Single-stranded DNA molecular weight standard based on light-operated self-assembly and preparation method thereof

Abstract

The invention discloses a single-stranded DNA molecular weight standard based on light-operated self-assembly and a preparation method thereof.The preparation method comprises the following steps that S1, a DNA sequence containing a photosensitive bridging group is chemically synthesized, the DNA sequence can be self-assembled to form hairpin structures, and the hairpin structures can also be self-assembled; s2, carrying out annealing treatment on the DNA sequence, and carrying out self-assembly on a single DNA sequence to form a hairpin structure; s3, mixing the hairpin structure with nucleic acid ligase, breaking the photosensitive bridging group under the irradiation of ultraviolet light, complementarily pairing the exposed single-chain sequence with other hairpin structures through bases, and realizing cascade self-assembly through the nucleic acid ligase; s4, carrying out thermal inactivation treatment; s5, carrying out ultraviolet irradiation treatment again to break all the photosensitive bridging groups; and S6, adding an electrophoresis loading buffer solution, and storing at low temperature. The DNA molecular weight standard is rapidly prepared through the one-pot method, and the method has the advantages of being simple in process, low in manufacturing cost, high in expansibility and the like and has good application prospects.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a single-stranded DNA molecular weight standard based on light-controlled self-assembly and its preparation method. Background Technology

[0002] DNA molecular weight standards are a series of reagents that mix DNA fragments of different molecular weights. In the field of molecular biology, DNA molecular weight standards are reagents used to calibrate the molecular weight of DNA fragments to be tested. The specific calibration method involves performing an electrophoresis experiment on the same agarose gel or polyacrylamide gel with the DNA molecular weight standards. The DNA fragments of known lengths in the DNA molecular weight standards form gradient bands, indicating the size and distribution of the unknown DNA fragments to be tested.

[0003] In molecular biology experiments, DNA molecular weight standards are an essential reagent that is used frequently and consumed in large quantities. Therefore, there is a great demand for their preparation, and the requirements are low production cost, high accuracy, and high diversity.

[0004] Currently, there are two main methods for preparing DNA molecular weight standards: PCR amplification and enzyme digestion plasmids. The main principle of PCR amplification is to design primers, amplify template DNA to the desired length, purify the amplified DNA, and then mix the different DNA fragments. The main principle of enzyme digestion plasmids is to design a pair of primers, amplify template DNA, and obtain DNA fragments. However, for specially modified DNA molecular weight standards, such as fluorescently labeled ones, or single-stranded DNA molecular weight standards, there is a lack of simple and efficient preparation methods. Especially for small single-stranded fragments, such as 20 nt DNA molecular weight standards, the cost of PCR amplification is high due to their small fragment length, while enzyme digestion plasmids often produce redundant bands, which is detrimental to subsequent purification and limits large-scale production. Currently available small-fragment single-stranded DNA molecular weight standards or fluorescently modified DNA molecular weight standards are expensive to purchase, and there are currently no fluorescently modified single-stranded DNA molecular weight standards available. Summary of the Invention

[0005] The purpose of this invention is to provide a single-stranded DNA molecular weight standard based on light-controlled self-assembly and its preparation method, thereby solving the technical bottlenecks of high cost and difficulty in modification of single-stranded small fragment DNA molecular weight standards in the prior art.

[0006] To solve the above problems, the present invention adopts the following technical solution:

