Application of rice yellow-like stripe protein gene OsYSL18 in prevention and control of grain cadmium accumulation

Abstract

The invention discloses an application of a rice yellow-like stripe protein gene OsYSL18. The sequence of the yellow-like stripe protein gene OsYSL18 is as shown in SEQ ID NO. 1. The gene can be applied in multiple aspects of preventing and controlling the cadmium element from being transferred to the overground part of the rice, reducing the cadmium content of rice grains and the like. The biological function of the yellow stripe-like protein gene OsYSL18 in rice is found through a large number of experiments, and after the gene is knocked out, the cadmium content of the overground part of a rice seedling subjected to cadmium treatment is remarkably reduced; after the rice is mature, the grain cadmium content is reduced by more than 85%.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant genetic engineering, and relates to application of rice yellow stripe protein gene OsYSL18 in blocking and controlling grain cadmium accumulation. BACKGROUND

[0002] As a non-essential trace heavy metal element, cadmium has strong toxicity to plants, animals and humans. First, cadmium in the environment is absorbed into plants through roots and leaves, which can have a serious inhibitory effect on the growth and development of plants. Under cadmium stress, plants exhibit growth phenotypes such as reduced germination rate, growth retardation, leaf yellowing and necrosis, and reduced biomass (Zhou et al., 2014). In addition, cadmium can inhibit the absorption of other mineral elements by plants, leading to mineral nutrient deficiency in plants (Dong et al., 2006). In addition to plants, cadmium also has serious toxic effects on the human body. Cadmium can bind to metallothionein in the human body, thereby causing damage to the kidneys, liver, bones, cardiovascular system and reproductive system (Jarup, 2004). In addition to the above diseases, long-term exposure to cadmium can increase the incidence of pancreatic cancer, lung cancer, breast cancer and endometrial cancer (Ferrari et al., 2013).

[0003] Rice is one of the most important food crops in the world, and nearly half of the world's population relies on rice as their main food source. Compared with other food crops, rice can absorb and transfer more cadmium to the aboveground part and grain, so rice is an important source of cadmium intake for the human body. However, due to rapid industrialization, the area of heavy metal contaminated farmland is increasing. Industrial wastewater discharge, mineral mining and smelting, and unreasonable use of fertilizers are the main sources of soil cadmium pollution. Excess cadmium enters the soil and is difficult to be degraded by microorganisms or chemical methods, so it remains in the soil for a long time, thereby exceeding the upper limit of soil self-purification capacity, causing soil pollution. Under the pulling force of root pressure and transpiration, cadmium is absorbed by crops into the roots and then transferred to the aboveground part through xylem and phloem, and finally accumulated in the grain and endanger human health.

[0004] At present, the harm of cadmium contaminated rice has attracted worldwide attention, and it is imperative to take necessary measures to control the accumulation of cadmium in rice grains. We can use some physical methods to repair cadmium contaminated soil, such as adjusting the field water and fertilizer management to reduce the solubility of soil cadmium at the booting stage (Alloway 2013), or adding organic matter modifier to reduce the bioavailability of heavy metals (Shuman 1998). However, these measures generally have problems such as high cost, long repair time and difficult operation, especially the water and fertilizer management is not easy to control, which may increase the solubility of other heavy metal elements while reducing cadmium, thereby causing a new round of pollution (Hu et al., 2013). Considering comprehensively, breeding cadmium low accumulation rice varieties is an effective means. Studies have shown that there is a huge and heritable variation in the cadmium content of many grain crops (Grant et al., 2008). In the short term, we can screen existing rice varieties, identify heavy metal low accumulation varieties, and replace high accumulation varieties with low accumulation varieties in cadmium contaminated soil areas, so as to minimize the transfer of cadmium to the food chain. In the medium and long term, we can use excellent alleles and germplasm resources to breed new rice varieties with low cadmium accumulation. At present, some genes related to root cadmium absorption and vacuole cadmium block have been identified in rice, but there are few reports on genes that regulate grain cadmium accumulation. Mining genes that directly block and control rice grain cadmium accumulation is beneficial to effectively reduce the cadmium content in rice without affecting the growth and development of rice in the early stage, and provides direction for breeding new varieties with low cadmium accumulation. SUMMARY

[0005] The purpose of the present application is to solve the above-mentioned problems existing in the prior art, and to provide the application of rice yellow stripe protein gene OsYSL18. The accession number of OsYSL18 in GenBank is NM_001409095.

