) / K955(E) / R977(E), Y833(F) / Y842(K) / A876(R) / T914(R) / K955(E) / S1013(D), Y842(K) / A876(R) / T914(R) / K955(E) / R977(E) / S1013(D).

[0100] [Seven - variant Hep - 2] F423(L) / Y425(F) / Y833(F) / Y842(K) / A876(R) / T914(R) / K955(E), F423(L) / Y425(F) / Y833(F) / Y842(K) / A876(R) / T914(R) / R977(E), F423(L) / Y425(F) / Y833(F) / Y842(K) / A876(R) / T914(R) / S1013(D), Y425(F) / Y833(F) / Y842(K) / A876(R) / T914(R) / K955(E) / R977(E), Y425(F) / Y833(F) / Y842(K) / A876(R) / T914(R) / K955(E) / S1013(D), Y833(F) / Y842(K) / A876(R) / T914(R) / K955(E) / R977(E) / S1013(D).

[0101] [Eight - variant Oct - 2] F423(L) / Y425(F) / Y833(F) / Y842(K) / A876(R) / T914(R) / K955(E) / R977(E), F423(L) / Y425(F) / Y833(F) / Y842(K) / A 876(R) / T914(R) / K955(E) / S1013(D), Y425(F) / Y833(F) / Y842(K) / A876(R) / T914(R) / K955(E) / R977(E) / S1013(D).

[0102] [Nine-fold Mutant Non-2] F423(L) / Y425(F) / Y833(F) / Y842(K) / A876(R) / T914(R) / K955(E) / R977(E) / S1013(D).

[0103] For convenience, the set of the above variants will be referred to as set S-2.

[0104] [Mathematical Expression 2]

[0105] In some embodiments, recombinant Factor C can have any combination of variations from sets S-1 and S-2. For convenience, such variants are referred to as set S-3. In some embodiments, recombinant Factor C variants based on recombinant Factor C variants included in sets S-1, S-2, or S-3 can have more than one reversion variant (wherein the number of reversion variants does not exceed the number of introduced amino acid substitutions). A reversion variant is a variant that introduces a variant at the position of an introduced amino acid substitution, reverting it to the amino acid state before the substitution. For convenience, the set of such reversion variants is referred to as set S-4.

[0106] The recombinant Factor C variants included in sets S-1, S-2, S-3, or S-4 may be variants with improved thermostability compared to the original recombinant Factor C. In this specification, they are sometimes referred to as thermostability-enhanced variants. The recombinant Factor C variants included in sets S-1, S-2, S-3, or S-4 are limited, and their thermostability can be confirmed by those skilled in the art through conventional verification procedures. In some embodiments, this disclosure provides recombinant Factor C protein variants having the variants included in sets S-1, S-2, S-3, or S-4, and having an amino acid sequence identity of 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, for example, 95% or more, 95.5% or more, 96% or more, 96.5% or more, 97% or more, 97.5% or more, 98% or more, 98.5% or more, 99% or more, or 99.5% or more with sequence number 3.

[0107] In this specification, "thermal stability" can be used as an indicator to evaluate, for example, the residual activity of Factor C after heat treatment at a specified temperature for a specified time. Specifically, the thermal stability of Factor C can be evaluated by comparing the residual activity rate after heat treatment at high temperatures, such as 30~56°C, 35~55°C, 40~50°C, 42~49°C, and 45~49°C for a certain time, such as 5~120 minutes, 10~60 minutes, and 15~30 minutes.