[0007] According to a first aspect of the present invention, a method for preparing a single-stranded DNA molecular weight standard based on photocontrolled self-assembly is provided, comprising the following steps: S1: chemically synthesizing a DNA sequence containing a photosensitive bridging group, wherein the DNA sequence can self-assemble to form a hairpin structure, and the hairpin structures can also self-assemble with each other, wherein the photosensitive bridging group is located in the middle of the DNA sequence, so that it can break after photolysis to form two partially complementary DNA sequences; S2: annealing the DNA sequence containing the photosensitive bridging group, wherein a single DNA sequence self-assembles to form a hairpin structure; S3: combining the hairpin structure obtained in step S2 with a nucleus... Acid ligases are mixed, and under ultraviolet light, the photosensitive bridging groups break, exposing single-stranded sequences that pair with other hairpin structures through base complementarity and cascade self-assembly via nucleic acid ligases. The duration of ultraviolet light irradiation determines the maximum length of the prepared DNA molecular weight standard. S4: After ultraviolet light irradiation, the reaction system is placed at high temperature to thermally inactivate the nucleic acid ligases. S5: The thermally inactivated reaction system is subjected to ultraviolet light irradiation again to break all photosensitive bridging groups. S6: An appropriate volume of electrophoresis loading buffer is added to prepare a single-stranded DNA molecular weight standard solution, which is then stored at low temperature.

[0008] Preferably, in step S1, the photosensitive bridging group is selected from: PC linker (3-(4,4'-Dimethoxytrityl)-1-(2-nitrophenyl)-propan-1-yl-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite), o-nitrobenzyl, or p-hydroxyphenylpropionate, etc., to meet different photoresponse requirements. It should be understood that any photosensitive bridging group with this property is applicable to the present invention, but the 5' end needs to retain a phosphate group after cleavage.

[0009] According to the present invention, when preparing single-stranded DNA molecular weight standards, a photosensitive bridging group needs to be modified in the middle of the DNA strand. It should be understood that the preparation of single-stranded DNA molecular weight standards adopts a hairpin structure design and modifies the middle of the stem with a photosensitive bridging group. After breakage, two single-stranded DNA fragments of equal length are generated, the length of which is determined by half the total length of the hairpin DNA.

[0010] Preferably, the length of the photosensitive hairpin DNA structure is between 40 and 120 nt. More preferably, a 40 nt hairpin DNA PC20 nt is used as the raw material for preparing single-stranded DNA molecular weight standards, that is, the DNA sequences on both sides of the photosensitive bridging group PC linker are both 20 nt, and the sequence length gradient of the DNA molecular weight standards prepared thereby is 20 nt. It should be understood that the sequence length of this photosensitive hairpin DNA structure is only illustrative of preferred embodiments and is not intended to limit the scope. The preferred sequence length is 40-120 nt, which ensures both high efficiency of self-assembly and high accuracy and low cost during synthesis.

[0011] Preferably, in step S1, functional group modification can be performed during the synthesis of the DNA sequence. The functional group modification is selected from: Cy3 fluorescent group, Cy5 fluorescent group, azide group, methylation modification, digoxigenin labeling or methylene blue modification, etc.

[0012] Preferably, in step S3, the two single-stranded DNAs generated after the photosensitive bridging group breaks have the same number of bases, and the number of bases determines the sequence length difference of the DNA molecular weight standard prepared therefrom.

[0013] Preferably, in step S3, each self-assembly connection increases the DNA strand by a fixed number of bases, forming a fixed gradient of single-stranded DNA molecular weight standards, wherein the fixed gradient is selected from: 10 nt, 15 nt, 20 nt, 25 nt, 30 nt, 35 nt, 40 nt, etc.

[0014] Preferably, in step S3, the ultraviolet wavelength range is 315-405 nm, the light intensity is 0.1~1000 mW / cm², and the irradiation time is 0.1~60 min.

[0015] According to a preferred embodiment of the present invention, the ultraviolet wavelength range is 315-405 nm, the light intensity is 30 mW / cm², and the irradiation time is 1 min.

[0016] Preferably, in step S3, the nucleic acid ligase is an enzyme with DNA ligation function, including: T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, Taq DNA ligase, 9°N DNA Ligase, E. coli DNA ligase, SplintR ligase, 5´ AppDNA / RNA thermostable ligase, T4 RNA ligase, T4 RNA ligase 2, or RtcB ligase.

[0017] According to one embodiment of the present invention, the nucleic acid ligase is a T4 DNA ligase, and the final concentration of the T4 DNA ligase is 0.1-100 U / μL.