[0006] The technical scheme of the present application is as follows:

[0007] The first purpose of the present application is to provide the application of knocking out rice yellow stripe protein gene OsYSL18 for reducing the cadmium content of rice seedlings above ground and / or blocking and controlling the accumulation of cadmium in grains and / or reducing the cadmium content in rice grains, wherein the genomic nucleotide sequence of the rice yellow stripe protein gene OsYSL18 is shown in SEQ ID NO. 1.

[0008] Further, the CDS sequence of the rice yellow stripe protein gene OsYSL18 is shown in SEQ ID NO. 2.

[0009] The second object of the present application is to provide a knock-out vector for reducing cadmium content in the above-ground part of rice seedlings and / or controlling and reducing cadmium accumulation in rice grains and / or reducing cadmium content in rice grains, which is a recombinant expression vector containing the aforementioned rice yellow stripe-like protein gene OsYSL18 or any fragment thereof.

[0010] Further, the knock-out vector is a recombinant expression vector containing the target sequence T1 of the yellow stripe-like protein gene OsYSL18 shown in SEQ ID NO. 3 and / or the target sequence T2 of the yellow stripe-like protein gene OsYSL18 shown in SEQ ID NO. 4.

[0011] Further, the knock-out vector is a recombinant expression vector obtained by assembling the sgRNA expression cassette OsU6a-T1-sgRNA containing the target sequence T1 of the yellow stripe-like protein gene OsYSL18 shown in SEQ ID NO. 3 and / or the sgRNA expression cassette OsU6a-T2-sgRNA containing the target sequence T2 of the yellow stripe-like protein gene OsYSL18 shown in SEQ ID NO. 4 into the BsaI-BsaI enzyme digestion site of the pYLCRISPR / Cas9Pubi-H vector as the base vector.

[0012] Further, the sgRNA expression cassette OsU6a-T1-sgRNA containing the target sequence T1 of the yellow stripe-like protein gene OsYSL18 shown in SEQ ID NO. 3 and the sgRNA expression cassette OsU6a-T2-sgRNA containing the target sequence T2 of the yellow stripe-like protein gene OsYSL18 shown in SEQ ID NO. 4 are obtained by the following steps:

[0013] (1) using the plasmid pYLsgRNA-OsU6a as the template, the sgRNA fragment containing the target T1 is amplified with SEQ ID NO. 5 gRT1 and SEQ ID NO. 6 OsU6aT1 as primers; using the plasmid pYL-sgRNA-OsU6b as the template, the sgRNA fragment containing the target T2 is amplified with SEQ ID NO. 7 gRT2 and SEQ ID NO. 8 OsU6bT2 as primers;

[0014] (2) using SEQ ID NO. 9 Pps-GGL and SEQ ID NO. 10 Pgs-GG2 as primers to amplify the sgRNA fragment containing the target T1, obtaining the sgRNA expression cassette OsU6a-T1-sgRNA; using SEQ ID NO. 11 Pps-GG2 and SEQ ID NO. 12 Pgs-GGR as primers to amplify the sgRNA fragment containing the target T2, obtaining the sgRNA expression cassette OsU6a-T2-sgRNA.

[0015] A third objective of this invention is to provide the application of the aforementioned knockout vector in reducing cadmium content in the aboveground parts of rice seedlings and / or inhibiting cadmium accumulation in grains and / or reducing cadmium content in rice grains.

[0016] Furthermore, the aforementioned knockout vector was introduced into rice to obtain rice with the knockout of the yellow stripe protein gene OsYSL18, thereby reducing the cadmium content in the aboveground parts of rice seedlings and / or inhibiting cadmium accumulation in grains and / or reducing the cadmium content in rice grains.