[0108] The residual activity of Factor C refers to the activity after heat treatment when the Factor C activity before treatment under the aforementioned high-temperature conditions is set to 1. For example, if the residual activity after heat treatment is halved, the residual activity after heat treatment is 0.5 relative to the activity of 1 before heat treatment. The residual activity rate of Factor C is calculated as the ratio of the activity after heat treatment to the Factor C activity before treatment under the aforementioned high-temperature conditions. In this specification, improved thermal stability means that the residual activity rate of the Factor C variant after treatment under the aforementioned conditions shows an improvement of 1.01 times or more, 1.02 times or more, 1.05 times or more, 1.1 times or more, 1.2 times or more, 1.3 times or more, 1.4 times or more, 1.5 times or more, 1.6 times or more, 1.7 times or more, 1.8 times or more, 1.9 times or more, or 2 times or more. In other words, in this specification, improved thermal stability means that the residual activity of the Factor C variant after being subjected to the above conditions is improved by more than 1%, 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% compared to the residual activity of Factor C before the introduction of the variant into this disclosure.

[0109] In some implementations, Factor C may have an amino acid sequence selected from the group consisting of: (i) An amino acid sequence that has an amino acid sequence identity of more than 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, or 99.5% compared with sequence number 3; (ii) The amino acid sequence of sequence number 3; or (iii) Regarding the amino acid sequence of (i) or (ii), it also has a variant amino acid sequence contained in one or more sets S-1, S-2, S-3 or S-4, for example, having the following substituted amino acid sequences: the position corresponding to F423 of sequence number 3 is substituted with Leu; the position corresponding to F557 is substituted with Leu; the position corresponding to F669 is substituted with Try; the position corresponding to L970 is substituted with Ala or Val; the position corresponding to S973 is substituted with Val, Ile or Leu; and the position corresponding to Y425 is substituted with Phe. The position corresponding to Y605 is replaced with Phe; the position corresponding to Y832 is replaced with Phe; the position corresponding to Y833 is replaced with Phe; the position corresponding to Y842 is replaced with Lys; the position corresponding to A876 is replaced with Arg; the position corresponding to k897 is replaced with Gln; the position corresponding to T914 is replaced with Arg; the position corresponding to S930 is replaced with Asp, Glu, or Lys; the position corresponding to k955 is replaced with Glu; the position corresponding to R977 is replaced with Glu; and / or the position corresponding to S1013 is replaced with Asp.

[0110] In some embodiments, this disclosure provides Factor C, with its activity before heat treatment as 100%, having a residual activity greater than 67% after heat treatment at 45°C for 30 minutes, for example, 68% or more, 75% or more, 80% or more, 83% or more, 85% or more, 90% or more, 92% or more, 95% or more, or 99% or more. In some embodiments, this disclosure provides Factor C, with its activity before heat treatment as 100%, having a residual activity greater than 3% after heat treatment at 48°C for 30 minutes, for example, 50% or more, 77% or more, 79% or more, 81% or more, 82% or more, 83% or more, 84% or more, 90% or more, 92% or more, 97% or more, 99% or more, 102% or more, 104% or more, or 113% or more. In some embodiments, this disclosure provides Factor C, with 100% activity before heat treatment, and residual activity after heat treatment at 49°C for 30 minutes greater than 62%, for example 63% or more, for example 70% or more, for example 76% or more, for example 77% or more, for example 81% or more, for example 94% or more, for example 103% or more, for example 121% or more.

[0111] The wild-type sequence itself is removed from the recombinant Factor C of this disclosure. Furthermore, natural elements are removed from the recombinant Factor C of this disclosure. In some embodiments, the wild-type sequence and natural elements specified after or following this disclosure are also removed.

[0112] This disclosure enables the preparation of hydrolytic enzymes without relying on horseshoe crab cell lysates. Furthermore, this disclosure enables the detection of endotoxins without relying on horseshoe crab cell lysates. Moreover, this disclosure provides an alternative method to existing recombinant Factor C.

[0113] (Example) The Factor C of this disclosure is further illustrated by the following embodiments. However, these are merely illustrative and the disclosure is not limited thereto.