[0018] According to the method of the present invention, the concentration of the nucleic acid ligase and the reaction time together determine the number of self-assemblies; however, the concentration and reaction time mentioned above are preferred conditions used in this experiment and are not intended to limit the number of self-assemblies.

[0019] It should also be understood that, according to the method of the present invention, there is no limitation on the concentration of hairpin DNA. Preferably, in step S3, the concentration of hairpin DNA is 0.01-100 μM, and the DNA concentration is adjusted according to the target product requirements.

[0020] Preferably, in step S4, the enzyme undergoes a three-step inactivation process: heating at 65°C for 10 minutes, rapid cooling in an ice bath, and EDTA chelation, to ensure complete elimination of enzyme activity. This invention is the first to employ such a three-step inactivation method to ensure complete inactivation and product stability. Heating at 65°C for 10 minutes denatures the protein structure of the nucleic acid ligase; rapid cooling in an ice bath quickly immobilizes the enzyme's inactive state, preventing renaturation; and EDTA chelation removes the metal ions required for the active site of the nucleic acid ligase by binding to metal ions, further ensuring complete elimination of enzyme activity.

[0021] According to the present invention, modifications with different functional groups or different numbers of functional groups can be performed during the synthesis process. These functional groups are selected from: Cy3 fluorescent groups, Cy5 fluorescent groups, azides, methylation, digoxigenin, or methylene blue, etc., to prepare DNA molecular weight standards with different modifications. For example, modifications with fluorescent groups such as Cy3 and Cy5 make the DNA molecular weight standards easier to detect and track in fluorescence detection experiments; methylation modifications may affect certain biological activities of DNA, and have different application values ​​in specific experimental needs.

[0022] The reaction buffer comprises, but is not limited to, 6.6 mM MgCl2, 1 mM ATP, 10 mM DTT, 66 mM Tris-HCl buffer at pH 7.6, or other buffers of varying concentrations and pH, as long as they can ensure enzyme activity. Examples include PBS, D-PBS, potassium phosphate buffer, and ATP solutions of different concentrations ranging from 0.1 to 10 mM. It should be understood that these reaction buffers are preferred conditions for the experiment and are not intended to limit the application; any buffer for nucleic acid ligases can be used in this invention.

[0023] According to a second aspect of the present invention, a single-stranded DNA molecular weight standard prepared by the preparation method is provided, the single-stranded DNA molecular weight standard comprising a plurality of single-stranded DNA molecular weight standards with equally increasing sequence lengths.

[0024] According to the present invention, since the photosensitive bridging group is located in the middle of the DNA sequence, the two single-stranded DNAs generated after the photosensitive bridging group breaks have the same number of bases, and the number of bases determines the sequence length difference of the DNA molecular weight standard prepared therefrom.

[0025] According to a preferred embodiment of the present invention, a method for preparing DNA molecular weight standards based on photocontrolled DNA self-assembly is provided, comprising the following steps:

[0026] Directed self-assembly control: DNA sequences containing photosensitive bridging groups (such as PC linkers) of 0.01-100 μM form self-assembled structures in 66 mM Tris-HCl buffer (pH 7.6) containing 6.6 mM MgCl2, 1 mM ATP, and 10 mM DTT;

[0027] Molecular weight gradient generation: Add T4 DNA ligase to a final concentration of 20 U / μL. Under ultraviolet light irradiation, the photosensitive bridging groups (such as PC linkers) break, and the exposed single-stranded regions bind to the complementary regions of adjacent hairpin structures. The ligation reaction is achieved by DNA ligase. By controlling the reaction time (0.5-8 minutes), the number of self-assemblies can be precisely controlled. Each ligation increases the number of fixed bases to form an arithmetic gradient.

[0028] Product stabilization treatment: A three-step inactivation method is adopted, namely heating at 65℃ for 10 minutes → rapid cooling in an ice bath → EDTA chelation to ensure complete elimination of enzyme activity. Then, the reaction system is subjected to sufficient ultraviolet light irradiation to break all photosensitive bridging groups.