[0017] The beneficial effects of this invention are:

[0018] 1. Through systematic research, this invention provides for the first time a biological function of the yellow stripe protein gene OsYSL18 in blocking cadmium accumulation in grains.

[0019] 2. Knocking out the OsYSL18 gene, which is responsible for the yellow stripe protein, significantly reduced the cadmium content in the aboveground parts of rice seedlings.

[0020] 3. At the same time, knocking out the OsYSL18 gene, which is a type of yellow stripe protein, can also inhibit the accumulation of cadmium in grains and significantly reduce the cadmium content in mature rice grains.

[0021] 4. This invention constructs knockout material of the yellow stripe protein gene OsYSL18.

[0022] 5. The application of the yellow stripe protein gene OsYSL18 provided by this invention can effectively control the translocation of cadmium to the aboveground parts and significantly reduce the cadmium content of the grains, while not affecting the main agronomic traits such as the thousand-grain weight of rice. It can be applied to the breeding of rice varieties with low cadmium accumulation. Attached Figure Description

[0023] Figure 1 The cadmium content of various tissues in rice yellow stripe protein gene OsYSL18 knockout mutants under cadmium treatment is shown in Figure A: Statistical graph of cadmium content in the roots of wild-type JNSM seedlings and OsYSL18 knockout mutant seedlings after 5 days of 0.5 μM cadmium treatment; Figure B: Statistical graph of cadmium content in the aboveground parts of wild-type JNSM seedlings and OsYSL18 knockout mutant seedlings after 5 days of 0.5 μM cadmium treatment. Figure 2 A field experiment on cadmium-contaminated soil to cultivate rice with the OsYSL18 knockout mutant of the yellow stripe protein gene, and a statistical chart of cadmium content in the grains.

[0024] Figure 3 This is a statistical diagram of the main agronomic traits of the OsYSL18 knockout mutant of the yellow stripe protein gene in rice under field conditions; among which:

[0025] A: Field growth phenotypes of wild-type JNSM plants and OsYSL18 knockout mutant plants;

[0026] B: Comparison of thousand-grain weight between OsYSL18 knockout mutant plants and wild-type JNSM plants. Detailed Implementation

[0027] The present invention will be further explained below with reference to the embodiments, but the embodiments do not limit the present invention in any way.

[0028] Example 1

[0029] The specific process for preparing the OsYSL18 knockout mutant of the yellow stripe protein gene in rice is as follows:

[0030] 1) Knockout of OsYSL18 was performed using CRISPR / Cas9 gene editing technology. The sequence TCCGTCGACGGCCCATCCCG (SEQ ID NO.3) in the CDS region of OsYSL18 shown in SEQ ID NO.2 was selected as the editing target site T1, and the sequence CTGGTCGAGCAGGCGCGTCC (SEQ ID NO.4) was selected as the editing target site T2. Primers for the knockout vector were designed and constructed.

[0031] The primer sequences are as follows:

[0032] gRT1:5'-TCCGTCGACGGCCCATCCCGGTTTTAGAGCTAGAAAT-3' (SEQ ID NO.5);

[0033] OsU6aT1:5'-CGGGATGGGCCGTCGACGGACGGCAGCCAAGCCAGCA-3' (SEQ ID NO.6);

[0034] gRT2:5'-CTGGTCGAGCAGGCGCGTCCGTTTTAGAGCTAGAAAT-3' (SEQ ID NO.7);

[0035] OsU6bT2: 5'-GGACGCGCCTGCTCGACCAGCAACACAAGCGGCAGC-3' (SEQ ID NO. 8).

[0036] 2) Using plasmid pYLsgRNA-OsU6a as a template and SEQ ID NO.5gRT1 and SEQ ID NO.6OsU6aT1 as primers, an sgRNA fragment containing the target T1 was amplified; using plasmid pYL-sgRNA-OsU6b as a template and SEQ ID NO.7gRT2 and SEQ ID NO.8OsU6bT2 as primers, an sgRNA expression cassette fragment containing the target T2 was amplified.

[0037] The amplification system consisted of: 10 μl Mix buffer; 2 μl plasmid; 0.5 μl primers each; and 7 μl ddH2O.