[0114] [Example 1] (1) Construction of plasmid vector for Factor C expression (1-1) Construction of vector fragments Using pIZT / V5-His (Invitrogen), 1 ng of the vector was mixed with 25 μL of kOD One PCR Master Mix (Toyobo), 1.5 μL of 5 μM forward primer (Sequence No. 1), and 1.5 μL of 5 μM reverse primer (Sequence No. 2). The mixture was then brought to a final volume of 50 μL with ultrapure water for PCR. The PCR conditions were as follows: 98℃ for 10 seconds, 55℃ for 5 seconds, and 68℃ for 20 seconds constituted one cycle, which was repeated 25 times to amplify the fragment.

[0115] Add 2 μL of restriction enzyme DpnI (made by New England Biolabs) to the obtained PCR product, incubate at 37°C for 1 hour, and purify the reaction product using NucleoSpin Gel and PCR Clean-up (made by Macherey-Nagel) to use it as a vector fragment.

[0116] (1-2) Ligation of pIZT / V5 vector with Factor C gene For the base sequence (Sequence No. 4) encoding the amino acid sequence of FCv (Sequence No. 3), IntegratedDNA Technologies was commissioned to add the same sequence as the vector upstream (Sequence No. 5) and downstream (Sequence No. 6) of the ORF for synthesis.

[0117] The insert fragment was dissolved in ultrapure water to a concentration of 50 ng / μL. 1.5 μL of this solution was mixed with 1 μL of the 100 ng / μL vector fragment obtained in (1-1) and 2 μL of 5× In-Fusion Snap Assembly Master Mix (Clontech). The mixture was then brought to a final volume of 10 μL with ultrapure water and reacted at 50 °C for 15 minutes. 5 μL of the resulting In-Fusion reactant was used to transform 50 μL of ECOS (trademark) Competent E. coli JM109 (Japanese Genetics), which was then dispersed on LB agar medium supplemented with 25 μg / mL Zeocin and cultured overnight at 37 °C to obtain the transformant.

[0118] The obtained colonies were transplanted into 2.5 mL of LB liquid medium supplemented with 25 μg / mL Zeocin and multiplied overnight at 37°C and 200 rpm. Plasmids were then prepared using the FastGene Plasmid Mini kit (manufactured by Nippon Genetics). The base sequence was deciphered using DNA sequence analysis from Fasmac, confirming the construction of the Factor C expression plasmid vector (pIZT / V5-FCv). Colonies with confirmed sequences were transplanted into 5 mL of 2TY medium supplemented with 25 μg / mL Zeocin and multiplied overnight at 37°C and 200 rpm. Endotoxin-free plasmids were then prepared using NucleoBond (registered trademark) Xtra Midi EF (manufactured by Macherey-Nagel).

[0119] (2) Factor C's recombinant production (2-1) Culture of insect Sf9 cells Using Sf9 cells in Sf-900 (trademark) II SFM (manufactured by Thermo Fisher Scientific), a series of operations were performed on insect cells in a biosafety cabinet. 25 mL of Sf-900 (trademark) III SFM (manufactured by Thermo Fisher Scientific) was added to a 125 mL Erlenmeyer flask that had been pre-heated to 250°C for 2 hours and incubated at 28°C. Frozen Sf9 vials were rapidly thawed in a 37°C hot water bath until only a small amount of ice remained. After sterilizing the surface of the vials with 70% ethanol, the cells were gently mixed and the total volume was transferred to the aforementioned Erlenmeyer flask. The caps were loosened, and the cells were incubated at 28°C with shaking at 125 rpm.

[0120] Three days later, a portion of the cell culture medium was sampled and mixed with 4% trypan blue solution at a 1:1 ratio. Cell count and viability were measured using a Countess Automated Cell Counter (Thermo Fisher Scientific). If the count was 3 × 10⁻⁶ cells / day... 6 ~6×10 6 cell / mL, thus achieving 2×10 5 ~4×10 5 Cells were passaged at a rate of cell / mL. During the implementation of this example, cell passage was performed regularly every 3-4 days.

