A SNP site, gene related to rapid growth and high yield traits of bay scallop and application thereof

By identifying the SNP site chr10-38857288 in the intron region of the EPDR1 gene in Gulf scallops, and combining PCR and RNAi technologies, the problem of slow growth rate in Gulf scallops was solved, enabling rapid screening and growth promotion for fast-growing and high-yield breeding.

CN121109615BActive Publication Date: 2026-03-27OCEAN UNIV OF CHINA
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511676843.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-11-17
Publication Date
2026-03-27
Estimated Expiration
2045-11-17

AI Technical Summary

Technical Problem

In existing technologies, the slow growth rate and small size of bay scallops are prominent problems. There is a lack of effective molecular marker-assisted breeding methods, making it difficult to quickly breed new fast-growing and high-yielding varieties.

Method used

The SNP site chr10-38857288 in the intron region of the EPDR1 gene in Gulf scallop was identified, and specific primers and kits were designed. The genotype was determined by PCR amplification and Sanger sequencing. Combined with RNAi technology, the expression of the EPDR1 gene was suppressed, thus realizing the rapid growth and high yield breeding of Gulf scallop.

Benefits of technology

This method enables rapid and accurate screening of fast-growing, high-yielding bay scallop individuals, shortening breeding time, improving breeding efficiency, promoting bay scallop growth, and achieving rapid cultivation of superior seedlings.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121109615B_ABST
    Figure CN121109615B_ABST
Patent Text Reader

Abstract

The application discloses a SNP site, a gene and application thereof related to a fast-growing and high-yield trait of Chlamys hirundo. EPDR1 The site is located at 3,885,288 of chromosome 10 (chr10-3885288) of Chlamys hirundo, is in an intron region of the gene and shows T / C base polymorphism, and has significant correlation with the growth trait of Chlamys hirundo. EPDR1 Experimental results show that different genotypes of the site are significantly related to the shell height trait, and TT and TC genotype individuals show obvious growth advantages. In addition, the experiment further proves that inhibiting the expression of the Chlamys hirundo gene can promote the growth of the Chlamys hirundo. EPDR1 Based on the above finding, the SNP site and the gene where the SNP site is located can be used as a key molecular marker and a key gene for breeding of a new Chlamys hirundo variety with fast growth and high yield, and can effectively improve breeding efficiency and accelerate the breeding process of a good variety.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of shellfish genetics and molecular breeding in marine agriculture, specifically involving an SNP locus, gene, and its application related to the fast-growing and high-yielding traits of bay scallops. Background Technology

[0002] Shellfish are the dominant economic species in my country's marine aquaculture. According to data from the "2025 China Fisheries Statistical Yearbook," in 2024, my country's shellfish farming area reached 1,398,326 hectares, with a yield of 17,394,861 tons, ranking first among all marine aquaculture species, accounting for 62% and 69% of the total farming area and yield, respectively. Bay scallops ( Argopecten irradians As an important species in my country's marine aquaculture, the scallop (Gulf scallop) has an annual output of approximately 800,000 tons, accounting for 45% of my country's total scallop production. It plays a vital role in ensuring the construction of the "blue granary" (marine resources) and promoting the development of the marine economy. However, with the continuous expansion of the scale of Gulf scallop farming, the problems of slow growth rate and small individual size have become increasingly prominent. Breeding new varieties of fast-growing and high-yielding Gulf scallops has become a research hotspot in the aquaculture field.

[0003] Molecular marker-assisted breeding is a technique that utilizes molecular markers closely related to or associated with target traits for selection and breeding. This technology can significantly shorten breeding time and accelerate the breeding process, and has become an indispensable key technology in modern breeding systems. Single nucleotide polymorphisms (SNPs) are DNA sequence polymorphisms caused by variations in a single nucleotide. They are widely distributed and highly stable, making them ideal molecular markers. Currently, SNP sites related to growth traits have been systematically screened in various marine organisms (such as fish, shrimp, sea cucumbers, and some shellfish) and successfully applied in breeding practices. For example, Chinese patent application No. 201410035028.9 discloses an SNP site related to growth traits in the scallop *Sinocyclocheilus* and its detection and application. Experiments have shown that the site C.1054A>G on the IGFBP gene is significantly associated with important growth traits of *Sinocyclocheilus*, such as shell height, shell length, body weight, soft body weight, and adductor muscle weight. However, research on SNP sites significantly associated with growth traits in bay scallops remains relatively weak, with few related reports. Therefore, systematically screening and identifying SNP sites related to the growth of Gulf scallops and developing molecular markers that can be used for breeding assistance is of great practical significance for cultivating new varieties of fast-growing and high-yielding Gulf scallops. Summary of the Invention

[0004] In view of the shortcomings of existing technologies, this invention proposes an SNP locus, gene and its application related to the fast growth and high yield traits of Gulf scallops, providing effective molecular markers and technical means for the genetic breeding of Gulf scallops.