[0029] Product preservation: Dilute the product to the appropriate concentration and add the appropriate volume of electrophoresis loading buffer to the system to prepare a DNA molecular weight standard solution, and store it at 4 °C.

[0030] According to the method for preparing DNA molecular weight standards provided by the present invention, combined with Figure 1 As shown, its working principle is explained as follows: DNA containing photosensitive bridging groups can form hairpin structures. After the photosensitive bridging groups break, the exposed sequence can self-assemble with another hairpin structure and be linked by a nuclease. Each ligation and assembly adds the same number of bases, forming DNA fragments with increasing gradients, i.e., single-stranded DNA molecular weight standards. When preparing modified DNA molecular weight standards, single-stranded DNA raw materials with corresponding modifications are used.

[0031] The method for preparing DNA molecular weight standards according to the present invention involves two self-assemblies, one occurring in step S2 and the other in step S3.

[0032] In this invention, the self-assembly in step S2 refers to the self-assembly of a single DNA sequence to form a hairpin structure through annealing.

[0033] In this invention, self-assembly in step S3 refers to the process by which the sequence exposed after the photosensitive bridging group breaks can spontaneously form a specific spatial structure with another hairpin structure through base complementary pairing. Specifically, the sequence exposed after the photosensitive bridging group breaks can recognize and bind with another hairpin structure through base pairing (such as AT and CG pairing), thereby causing the two hairpins to assemble together in a directional manner to form a stable composite structure. The complementary sequence is used to allow the two hairpins to initially oriented closer together during self-assembly, while the self-assembled complementary sequence determines the specificity and stability of the final self-assembled structure. This self-assembly is the basis for the subsequent function of DNA ligase. The assembled structure provides ligase with recognizable connection sites, enabling the nucleic acid ligase to connect adjacent DNA strands, and then, by controlling reaction time and other conditions, generate DNA molecular weight standards with progressively increasing lengths (such as 20 nt, 40 nt, 60 nt, etc.).

[0034] According to the present invention, the lengths of the "complementary sequence" and the "self-assembled complementary sequence" of the two hairpin DNAs are not fixed, and the number of bases at both ends of the photosensitive bridging group is the same (the number of bases determines the difference in sequence length of the molecular weight standard), which provides a basis for the flexibility and gradient regulation of self-assembly.

[0035] While self-assembly and enzyme ligation are existing technologies, the main inventive aspect of this invention lies in the introduction of a hairpin structure and a photosensitive bridging group, thereby achieving precise gradient control and universal raw material availability. The pre-folded conformation of the hairpin structure achieves precise spatial positioning through complementary sequences, enabling rapid directional pairing of exposed sequences after light control, avoiding non-specific binding. Its stem-loop structure also enhances the rigidity of the complex, providing a stable template for the ligase. Simultaneously, the hairpin design allows for flexible control of the gradient interval (e.g., 20 nt, 40 nt, etc.) by adjusting the length ratio of the complementary sequences, while its closed structure significantly suppresses mishybridization and side reactions, improving product purity. The photosensitive bridging group achieves instantaneous and precise sequence cutting and assembly initiation through light-controlled triggering. Its symmetric design strictly ensures the consistency of sequence length, thus forming a precise gradient. Furthermore, the same photosensitive bridging group can be adapted to different hairpin sequences; only the complementary region needs to be adjusted to expand its application, significantly improving the universality of raw materials. This invention overcomes the high cost and complexity of traditional single-stranded DNA molecular weight standards preparation processes. It allows for the preparation of multiple DNA molecular weight standards with progressively increasing sequence lengths through a simple reaction process. Furthermore, the invention is innovative because it uses only one DNA strand as the starting material, avoiding the problem of residual uncomplementary DNA strands after double-stranded annealing assembly due to the mixing ratio of two DNA strands, which affects product purity. The method is also simpler and more efficient.