[0121] (2-2) Transient transfection Sf9 cells that have been passaged at least three times and meet a viability of 90% were used for transfection. Sf9 samples were taken during the culture process to achieve a concentration of 4.1 × 10⁻⁶. 5 Dilute Sf9 cells in Sf-900 III SFM (Thermo Fisher Scientific) at room temperature using a cell / mL ratio. Add 2 mL of this solution to each well of a 6-well cell culture plate (Corning), gently shaking alternately to ensure even cell distribution.

[0122] The endotoxin-free plasmid obtained in “(1) Construction of plasmid vector for Factor C expression” was aliquoted into 1.4 μg sterile tubes, and 100 μL of Sf-900 (trademark) III SFM (Thermo Fisher Scientific) was added to each tube. The tubes were then incubated for 15–25 minutes. At the same time, Sf9 without plasmid was prepared as a negative control.

[0123] Next, for each sample, 12 μL of Cellfectin II Reagent (Thermo Fisher Scientific) and 150 μL of Sf9 cells in Sf-900 III SFM were mixed and allowed to stand for 15 minutes. Cellfectin II Reagent was thoroughly mixed by inverting the container before use. Every hour, the plasmid and Cellfectin II Reagent were mixed and sprayed into each well containing cells, gently shaking alternately from side to side, and incubated at 28°C for 96 hours. After incubation, transfection efficiency was confirmed using a fluorescence microscope (BZ-X810, Keyence), and the supernatant was collected. The supernatant was filtered through a DISMIC13CP020AS needle filter (Advantech) to obtain FCv culture supernatant.

[0124] (2-3) Evaluation of Factor C activity 10 μL of Sf9 culture supernatant after transient FCv expression was mixed with 50 μL of endotoxin solution (10 EU / mL), 40 μL of 50 mM Tris-HCl (pH 8.0), and 50 μL of Otsuka distilled water (manufactured by Otsuka Pharmaceutical Co., Ltd.) in a Nunc F96 MicroWell black plate (manufactured by Thermo Fisher Scientific) and heated at 37°C for 10 min. Then, 50 μL of fluorescent matrix was added, and measurements were taken every 5 minutes for 60 minutes using an Infinite 200 fluorescence reader (manufactured by TECAN) set to 37°C. The measurement conditions were set as follows: excitation wavelength 380 nm, fluorescence wavelength 440 nm, and Gain 80.

[0125] The X-axis represents the measurement time, and the Y-axis represents the fluorescence value. The value calculated using the SLOPE function is used as the "endotoxin-dependent activity" for the following evaluation. Otsuka distilled water is added as a control to replace endotoxin, and the experiment is performed simultaneously. The activity at this point is taken as the "endotoxin-independent activity," and samples with significantly high activity are excluded from subsequent tests. As an endotoxin standard, Control Standard Endotoxin (CSE) 10 ng / vial (prepared by CAPE COD) is adjusted to 10 EU / mL with Otsuka distilled water before use. As a fluorescent matrix, Boc-Asp (OBzl)-Pro-Arg-MCA (prepared by Peptide Research Institute) is dissolved in CultureSure DMSO (registered trademark) and adjusted to 0.25 mM with Otsuka distilled water before use. All reagents used are endotoxin-free or biotechnology grade.

[0126] (3) Evaluation of the activity of recombinant expression Factor C 50 μL of culture supernatant from Sf9 after transient FCv expression and 50 μL of 100 mM Bis-Tris (pH 6.0) were mixed in a PCR tube and incubated for 30 minutes. Then, endotoxin-dependent activity was determined for Factor C solution using the method described above. Surprisingly, endotoxin was detected for recombinantly expressed FCv. This provides an alternative method for endotoxin detection, distinct from existing recombinant Factor C methods.