[0005] The technical scheme of the present application mainly comprises the following contents:

[0006] The present application provides a SNP site (chr10-38857288) related to the rapid growth and high yield trait of Argopecten irradians, which is located at the 116th base of the intron region of a gene (3,885,288th base of chromosome 10 of Argopecten irradians), the base of the site is T or C, and the base sequence of the intron region is shown in SEQ ID NO:1. EPDR1

[0007] SEQ ID NO:1:

[0008] CCACATGACCTTCATACTAGACCAGAATTTGTTAGTTACCTTTTGACTTTTCGTATTAAGGTATAGATGAATTGATATATATAGGCATACAAGAGGTCACTAGTTTAAACGGGGT C TTAACCATTAAGGAAACAGAATAGGCCAGAACACAATCGAAAACATAATAATATGATATTGTGACTATAAATCATTTTCTCATTGAAATGTTATTTTTACGGTATTTTGTGTAAGCAAATTCTAAATATACAAACTTCCTTAACGATCACCTTTTTATAAATACCAAATGCTGAATAAGACCACTTTTATAGGGTCCCGTATTGATATTTTCCATTATAATTCAAGTTATGTCTGACCGCCCG

[0009] The present application also provides a primer for amplifying the SNP site, and the nucleotide sequence of the primer is shown in SEQ ID NO:2 (5'-CCACATGACCTTCATACTAGACCAGAA-3') and SEQ ID NO:3 (5'-CGGGCGGTCAGACATAACTTGA-3').

[0010] The present application also provides a kit for amplifying the SNP site, which contains the primer and PCR amplification reagents. The PCR amplification reagents include 2x Taq PCR Master Mix.

[0011] ​Further, the application provides the application of the SNP site, the primer or the kit in the breeding of fast-growing high-yield Chlamys variegata. Specifically, the genotype of the SNP site is identified, if the genotype is TT or TC, the sample is a large individual, and if the genotype is CC, the sample is a small individual.

[0012] Further, the application is: extracting the genomic DNA of the Chlamys variegata filament tissue as a template, using the primer or the kit for PCR amplification, performing Sanger sequencing on the PCR amplification product to determine the genotype of the SNP site, if the genotype is TT or TC, the sample is a large individual, and if the genotype is CC, the sample is a small individual.

[0013] On the other hand, the application also provides a breeding method of fast-growing high-yield Chlamys variegata, comprising the following (1) and / or (2):

[0014] (1) identifying the genotype of the SNP site, and selecting individuals with genotypes of TT or TC for breeding to obtain fast-growing high-yield Chlamys variegata;

[0015] (2) inhibiting the expression of the Chlamys variegata EPDR1 gene to obtain fast-growing high-yield Chlamys variegata; the CDS sequence of the EPDR1 gene is shown as SEQ ID NO: 4.

[0016] SEQ ID NO: 4:

[0017] ATGATCACTCTAGCTCTGGTCTGTTTTAGTAGCCTCATTGCACTAAGTTCCGGTAAGGGATGTTGTTCACCTCCGCAGTGGGAACGTACCGAGTATATCTCGGGTACAGAAGTGGTCAGCGGAAAGATGATCACTGTCCAGGGAGAAGCACGAACGTCCTATGATGCTAACGCTAGGAAGATAATGAATGAGTTTTCAATCATGCGAGGACAGCAACAGATCGCGCAACTCTCACTTATGGACTACGCAGCCGTAAACTCTGCCCCACCTGCCATCCCTATGTATTTTGGAACAGGTGACAATAAGATAAATGTGATGAATTACGTATTGGCTGACCCCTCTGGGATTATCACCTCTCTGCTTGTGTCAGATGGCTGTCCATATGCTTTGTCACTCGGATATAACGGTACTACAATCGGGATTAAAGATCCTTCGGTCTTCGACGTTCCAGCAGAATGTAAACACGACACAGATCCAGTGAGAGTCGATCCTGTTCAACAGGCTCCACGAAAATGCTGTTTCCCCCAAAAGTTTCAGTCGCCGGGAGGTATGATTGGTCTCGTAGAGACTGGTGGCAAAACGTATTTTCAGTCGACGAACCTGAATATTTCGTATGATGCCACGCTCCAGAAGCAAGCGACTGTATCCCAAACAAGTATAAATGAATCTCCTCCAACAATCGAAATCGAACTGAAAGACTACCGCGTTGGAGTTCAATACAACGTGAGAAATGGAAAATGCTTTAAAAATCCACTGAAGTCTCCCATGCCCAATTGCATACCAGATGATGCCACATACGAGCCGATGGTCATGGGATCTGGCGCTACCAAACTGAAAGGGGGAGTATATACGCCACAGAGGTTGAAAACGCTAGGCTATCTGTTTGGCAAATCTAGTCCTGGTCCCAGGCAAACGTCAACTTAA