[0036] Compared with existing technologies, the advantages of the present invention are mainly in the following aspects:

[0037] 1) Photo-controlled self-assembly: Utilizing the self-assembly properties between hairpins, cutting is performed by light control, and directional ligation is achieved through complementary base pairing, which is different from the random fragment generation of traditional enzyme digestion or PCR;

[0038] 2) Precise gradient control: By controlling the reaction time of the nucleic acid ligase, an arithmetic gradient with a fixed number of bases added each time is achieved, which solves the problem of irregular gradient intervals in the existing technology;

[0039] 3) Three-step inactivation method: By combining heating, ice bath and EDTA chelation treatment, the enzyme activity is completely eliminated and the product stability is improved. Existing technologies may only use heating to inactivate, and the effect is relatively limited.

[0040] 4) Raw material versatility: Using short-chain DNA (such as 40 nt) as raw material, it can be extended to long fragments through self-assembly, reducing synthesis costs, while traditional chemical synthesis methods for long fragments are expensive.

[0041] In summary, the method for preparing single-stranded DNA molecular weight standards based on photocontrolled self-assembly provided by this invention can prepare single-stranded DNA molecular weight standards of different gradients. The process is simple and the preparation cost is low. This method can also prepare DNA molecular weight standards with different modifications, such as fluorescent molecule modification and cholesterol modification. It is particularly suitable for preparing DNA molecular weight standards with chemical modification functions in the range of 20-100 nt, overcoming the technical bottlenecks of high cost and difficulty in modification of single-stranded small fragment DNA molecular weight standards in existing technologies. This invention uses a one-pot method for rapid preparation of DNA molecular weight standards, possessing advantages such as simple process, low production cost, and strong scalability, and has good application prospects. Attached Figure Description

[0042] Figure 1 The flowchart provided by the present invention is for the preparation of single-stranded DNA molecular weight standards based on photocontrolled self-assembly. It should be understood that the step of annealing and self-assembling the DNA sequence into a hairpin structure is omitted. The flowchart mainly shows the steps of photocontrolled self-assembly and inactivation treatment.

[0043] Figure 2 This is a denaturing electrophoresis comparison of the 20 nt single-stranded DNA molecular weight standard prepared according to Example 1 of the present invention and the commercial single-stranded DNA molecular weight standard; wherein, band 1 is the commercial molecular weight standard and band 2 is the molecular weight standard prepared by this method.

[0044] Figure 3 Denaturing electrophoresis gel images of a 20 nt single-stranded DNA molecular weight standard prepared according to Example 1 of the present invention and a known 42 nt single-stranded DNA; wherein, band 1 is the 20 nt single-stranded DNA molecular weight standard prepared by this method, and band 2 is the 42 nt single-stranded DNA;

[0045] Figure 4 Denaturing electrophoresis gel images of a 25 nt single-stranded DNA molecular weight standard prepared according to Example 2 of the present invention and a known 42 nt single-stranded DNA; wherein, band 1 is the 25 nt single-stranded DNA molecular weight standard prepared by this method, and band 2 is the 42 nt single-stranded DNA;

[0046] Figure 5This is a 20 nt single-stranded DNA molecular weight standard prepared using different UV reaction times according to Example 3 of the present invention; wherein, band 1 is a commercially available molecular weight standard, band 2 is a single-stranded DNA molecular weight standard prepared by UV reaction for 0.5 min, band 3 is a single-stranded DNA molecular weight standard prepared by UV reaction for 1 min, band 4 is a single-stranded DNA molecular weight standard prepared by UV reaction for 2 min, band 5 is a single-stranded DNA molecular weight standard prepared by UV reaction for 3 min, band 6 is a single-stranded DNA molecular weight standard prepared by UV reaction for 4 min, band 7 is a single-stranded DNA molecular weight standard prepared by UV reaction for 5 min, band 8 is a single-stranded DNA molecular weight standard prepared by UV reaction for 6 min, band 9 is a single-stranded DNA molecular weight standard prepared by UV reaction for 7 min, and band 10 is a single-stranded DNA molecular weight standard prepared by UV reaction for 8 min;