[0038] The amplification program is as follows: (1) 95℃, 3min; (2) 95℃, 15s; (3) 58℃, 15s; (4) 72℃, 20s; (5) 72℃, 5min; (6) 4℃, 5min; Steps (2)-(4) are repeated for 35 cycles.

[0039] 3) Using the sgRNA expression cassette fragment from 2) as a template, the complete sgRNA expression cassettes OsU6a-T1-sgRNA and OsU6a-T2-sgRNA were further amplified.

[0040] The amplification system consisted of: 10 μl Mix buffer; 2 μl expression cassette fragment; 0.5 μl primers each; and 7 μl ddH2O.

[0041] The primers used were:

[0042] Pps-GGL: 5'-ttcagaggtctctctcgactagtatggaatcggcagcaaagg-3' (SEQ IDNO.9);

[0043] Pgs-GG2: 5'-agcgtgggtctcgtcagggtccatccactccaagctc-3' (SEQ ID NO. 10);

[0044] Pps-GG2: 5'-ttcagaggtctctctgacactggaatcggcagcaaagg-3' (SEQ ID NO. 11);

[0045] Pgs-GGR: 5'-agcgtgggtctcgaccgacgcgtatccatccactccaagctc-3' (SEQ IDNO.12);

[0046] The sgRNA fragment containing the target T1 was amplified using primers Pps-GGL (SEQ ID NO. 9) and Pgs-GG2 (SEQ ID NO. 10) to obtain the complete sgRNA expression cassette OsU6a-T1-sgRNA; the sgRNA expression cassette fragment containing the target T2 was amplified using primers Pps-GG2 (SEQ ID NO. 11) and Pgs-GGR (SEQ ID NO. 12) to obtain the complete sgRNA expression cassette OsU6a-T2-sgRNA.

[0047] The amplification program is as follows: (1) 95℃, 3min; (2) 95℃, 15s; (3) 58℃, 15s; (4) 72℃, 20s; (5) 72℃, 5min; (6) 4℃, 5min; Steps (2)-(4) are repeated for 35 cycles.

[0048] 4) The sgRNA expression cassettes OsU6a-T1-sgRNA and OsU6a-T2-sgRNA were assembled between the BsaI-BsaI restriction sites of pYLCRISPR / Cas9Pubi-H to construct the knockout vector.

[0049] 5) Transform the knockout vector verified in step 4) into rice. The specific transgenic process is as follows: (1) Transform the pYLCRISPR / Cas9Pubi-H plasmid into Agrobacterium (EHA105); (2) Use rice variety Jin Nong Simiao (JNSM) seeds as material, peel off the shells, disinfect them and place them on the induction medium to induce callus tissue; (3) Infect the callus tissue with Agrobacterium bacterial solution, then wash it three times with sterile ddH2O and place it on the selection medium to screen out resistant callus tissue; (4) Transfer the resistant callus tissue to the differentiation medium and the rooting medium in sequence, and obtain transgenic T0 generation plants after induction differentiation and rooting.

[0050] 6) Plant T0 generation plants in the field, sequence them to identify whether the OsYSL18 coding region has mutated, select homozygous mutant plants, and harvest T1 generation seeds.

[0051] The identification primers are:

[0052] CRISPR-OsYSL18-F:5'-ATCGACCATCACTTGCATGC-3' (SEQ ID NO. 13);

[0053] CRISPR-OsYSL18-R:5'-GGTGGCGGATGATCATTGTC-3' (SEQ ID NO. 14);

[0054] Upon testing, three knockout mutants of the yellow stripe protein gene OsYSL18 with different editing patterns were obtained in this embodiment: osysl18-1, osysl18-2, and osysl18-3.

[0055] Example 2

[0056] The cadmium treatment experiment of the OsYSL18 knockout mutants osysl18-1, osysl18-2, and osysl18-3 prepared in Example 1 is carried out as follows:

[0057] 1) Seed soaking: After rinsing the rice seeds with clean water to remove any empty or shriveled husks floating on the surface, soak them at room temperature for 1 day, then germinate them in a 37℃ biochemical incubator until they show white sprouts. Once the seeds have sprouted white sprouts, sow them on a small black net secured with foam boards around the edges. Place them in a greenhouse for 3 days in the dark.