[0018] Further, the (1) includes the steps of:

[0019] Extract the genomic DNA of the Chlamys variegata filament tissue as a template, use the primer or the kit to perform PCR amplification, determine the genotype of the SNP site by performing Sanger sequencing on the PCR amplification product, and select individuals with genotypes of TT or TC for breeding to obtain Chlamys variegata with fast growth and high yield.

[0020] Further, the (2) comprises the following steps:

[0021] 1) For Chlamys variegata EPDR1 The CDS sequence of the gene is designed to design an siRNA interference fragment;

[0022] 2) Constructing an L4440 recombinant plasmid containing the interference fragment; and transforming the recombinant plasmid into an HT115 Escherichia coli competent cell to obtain an Escherichia coli containing the recombinant plasmid;

[0023] 3) Expressing dsRNA by IPTG induction;

[0024] 4) Mixing the bacteria and chlorella expressing dsRNA, and feeding the bacteria and chlorella mixture to Chlamys variegata to inhibit the expression of the Chlamys variegata EPDR1 gene, thereby obtaining Chlamys variegata with fast growth and high yield.

[0025] Advantages of the present application:

[0026] The present application identifies a major SNP site (chr10-38857288) significantly related to the shell height of Chlamys variegata. By detecting the genotype of the SNP site of the present application, Chlamys variegata individuals with potential for fast growth and high yield can be quickly and accurately screened, and compared with traditional breeding methods, the breeding time can be greatly shortened and the breeding efficiency can be improved.

[0027] The present application further analyzes the EPDR1 gene located by the SNP site, and experiments show that EPDR1 The expression level of the gene has a significant effect on the growth of Chlamys variegata, and its high expression may negatively regulate the growth traits of Chlamys variegata, and interfering with the EPDR1 gene can effectively promote the growth of Chlamys variegata. Taking the SNP site and EPDR1 gene as molecular markers and key genes, Chlamys variegata with fast growth and high yield can be bred in a targeted manner, and the process of breeding good varieties can be accelerated, and excellent seedlings are provided for the Chlamys variegata breeding industry. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 : Shell height trait statistics of Chlamys variegata in large / small groups.

[0029] Figure 2 : Chlamys variegata EPDR1Statistical analysis of the relative expression of genes.

[0030] Figure 3 Metabolic rate of each group of bay scallops after 41 days of RNA interference EPDR1 Gene expression.

[0031] Figure 4 Metabolic rate of each group of bay scallops after 41 days of RNA interference

[0032] Figure 5 Pictures and growth traits of each group of bay scallops after 41 days of RNA interference. Among them, (A) growth of bay scallops, the green line is the part newly grown during the experiment. (B) statistical results of growth traits of each group of bay scallops. DETAILED DESCRIPTION

[0033] In order to facilitate those skilled in the art to better understand the technical content of the present application, the present application will be further described in detail below through specific examples and drawings. Any reagent or agent involved in the following examples is a commercially available product unless otherwise specified.

[0034] Example 1

[0035] In July 2025, 30 bay scallops with maximum / minimal shell height in the same growth period were selected from the west coast of Qingdao (total population N > 1,000) for detection and application of SNP sites related to shell height traits of bay scallops. The specific steps are as follows:

[0036] 1. Shell height trait statistics of scallops

[0037] The shell height of the above 60 bay scallops was measured using a vernier caliper, and the trait differences between the large and small individual groups were evaluated. The results showed that the shell height of the large individual group was 44.53 ± 1.91 mm, and the shell height of the small individual group was 24.57 ± 1.63 mm, with a significant difference between the two groups (P < 0.01). Figure 1 ; P = 5.49×10 -46 ).