[0127] [Example 2] Thermal stability evaluation of Factor C Next, the thermal stability of FCv was evaluated. Specifically, 50 μL of the culture supernatant of Sf9 after transient FCv expression as described in Example 1 and 50 μL of 100 mM Bis-Tris (pH 6.0) were mixed in a PCR tube and then placed in a T100 (trademark) Thermal Cycler (Bio-Rad) set to 45 °C and allowed to stand for 30 minutes. FCv was then heat-treated at 45 °C. The endotoxin-dependent activity of the heat-treated Factor C solution was determined according to the above method. The thermal stability was calculated by dividing the activity of the heat-treated sample by the activity of the untreated sample and multiplying by 100. The results confirmed that the recombinant expression Factor C, i.e., FCv, retained 67% of its activity after heat treatment at 45 °C and exhibited a certain degree of thermal stability. It was considered to be suitable for practical use.

[0128] [Example 3] Construction of plasmid vector for expression of variant Factor C Next, based on the FCv that detected endotoxin, various mutants were constructed.

[0129] Specifically, the Factor C expression plasmid vector pIZT / V5-FCv constructed in Example 1 was diluted with ultrapure water to achieve a concentration of 40 ng / μL. 0.5 μL of this diluted solution was mixed with 10 μL of kOD One PCR Master Mix, 1.2 μL of 5 μM Fw primers, and 1.2 μL of 5 μM Fw primers, and then brought to a final volume of 20 μL with ultrapure water for PCR. The template plasmid vector, Fw primers, and Rv primers used for PCR are shown in the table below. The PCR conditions were as follows: 98℃ for 10 seconds, 55℃ for 5 seconds, and 68℃ for 35 seconds constituted one cycle, which was repeated 15 times to amplify the fragment.

[0130] [Table 2]

[0131] Add 1 μL of restriction enzyme DpnI to the obtained PCR product, incubate at 37°C for 1 hour, then take 3 μL and transform 30 μL of ECOS (trademark) Competent E. coli JM109 into LB agar medium supplemented with 25 μg / mL Zeocin. Incubate overnight at 37°C to obtain the transformant.

[0132] The obtained colonies were transplanted into 2.5 mL of LB liquid medium supplemented with 25 μg / mL Zeocin and multiplied overnight at 37°C and 200 rpm. Plasmids were then prepared using the FastGene Plasmid Mini kit, and their base sequences were confirmed using Fasmac's DNA sequencing service. Colonies with confirmed sequences were transplanted into 2TY medium supplemented with 5 mL of 25 μg / mL Zeocin and multiplied overnight at 37°C and 200 rpm. Finally, a plasmid vector for expressing endotoxin-free variant FCv was prepared using NucleoBond (registered trademark) Xtra Midi EF.

[0133] Using the obtained mutant FCv expression plasmid vector, insect cells were cultured and transiently transfected according to the same procedure as in Example 1 to obtain mutant FCv culture supernatant. Activity evaluation was also performed according to the procedure described in Example 1.

[0134] (4) Evaluation of the thermal stability of Factor C 50 μL of culture supernatant transiently expressing FCv or its variant Sf9 was mixed with 50 μL of 100 mM Bis-Tris (pH 6.0) in a PCR tube and incubated at 45 °C using a T100 (trademark) Thermal Cycler (Bio-Rad) for 30 minutes. Endotoxin-dependent activities were determined for each Factor C solution after heat treatment using the method described above. The thermal stability was calculated by dividing the activity of the heat-treated sample by the activity of the untreated sample and multiplying by 100. The thermal stability of FCv and its variants is shown in the table below.

[0135] [Table 3]

[0136] The amino acid substitutions attempted in this embodiment were confirmed to improve the thermal stability of recombinant Factor C, particularly when leucine at position 970 was replaced with alanine or valine, in which the FCv variant exhibited high stability. Furthermore, the FCv variant also exhibited high stability when phenylalanine at position 423 was replaced with leucine.