[0058] 2) Initial culture: After one week of culture under normal light, add 1 / 2 Kimura B nutrient solution and continue culture. Adjust the pH of the nutrient solution to 5.6 and change the nutrient solution every 3 days.

[0059] 3) Cadmium treatment: After culturing for 2 weeks under normal conditions, add the required volume of 0.5 mM cadmium stock solution (1000X) to a newly replaced 1 / 2 Kimura B nutrient solution in a transfer chamber. Shake the treatment solution with a glass rod until the final concentration is 0.5 μM cadCl2. Treat for 5 days, changing the treatment solution every 2 days. Carefully observe the seedling growth during the treatment period.

[0060] 4) Cadmium content determination: After 5 days of treatment, the roots and aboveground parts of each seedling were sampled and dried at 42℃ to constant weight. The dry weight of the sample was weighed and the sample was digested in a graphite furnace. The cadmium content of the sample was determined by ICP-MS.

[0061] The results showed that after treatment with 0.5 μM cadmium, the cadmium content in the roots of OsYSL18 knockout mutant seedlings was not significantly different from that in the roots of wild-type JNSM seedlings. Figure 1 A); After treatment with 0.5 μM cadmium, the cadmium content in the aboveground parts of OsYSL18 knockout mutant seedlings was significantly lower than that in the aboveground parts of wild-type JNSM seedlings. Figure 1 B) This embodiment shows that after the mutation of the yellow stripe protein gene OsYSL18, it will hinder the translocation of cadmium to the aboveground parts of rice, thereby reducing the cadmium content in the aboveground parts of seedlings.

[0062] Example 3

[0063] The field planting experiment of the yellow stripe protein gene OsYSL18 knockout mutants osysl18-1, osysl18-2, and osysl18-3 prepared in Example 1 on cadmium-contaminated soil was carried out as follows:

[0064] 1) After germinating wild-type JNSM seeds and T1 generation homozygous seeds of mutants osysl18-1, osysl18-2 and osysl18-3 at 37℃ for 3 days, the seeds were sown on a plastic black net suspended on tap water. Cardboard was placed over the black net for shading to promote rooting. After 3 days, the cardboard was removed and the seeds were placed under normal light to grow.

[0065] 2) Two weeks later, the wild-type JNSM seedlings and the mutants osysl18-1, osysl18-2 and osysl18-3 were transferred to a black plastic bucket containing 1 / 2 Kimura B nutrient solution and continued to grow for two weeks, during which the nutrient solution was changed every 3 days.

[0066] 3) Select wild-type JNSM seedlings with consistent growth and mutants osysl18-1, osysl18-2 and osysl18-3, and transplant them into cadmium-contaminated rice fields. Transplant 6 seedlings of each line, with a spacing of 10 cm between each seedling and a row spacing of 15 cm. Water and fertilizer management and pest and disease control throughout the rice growth period are the same as in ordinary fields.

[0067] 4) Harvest wild-type JNSM plants and mutants osysl18-1, osysl18-2 and osysl18-3 at the rice maturity stage.

[0068] 5) Pick the kernels from the tip of the main panicle of each plant, dry them in an oven, peel off the husks, weigh them, and then burn them in a graphite furnace. Finally, use ICP-MS to determine the cadmium content.

[0069] This example demonstrates that after mutation of the yellow stripe protein gene OsYSL18, the cadmium content of mature rice grains under cadmium-contaminated field conditions significantly decreased by more than 85%. Figure 2 ).

[0070] Example 4

[0071] The statistical analysis of the main agronomic traits of the yellow stripe protein gene OsYSL18 knockout mutants osysl18-1, osysl18-2, and osysl18-3 prepared in Example 1 under non-cadmium-polluted field conditions is as follows:

[0072] 1) Repeat steps 1-2 of Example 3.

[0073] 2) Select wild-type JNSM seedlings with consistent growth and mutants osysl18-1, osysl18-2 and osysl18-3, and transplant them into conventional paddy fields. Transplant 6 seedlings of each line, with a spacing of 10cm between each seedling and a row spacing of 15cm. Water and fertilizer management and pest and disease control throughout the rice growth period are the same as in ordinary paddy fields.