[0038] 2. SNP typing

[0039] (1) DNA extraction and PCR

[0040] Two gill filaments were gently picked up using tweezers, and genomic DNA of bay scallops was extracted using phenol-chloroform extraction method. Genomic DNA was used as a template for PCR amplification using SEQ ID NO: 2 and SEQ ID NO: 3 typing primers. The PCR reaction system (Table 1) and reaction program (Table 2) are as follows:

[0041] Table 1. PCR reaction system

[0042]

[0043] Table 2. PCR reaction program

[0044]

[0045] (2) Sanger sequencing of PCR products

[0046] The PCR products were subjected to quality assessment using 1.5% agarose gel electrophoresis, and the results showed that the target bands were clear and free of mixed bands. The products meeting the quality requirements were sent to Shanghai Sangon Biological Engineering Co., Ltd. for Sanger sequencing.

[0047] (3) Genotype analysis

[0048] The genotype of each individual Argopecten irradians at the target SNP site (chr10-38857288) was determined based on the sequencing peak graph: single peak represented homozygous genotype (TT or CC); overlapping double peaks represented heterozygous genotype (TC). The genotype statistical results are shown in Table 3: individuals with genotype TT or TC at this SNP site belong to the large individual group, while individuals with genotype CC are mostly in the small individual group. Specifically, among the 30 individuals in the large individual group, 20 had TT genotype, 4 had TC genotype, and 6 had CC genotype; all individuals in the small individual group had CC genotype. Through Fisher's exact test analysis, there was a highly significant difference in the genotype of this SNP site between the large and small individual groups of Argopecten irradians (P < 0.01). P = 2.06 x 10 -09 ).

[0049] Table 3. Genotype composition of chr10-38857288 site in large and small Argopecten irradians individuals

[0050]

[0051] Example 2

[0052] To verify the relationship between the SNP site chr10-38857288 and the growth of Argopecten irradians, the following experiments were carried out. EPDR1 1、

[0053] Differential expression analysis EPDR1

[0054] (1) Experimental materials: The Argopecten irradians individuals and their shell height trait data used were the same as in Example 1.

[0055] (2) Tissue dissection: dissect the tissue samples of Argopecten irradians, quickly freeze them in liquid nitrogen, and then transfer them to a -80°C refrigerator for storage. ​​

[0056] (3) RNA extraction and reverse transcription: 0.20 g of the adductor muscle of Chlamys variegata was weighed, and total RNA was extracted from the tissue by using the TRIzol method. The RNA concentration was determined by using a Nanodrop, and the RNA integrity was evaluated by 1.5% agarose gel electrophoresis (the amount of RNA loaded was 300 ng).

[0057] 500 ng of total RNA was taken, 1 μL of oligo d(T) primer was added, DEPC water was added to 12.5 μL, and after mixing, it was incubated in a metal bath at 65 °C for 5 min. Then, the reverse transcription reaction system (Table 4) was added, and the reverse transcription of cDNA was performed in a PCR instrument according to the procedure shown in Table 5.

[0058] Table 4. Reverse transcription reaction system

[0059]

[0060] Table 5. Reverse transcription reaction procedure

[0061]

[0062] (4) EPDR1 Gene relative expression determination: reference gene of Chlamys variegata EF1A The primer sequences were as follows: the upstream primer was 5'-ACTGGAACCTCCCAAGCCGAT-3' (SEQ ID NO: 5), and the downstream primer was 5'-TTTACACCAAGCGTGTAGGCGAG-3' (SEQ ID NO: 6).

[0063] EPDR1 The primer sequences were as follows: the upstream primer was 5'-CTCCAGAAGCAAGCGACTGTATCC-3' (SEQ ID NO: 7), and the downstream primer was 5'-CATCGGCTCGTATGTGGCATCAT-3' (SEQ ID NO: 8).