[0137] [Example 4] Creation of multiple variant FCv Combinations of variants (Table 2) that will help improve the thermal stability of FCv were used to create dual-variant FCv. The dual-variant was created following the same procedures as in Example 3. In PCR, the plasmid vector (pIZT / V5-FCv-4) for expressing the L970A variant of FCv was used as a template. The Fw and Rv primers used are shown in the table below.

[0138] [Table 4]

[0139] Next, triplet and quadruple variants of FCv were created. The creation of triplet and quadruple variants was performed using the same procedures as in Example 3. The Fw and Rv primers used for PCR are shown in the table below. When creating the expression plasmid vector for the triplet variant FCv, the expression plasmid vector for the L970A / F557L variant of FCv (pIZT / V5-FCv-6) was used as a template. When creating the expression plasmid vector for the quadruple variant FCv, the expression plasmid vector for the L970A / F557L / F669Y variant of FCv (pIZT / V5-FCv-6) was used as a template.

[0140] [Table 5]

[0141] Next, the five-fold variant FCv was created. The creation of the five-fold variant was performed using the same procedures as in Example 3. The Fw and Rv primers used for PCR are shown in the table below. When creating the expression plasmid vector for the five-fold variant FCv, the expression plasmid vector for the L970A, F557L, F669Y, and S973V variants of FCv (pIZT / V5-FCv-12) was used as a template.

[0142] [Table 6]

[0143] (5) Evaluation of thermal stability of multiple variant FCv The results of the thermal stability evaluation for each duplex variant are shown in the table below. The thermal stability evaluation was performed using the method described in "(4) Thermal Stability Evaluation of Factor C". The heat treatment temperature was set to 45°C. For all duplex variants, superior thermal stability compared to the single variants was confirmed.

[0144] [Table 7]

[0145] The results of the thermal stability evaluation of each triple and quadruple variant are shown in the table below. The thermal stability evaluation was performed using the method described in "(4) Thermal Stability Evaluation of Factor C". In addition, the triple and quadruple variants have high stability; even after heat treatment at 45°C, the thermal stability of all variants does not fall below 100%. Therefore, the heat treatment temperature was set at 48°C. The thermal stability of both the triple and quadruple variants is improved.

[0146] [Table 8]

[0147] The results of the thermal stability evaluation of each quintuplet variant are shown in the table below. The thermal stability evaluation was performed using the method described in "(4) Thermal Stability Evaluation of Factor C". The heat treatment temperature was set to 48°C. The thermal stability was improved in each quintuplet variant. This shows that not only by replacing the amino acids that contribute to thermal stability discovered in this study with single variants, but also by creating multiple variants through several combinations, it is possible to obtain recombinant Factor C with significantly improved thermal stability.

[0148] [Table 9]

[0149] Next, six- to nine-fold variants of FCv were created. The creation of each multiple variant was performed using the same procedures as in Example 3. The Fw and Rv primers used for PCR are shown in the table below. When creating the expression plasmid vector for the six-fold variant FCv, the expression plasmid vector for the L970A, F557L, F669Y, S973V, and Y842k variants of FCv (pIZT / V5-FCv-19) was used as a template. When creating expression plasmid vectors for the seven-fold variant FCv, the expression plasmid vectors for the L970A, F557L, F669Y, S973V, Y842k, and A876R variants of FCv (pIZT / V5-FCv-29) were used as templates. When creating expression plasmid vectors for the eight-fold variant FCv, the L970A, F557L, F669Y, S973V, and Y842k variants of FCv were used as templates. The plasmid vector for expressing the A876R and R977E variants (pIZT / V5-FCv-30) was used as a template. When preparing the plasmid vector for expressing the nine-fold variant FCv, the plasmid vector for expressing the L970A, F557L, F669Y, S973V, Y842k, A876R, R977E and S1013D variants of FCv (pIZT / V5-FCv-31) was used as a template.