[0047] Figure 6 This refers to 20 nt single-stranded DNA molecular weight standards prepared using DNA hairpin structures with different reaction concentrations according to Example 4 of the present invention; wherein, band 1 is a commercially available molecular weight standard, band 2 is a single-stranded DNA molecular weight standard prepared at 0.1 μM, band 3 is a single-stranded DNA molecular weight standard prepared at 0.5 μM, band 4 is a single-stranded DNA molecular weight standard prepared at 1 μM, band 5 is a single-stranded DNA molecular weight standard prepared at 2 μM, band 6 is a single-stranded DNA molecular weight standard prepared at 4 μM, band 7 is a single-stranded DNA molecular weight standard prepared at 6 μM, band 8 is a single-stranded DNA molecular weight standard prepared at 8 μM, and band 9 is a single-stranded DNA molecular weight standard prepared at 10 μM.

[0048] Figure 7To illustrate the assembly effect of using different concentrations and types of DNA ligases with 20 nt single-stranded molecular weight standards under UV light for 1 min according to Example 5 of the present invention; wherein, band 1 is the single-stranded DNA molecular weight standard prepared by 15 U / μL T3 DNA ligase, band 2 is the single-stranded DNA molecular weight standard prepared by 75 U / μL T3 DNA ligase, band 3 is the single-stranded DNA molecular weight standard prepared by 150 U / μL T3 DNA ligase, band 4 is the single-stranded DNA molecular weight standard prepared by 225 U / μL T3 DNA ligase, band 5 is the single-stranded DNA molecular weight standard prepared by 300 U / μL T3 DNA ligase, band 6 is the single-stranded DNA molecular weight standard prepared by 1.75 U / μL T4 DNA ligase, band 7 is the single-stranded DNA molecular weight standard prepared by 8.75 U / μL T4 DNA ligase, and band 8 is the single-stranded DNA molecular weight standard prepared by 17.5 U / μL T4 DNA ligase. The molecular weight standards are as follows: band 9 represents the molecular weight of single-stranded DNA prepared with 26.25 U / μL T4 DNA ligase; band 10 represents the molecular weight of single-stranded DNA prepared with 35 U / μL T4 DNA ligase; band 11 represents the molecular weight of single-stranded DNA prepared with 15 U / μL T7 DNA ligase; band 12 represents the molecular weight of single-stranded DNA prepared with 75 U / μL T7 DNA ligase; band 13 represents the molecular weight of single-stranded DNA prepared with 150 U / μL T7 DNA ligase; band 14 represents the molecular weight of single-stranded DNA prepared with 225 U / μL T7 DNA ligase; and band 15 represents the molecular weight of single-stranded DNA prepared with 300 U / μL T7 DNA ligase. Detailed Implementation

[0049] The present invention will be further described below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the techniques used in the embodiments are conventional practices in the art, or experimental methods recommended by the reagent kit and instrument manufacturers. Unless otherwise specified, the reagents and materials used in the embodiments are commercially available.

[0050] Table 1. DNA sequences used in this instruction manual.

[0051] name 5’ - 3’ PC20nt GGCACACACTTGAAAACCGG / iPCLink / GTGTGTGCCCCGGTTTTCAA PC25nt GGCACACACACAATAAAACCGGAAG / iPCLink / TGTGTGTGTGCCCTTCCGGTTTTAT

[0052] Example 1: Preparation of molecular weight standards for 20 nt single-stranded DNA

[0053] 10 μM 40 nt of PC linker-containing DNA (PC20nt) was annealed to allow self-hybridization and hairpin structure formation. The annealed hairpin structure was mixed with T4 DNA ligase (final DNA concentration 2 μM) and reacted under a UV lamp (30 mW) for 1 min. The reaction system was then incubated at 65 °C for 10 min. After the ligase was inactivated by heat, the system was reacted under a UV lamp (200 mW) for 10 min. An equal volume of 2× denaturing loading buffer was added to the system, and the system was stored at 4 °C.

[0054] The results are as follows Figure 2 As shown, band 1 is a commercial DNA molecular weight standard from a certain company, and band 2 is the DNA molecular weight standard prepared in this embodiment. It can be seen that 11 DNA molecular weight standards can be successfully prepared by reacting for 1 minute according to the method of this embodiment.