[0074] 3) Observe the field growth phenotypes of wild-type JNSM and mutants osysl18-1, osysl18-2 and osysl18-3, and count the main agronomic traits of wild-type JNSM and mutants osysl18-1, osysl18-2 and osysl18-3.

[0075] This example shows that after the OsYSL18 mutation of the yellow stripe protein gene, the thousand-grain weight of the mutant plants was not significantly different from that of the wild-type JNSM plants. Figure 3 B).

[0076] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

[0077]

[0078] SEQ ID No.2: CDS sequence of OsYSL18

[0079] atggagtcggtcggcgacccgcgggatgggccgtcgacggagcgcgcgttcgaggggcagcccgtcccgccgtggacggagcaggtgacg

[0080] ctgcgcgccgtggtggcgagcgtggcgctgggcgtggccctgagcagcgtgatgatgaacctggtgttcacgtcggggatcatcccgtcgctc

[0081] aacatctccgccggcctcctcggcttcttcctcctcaaggcctggacgcgcctgctcgaccagctcggctcgccgggccgccccttcacccgcca

[0082] ggagaacgccgtcgtccagacctgcgtcgtcgcctgcgccagcatgacatacagcggtgggtttggatcgtatctgctggccatggatcggaag

[0083] acggcggagaagacgagcaccggggacgactccagcgcgagcgtcagtgagccggagttcggtcggatgatggccttcttcttcctcgttagct

[0084] tcgtcggtctcctcgccattgtccccatgaggaagacaatgatcatccgccaccggctgacgttcccaagcggctcggcgacggctcacctcatc

[0085] aacagcttccatacccctcacggcgctagacaagcgaagaggcaagtctcgctcgttctccggtcgtcgttggcgagcttgttctggtccatcttcc

[0086] agtggttctacaccggaggtccaaactgcggcttcacttcttcccaacgtttgggctcagcgcttcaatcgcggtttctacatcagtttgaacgga

[0087] acttatgtgggaatcgggatgatcagtcctcacctgataaacgtctcgatgctcttcgggtccatcatctcctggggatcatgcggccgtacatcc

[0088] ggagcaaaagaggaatctggtacgacgccgatctccagggagacgaacttgaagagcttcagtggatacaaggtgttttgcgccatagcaatgatc

[0089] ctcggcgacggcatcttccagctcgtcgcgatctcgctgaggacgatacacacggtgcgccaccaccaggtagcggcggagacgctcaggtcc

[0090] ttctccgacgtcgacgccatgccgcggccggtgatgagcttcgacgaccgccgcagcagcaggtgttcctcagggagcacatcccgagcacc

[0091] ttcgccatcagcgggtacgtcgtcctggccaccgtctccaccgtcgtcatcccgctcatgtacggccaggtgaggtactaccacgtcgccgccgc

[0092] gtacgcgttcgcgcccgtcctggccttctgcaacgcctacggcacgggcgtcgcggagaccaacttctcggcgcagtacaacaagctggtgatc

[0093] ctcatgttcgcgtcgtggatcgggatcaagaacggcgggatcgtcgggagcctcgtcatctgcggcatcgtgtcgtccatcgtctccaccgcctcc

[0094] gacttcatgtcggacttcaagacgagctacctgacgctcacctcgccgcgggccacgctggtgagccaggtgatcggcacggcgatggggtgc

[0095] gtcgtcaacccggccgtgttcaccgtcttccaccacttctacgagatgaaccccaacaagacgtaccaggcgccgctggccaagatctaccggg

[0096] gcatcgccgtgctcggcgccggcggcctcgagctgcccaagtactgcctcgccatcagcgccaccttcttcgtgctggcgctggccgtctgcgc

[0097] gatgcgggaggtggccgcgcacggcaagtggcgcgccgagccgtacatcccgagcgtcaccggcatggccgtgtcgttcctgctggtgccgg