[0150] [Table 10]

[0151] The results of the thermal stability evaluation of each multiple variant are shown in the table below. The thermal stability evaluation was performed using the method described in "(4) Thermal Stability Evaluation of Factor C". The stability of the six- to nine-fold variants was higher than that of the five-fold variant, and the thermal stability exceeded 100% even after treatment at 48°C. Therefore, the heat treatment temperature was set at 49°C. The thermal stability was improved in all multiple variants. More surprisingly, by overlapping the variant positions from five-fold to nine-fold, Factor C with significantly improved thermal stability was obtained.

[0152] [Table 11]

[0153] The above demonstrates that not only can the amino acid substitutions that contribute to thermal stability be used in single variants, but also by combining several to create multiple variants, it is possible to obtain recombinant Factor C with significantly improved thermal stability.

[0154] Industrial applicability The recombinant protein disclosed herein can be used as a protease for a variety of purposes. For example, the recombinant protein disclosed herein can be used for endotoxin assays and endotoxin detection, but is not limited thereto.

[0155] This specification includes references to documents such as patent applications, academic literature, and manufacturer's instructions for use. The disclosure of these documents is not to be construed as relating to the patentability of this invention, but their entire contents are incorporated herein by reference. More specifically, the inclusion of all referenced documents herein by reference is equivalent to the inclusion of each document individually and specifically shown by reference.