[0055] The results are as follows Figure 3 As shown, band 1 is a DNA molecular weight standard prepared from 20 nt single-stranded DNA, and band 2 is a 42 nt single-stranded DNA strand. It can be seen that the DNA molecular weight standard prepared by reacting for 1 min according to the method of this embodiment meets the expectations.

[0056] Example 2: Preparation of molecular weight standards for 25 nt single-stranded DNA

[0057] 10 μM 50 nt of PC linker-containing DNA (PC25nt) was annealed to allow self-hybridization and hairpin structure formation. The annealed hairpin structure was mixed with T4 DNA ligase (final DNA concentration 2 μM) and reacted under a UV lamp (30 mW) for 1 min. The reaction system was then incubated at 65 °C for 10 min. After the ligase was inactivated by heat, the system was reacted under a UV lamp (200 mW) for 10 min. An equal volume of 2× denaturing loading buffer was added to the system, and the system was stored at 4 °C.

[0058] The results are as follows Figure 4 As shown, band 1 is the DNA molecular weight standard prepared using PC25nt as raw material, and band 2 is a 42nt single-stranded DNA strand. It can be seen that the DNA molecular weight standard prepared by reacting for 1 min according to the method of this embodiment meets the expectations.

[0059] Example 3: Preparation of molecular weight standards for 20 nt single-stranded DNA with different ligation times

[0060] 10 μM 40 nt of PC linker-containing DNA (PC20nt) was annealed to allow self-hybridization and hairpin structure formation. The annealed hairpin structure was mixed with T4 DNA ligase (final DNA concentration 2 μM) and reacted under a UV lamp (30 mW) for different times (0.5-8 min). The reaction system was then incubated at 65 ℃ for 10 min. After the ligase was heat-inactivated, the system was reacted under a UV lamp (200 mW) for 10 min. An equal volume of 2× denaturing loading buffer was added to the system, and the system was stored at 4 ℃.

[0061] The results are as follows Figure 5 As shown, the assembly effect of DNA molecular weight standards prepared by ligating PC20nt with DNA ligase for different times varies. With the increase of reaction time, more molecular weight standards with higher molecular weights (such as 220 nt and 200 nt) are prepared.

[0062] Example 4: Preparation of molecular weight standards for 20 nt single-stranded DNA with different ligation concentrations

[0063] 10 μM 40 nt of PC linker-containing DNA (PC20nt) was annealed to allow self-hybridization and hairpin structure formation. The annealed hairpin structure was mixed with T4 DNA ligase (final concentration of DNA hairpin structure was 0.1-10 μM) and reacted under a UV lamp (30 mW) for 1 min. The reaction system was then incubated at 65 °C for 10 min. After the ligase was inactivated by heat, the system was reacted under a UV lamp (200 mW) for 10 min. An equal volume of 2× denaturing loading buffer was added to the system, and the system was stored at 4 °C.

[0064] The results are as follows Figure 6 As shown, band 1 is a commercial DNA molecular weight standard from a certain company, and bands 2-9 are the products obtained in this embodiment. It can be seen that as the concentration of single-stranded DNA increases, more molecular weight standards with lower molecular weights (such as 40 nt and 60 nt) are prepared.

[0065] Example 5: Preparation of molecular weight standards for 20 nt single-stranded DNA using different concentrations of different DNA ligases

[0066] 10 μM 40 nt of PC linker-containing DNA (PC20nt) was annealed to allow self-hybridization and hairpin structures. The annealed hairpin structures were then mixed with different concentrations (0.1× - 2×) of DNA ligase (T3 DNA ligase, T4 DNA ligase, T7 DNA ligase) (final DNA concentration 2 μM) and reacted under a UV lamp (30 mW) for 1 min. The reaction system was then incubated at 65 °C for 10 min. After the ligases were thermally inactivated, the system was reacted under a UV lamp (200 mW) for 10 min. An equal volume of 2× denaturing loading buffer was added to the system, and the system was stored at 4 °C.