[0098] cggtgtccatcgacatgtgcatcggcagcctgatcgtgttcctgtggaaccgcaacgacaagctgggatcgcaggtgttcgggccggtgctggc

[0099] gtccgggctcatctgcggcgacggcctcttctccataccgtacgcgctgctcgcgaggtacgacgtcacgccgcccatctgcatcaggttcctcg

[0100] gccgggtgcagaacgacaagctggacgctttcttggcgagtaaggctaaagctggatga

[0101] SEQ ID No.3 T1

[0102] tccgtcgacggcccatcccg

[0103] SEQ ID No.4 T2

[0104] ctggtcgagcaggcgcgtcc

Claims

1. The application of knocking out the rice yellow stripe protein gene OsYSL18 in reducing cadmium content in the aboveground parts of rice seedlings and / or inhibiting cadmium accumulation in grains and / or reducing cadmium content in rice grains, characterized in that... The genomic nucleotide sequence of the rice yellow stripe protein gene OsYSL18 is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The CDS sequence of the rice yellow stripe protein gene OsYSL18 is shown in SEQ ID NO.

2.

3. A knockout vector for reducing cadmium content in the aboveground parts of rice seedlings and / or inhibiting cadmium accumulation in grains and / or reducing cadmium content in rice grains, characterized in that, The knockout vector is a recombinant expression vector containing the rice yellow stripe protein gene OsYSL18 as described in claim 1 or any fragment thereof.

4. The knockout carrier according to claim 3, characterized in that, The knockout vector is a recombinant expression vector containing the target sequence T1 of the yellow stripe protein gene OsYSL18 shown in SEQ ID NO.3 and / or the target sequence T2 of the yellow stripe protein gene OsYSL18 shown in SEQ ID NO.

4.

5. The knockout carrier according to claim 4, characterized in that, The knockout vector is obtained by assembling the sgRNA expression cassette OsU6a-T1-sgRNA containing the target sequence T1 of the yellow stripe protein gene OsYSL18 shown in SEQ ID NO.3, and / or the sgRNA expression cassette OsU6a-T2-sgRNA containing the target sequence T2 of the yellow stripe protein gene OsYSL18 shown in SEQ ID NO.4, between the BsaI-BsaI restriction sites of the basic vector.

6. The knockout carrier according to claim 5, characterized in that, The sgRNA expression cassette OsU6a-T1-sgRNA containing the target sequence T1 of the yellow stripe protein gene OsYSL18 shown in SEQ ID NO.3, and the sgRNA expression cassette OsU6a-T2-sgRNA containing the target sequence T2 of the yellow stripe protein gene OsYSL18 shown in SEQ ID NO.4, were constructed using the following steps: (1) Using plasmid pYLsgRNA-OsU6a as a template, and SEQ ID NO.5gRT1 and SEQ ID NO.6OsU6aT1 as primers, an sgRNA fragment containing the target T1 was amplified; using plasmid pYL-sgRNA-OsU6b as a template, and SEQ ID NO.7gRT2 and SEQ ID NO.8OsU6bT2 as primers, an sgRNA fragment containing the target T2 was amplified; (2) Using Pps-GGL shown in SEQ ID NO.9 and Pgs-GG2 shown in SEQ ID NO.10 as primers, the sgRNA fragment containing the target T1 was amplified to obtain the sgRNA expression cassette OsU6a-T1-sgRNA; using Pps-GG2 shown in SEQ ID NO.11 and Pgs-GGR shown in SEQ ID NO.12 as primers, the sgRNA fragment containing the target T2 was amplified to obtain the sgRNA expression cassette OsU6a-T2-sgRNA.

7. The application of the knockout vector according to any one of claims 3 to 6 in reducing the cadmium content in the aboveground parts of rice seedlings and / or inhibiting cadmium accumulation in grains and / or reducing the cadmium content in rice grains.

8. The application according to claim 7, characterized in that, Introducing the knockout vector according to any one of claims 3 to 6 into rice yields rice with the knockout of the yellow stripe protein gene OsYSL18, thereby reducing the cadmium content in the aboveground parts of rice seedlings and / or inhibiting cadmium accumulation in grains and / or reducing the cadmium content in rice grains.

Images