[0156] Brief description of the sequence Serial numbers 1-2: Primers for amplification of the pIZT / V5 fragment Serial number 3: Amino acid sequence of FCv Serial number 4: Base sequence of the FCv gene Sequence number 5: Homologous sequence added upstream of the start codon Sequence number 6: Homologous sequence added downstream of the stop codon Serial numbers 7-45: Primers used to introduce FCv variants Sequences Serial number 1 forward primer tgagtttatctgactaaatcttag Sequence number 2 reverse primer ggtaccaagctttaaattcgaacag Amino acid sequence of Serial No. 3 FCv Serial number 4 FCv gene base sequence Sequence number 5 is a homologous sequence added upstream of the start codon. ctgttcgaatttaaagcttggtacc Sequence number 6 is a homologous sequence added downstream of the stop codon. tgagtttatctgactaaatcttag Serial number 7 is the Fw primer used to introduce the FCv F423L variant. cagtccttccgtctcgactacgtgcgttcc Serial number 8 is the Rv primer used to introduce the FCv F423L variant. acggaaggactgagccagggacttcagctc Serial number 9 is the Fw primer used to introduce the FCv F557L variant. actaagtcctgcctccagccatcctccttc Serial number 10 is the Rv primer used to introduce the FCv F557L variant. gcaggacttagttttccacacggactgcag Serial number 11 is the Fw primer used to import the FCv F669Y variant. gtgggttctccctacctgcgtctgcctcgt Serial number 12 is the Rv primer used to introduce the FCv F669Y variant. gggagaacccacacgagagatggagttggt Serial number 13 is the Fw primer used to introduce the FCv L970A variant. tctggtggtcccgcggtgttctccgacgag Serial number 14 is the Rv primer used to introduce FCv L970A and L970V variants. gggaccaccagaatcgcctgagcaggagtc Serial number 15 is the Fw primer used to introduce the FCv L970V variant. tctggtggtcccgtggtgttctccgacgag Serial number 16 is the Fw primer used to introduce the FCv S973V variant. cccgcggtgttcgtcgacgagtctcgtact Serial number 17 is the Rv primer used to introduce FCv S973V, S973I, and S973L variants. gaacaccgcgggaccaccagaatcgcctga Serial number 18 is the Fw primer used to introduce the FCv S973I variant. cccgcggtgttcatcgacgagtctcgtact Serial number 19 is the Fw primer used to introduce the FCv S973L variant. cccgcggtgttcttagacgagtctcgtact Serial number 20 is the Fw primer used to import the FCv Y425F variant. ttccgtttcgacttcgtgcgttcctccacc Serial number 21 is the Rv primer used to introduce the FCv Y425F variant. gtcgaaacggaaggactgagccagggactt Serial number 22 is the Fw primer used to import the FCv Y605F variant. tcctctgtgcgcttctcctgcgaggtgctg Serial number 23 is the Rv primer used to introduce the FCv Y605F variant. gcgcacagaggaaccagcgtagaaaccgtc Serial number 24 is the Fw primer used to import the FCv Y832F variant. tacctgggcaagttctaccgtgacgactcc Serial number 25 is the Rv primer used to introduce the FCv Y832F variant. cttgcccaggtagaacttgaactgagaggg Serial number 26 is used to import the FCv Y833F variant using Fw primers. ctgggcaagtacttccgtgacgactccaag Serial number 27 is the Rv primer used to introduce the FCv Y833F variant. gtacttgcccaggtagaacttgaactgaga Serial number 28 is the Fw primer used to import the FCv Y842K variant. aaggacgacgacaaagtccaagtgcgcacc Serial number 29 is the Rv primer used to introduce the FCv Y842K variant. gtcgtcgtccttggagtcgtcacggtagta Serial number 30 is the Fw primer used to introduce the FCv A876R variant. gaggagtctgtccgtctgaccaccagggtg Serial number 31 is the Rv primer used to introduce the FCv A876R variant. gacagactcctcgagctggatcagagcgat Serial number 32 is the Fw primer used to introduce the FCv K897Q variant. cgcaacaacctgcaagagggtcacaaggct Serial number 33 is the Rv primer used to introduce the FCv K897Q variant. caggttgttgcggggaggaacggtcggtagg Serial number 34 is the Fw primer used to introduce the FCv T914R variant. aacgagaacgagcgctactctgagatgatc Serial number 35 is the Rv primer used to introduce the FCv T914R variant. ctcgttctcgttgagtccccatccggtcac Serial number 36 is the Fw primer used to introduce the FCv S930D variant. gtggtgtccgctgatacttgcgagcagggt Serial number 37 is the Rv primer used to introduce FCv S930D, S930E, and S930K variants. agcggacacccactggcagcacggcctgctg Serial number 38 is the Fw primer used to introduce the FCv S930E variant. gtggtgtccgctgaaacttgcgagcagggt Serial number 39 is the Fw primer used to introduce the FCv S930K variant. gtggtgtccgctaaaacttgcgagcagggt Serial number 40 is the Fw primer used to introduce the FCv K955E variant. tgcgctggttacgagaacggccgttacgac Serial number 41 is the Rv primer used to introduce the FCv K955E variant. gtaaccagcgcagaacatgttttcggtcac Serial number 42 is the Fw primer used to introduce the FCv K977E variant. gtcgacgagtctgaaactgatcgtcgttgg Serial number 43 is the Rv primer used to introduce the FCv K977E variant. agactcgtcgacgaacaccgcgggaccacc Serial number 44 is the Fw primer used to introduce the FCv S1013D variant. aacgtgttcctggactggatccgtcagttc Serial number 45 is the Rv primer used to introduce the FCv S1013D variant. caggaacacgttgactttggtaaaaccagc

Claims

1. A Factor C protein having an amino acid sequence identity of 95% or more with SEQ ID NO:

3.

2. A polynucleotide encoding the protein of claim 1.

3. An endotoxin detection reagent comprising the protein of claim 1.

4. A cell comprising the polynucleotide of claim 2.

5. A method of producing a Factor C protein, comprising: culturing the cell of claim 4; and obtaining the Factor C protein of claim 1.

6. A method of manufacturing an endotoxin detection reagent, comprising: culturing the cell of claim 4; and obtaining the Factor C protein of claim 1.

7. A method of endotoxin detection comprising: a process of contacting the protein of claim 1 or the reagent of claim 3 with a sample; and a process of detecting endotoxin.

Images