[0067] The results are as follows Figure 7 As shown, different DNA ligases have similar ligation effects, and as the concentration of the ligase increases, more molecular weight standards with higher molecular weights are produced.

[0068] The above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of the invention. Various variations can be made to the above embodiments of the present invention. All simple and equivalent changes and modifications made in accordance with the claims and description of this application fall within the protection scope of the claims of this patent. All aspects not described in detail in this invention are conventional technical content.

Claims

1. A method for preparing single-stranded DNA molecular weight standards based on light-controlled self-assembly, characterized in that, Includes the following steps: S1: A DNA sequence containing a photosensitive bridging group is chemically synthesized. The DNA sequence can self-assemble to form a hairpin structure, and the hairpin structures can also self-assemble with each other. The photosensitive bridging group is located in the middle of the DNA sequence, so that it can be broken into two partially complementary DNA sequences after photolysis. S2: The DNA sequence containing the photosensitive bridging group is annealed, and the individual DNA sequences self-assemble to form a hairpin structure; S3: The hairpin structure obtained in step S2 is mixed with a nucleic acid ligase. Under ultraviolet light, the photosensitive bridging group breaks, and the exposed single-stranded sequence pairs with other hairpin structures through base complementarity and achieves cascade self-assembly through the nucleic acid ligase. The duration of ultraviolet light irradiation determines the maximum length of the prepared DNA molecular weight standard. S4: After the UV irradiation is completed, the reaction system is placed at high temperature to thermally inactivate the nuclease; S5: The reaction system after thermal deactivation is subjected to ultraviolet light treatment again to break all photosensitive bridging groups; S6: Add electrophoresis loading buffer to prepare a single-stranded DNA molecular weight standard solution and store at low temperature.

2. The preparation method according to claim 1, characterized in that, In step S1, the photosensitive bridging group is selected from any one of PC linker, o-nitrobenzyl, p-hydroxyphenylpropionate, or other groups with photosensitive bridging function.

3. The preparation method according to claim 1, characterized in that: In step S1, functional group modification may be performed during the synthesis of the DNA sequence. The functional group modification is selected from one or more combinations of Cy3 fluorescent group, Cy5 fluorescent group, azide group, methylation modification, digoxigenin labeling or methylene blue modification.

4. The preparation method according to claim 1, characterized in that, In step S3, the two single-stranded DNAs generated after the photosensitive bridging group breaks have the same number of bases, and the number of bases determines the sequence length difference of the DNA molecular weight standard prepared therefrom.

5. The preparation method according to claim 1, characterized in that, In step S3, each self-assembly connection increases the DNA strand by a fixed number of bases, forming a fixed gradient of single-stranded DNA molecular weight standards. The fixed gradient is selected from: 10 nt, 15 nt, 20 nt, 25 nt, 30 nt, 35 nt, 40 nt and any other number of bases.

6. The preparation method according to claim 1, characterized in that, In step S3, the ultraviolet wavelength range is 315-405nm, the light intensity is 0.1~1000 mW / cm², and the irradiation time is 0.1~60 min.

7. The method according to claim 1, characterized in that: In step S3, the nucleic acid ligase is an enzyme with DNA ligation function, including: T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, Taq DNA ligase, 9°N DNA Ligase, E. coli DNA ligase, SplintR ligase, 5´ AppDNA / RNA thermostable ligase, T4 RNA ligase, T4 RNA ligase 2, or RtcB ligase.

8. The preparation method according to claim 1, characterized in that, In step S3, the concentration of the hairpin structure is 0.01-100 μM.

9. The preparation method according to claim 1, characterized in that, In step S4, the enzyme is inactivated in three steps: heating at 65°C for 10 minutes, quenching in an ice bath, and chelating with EDTA, to ensure complete elimination of enzyme activity.

10. A molecular weight standard for single-stranded DNA prepared by the method according to any one of claims 1-9, characterized in that, The single-stranded DNA molecular weight standards include multiple single-stranded DNA molecular weight standards with equally increasing sequence lengths.

Images