[0064] The qRT-PCR reaction system (Table 6) was prepared under dark conditions on ice, and was aliquoted into 384-well plates. Three technical replicates were set for each target gene of each sample. After centrifugation at 1,800 rpm for 2 min, the real-time quantitative PCR instrument was used to perform amplification according to the preset procedure (Table 7). The relative expression of the genes in the large and small individual groups was calculated by using the 2 -△△Ct method, respectively. EPDR1

[0065] Table 6. qRT-PCR reaction system

[0066]

[0067] Table 7. qRT-PCR reaction program

[0068]

[0069] Between large and small groups of individuals EPDR1 There was a very significant difference in the expression of the gene Figure 2 ; P = 0.000113), the relative expression of the large group of bay scallops EPDR1 (19.29 ± 11.30) was significantly lower than that of the small group (40.76 ± 24.13). The results showed that the expression level of the gene located at the chr10-38857288 site had a significant impact on the growth of bay scallops, and its high expression might negatively regulate the growth traits of bay scallops. EPDR1

[0070] 2. RNAi verification EPDR1 Function

[0071] (1) Experimental animals: 80 bay scallops (N > 1,000) with no significant differences in body size and weight were collected from the same population in Qingdao West Coast Sea Area in September 2025. The initial body size / weight traits were measured: shell height (39.58 ± 0.75 mm), shell length (40.86 ± 1.04 mm), shell width (16.03 ± 1.22 mm), and body weight (12.56 ± 1.36 mm). The 80 bay scallop individuals were randomly divided into 4 groups (20 each): control group, L4440 group, ds EGFP group, and ds EPDR1 group. All scallops were temporarily raised in aerated seawater at 22°C.

[0072] (2) L4440 interference plasmid construction: The CDS fragments of Plakobrachus spinus EPDR1 and EGFP (negative control) were submitted to the siDirect website (https: / / sidirect2.rnai.jp / ) to predict efficient siRNA fragments, and interference target points were screened. The interference fragments were compared to the Plakobrachus spinus CDS file by BLAST to confirm their specificity. The designed interference fragment sequences and L4440 blank vector were submitted to Shanghai Shengong Biological Engineering Co., Ltd. to construct the interference recombinant plasmid. The synthesized plasmid was transformed into HT115 E. coli competent cells, and uniformly coated on LB solid medium containing ampicillin (Amp + ) and tetracycline (Tet + ) resistance, and after 12 h of inverted culture at 37°C, single colonies were picked and inoculated into 500 μL Amp + ​and Tet + LB medium with Amp and Tet, small shaking 6-8 h, add equal volume of 60% glycerol, put in -80℃ refrigerator for preservation.

[0073] Bay scallop EPDR1 The gene interference fragment is located at 174-669 bp of SEQ ID NO: 4;

[0074] EGFP The interference fragment sequence (SEQ ID NO: 9) is:

[0075] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGG.

[0076] (3) dsRNA preparation: 10-30 μL glycerol bacteria are inoculated in 5 mL LB medium containing Amp and Tet + and Tet + LB medium with Amp and Tet, small shaking 6-8 h, add equal volume of 60% glycerol, put in -80℃ refrigerator for preservation. 600 = 0.4-0.6), add isopropyl-β-D-thiogalactoside (IPTG) with a final concentration of 0.5 mmol / L to induce high-efficiency expression of dsRNA. After 4 hours of culture, centrifuge at 8,000 rpm for 5 min to collect bacterial precipitate.

[0077] (4) Algae-bacteria mixed feeding: During the interference period, the water was changed twice a day (8:30, 20:30), and each time the water was changed by 1 / 2 volume; 3 times a day, 8:30 and 14:30 fed 2 mL of Chlorella concentrated liquid (about 100 million cells / mL), and 2 mL of bacteria-algae mixed liquid was fed after 20:30 water change. Specifically: the control group was fed 2 mL of Chlorella concentrated liquid, the L4440 group was fed 2 mL of Chlorella concentrated liquid and bacteria-algae mixture containing L4440 empty plasmid bacteria, the ds EGFP group was fed 2 mL of Chlorella concentrated liquid and bacteria-algae mixture containing EGFP-L4440 recombinant plasmid bacteria, and the ds EPDR1 group was fed 2 mL of Chlorella concentrated liquid and bacteria-algae mixture containing EPDR1-L4440 recombinant plasmid bacteria.

[0078] (5) EPDR1 Gene relative expression determination: The method is the same as "Differential expression analysis". EPDR1 The relative expression of the control group, the L4440 group, the ds EGFP group was 1.07 ± 0.48, 0.92 ± 0.51, and 1.06 ± 0.56, respectively, while the ds EPDR1 group was 0.15 ± 0.19, EPDR1 <0.05), indicating that feeding bacteria containing EPDR1-L4440 recombinant plasmid can effectively reduce the expression level of EPDR1 gene in Chlamys variegata. P EPDR1

[0079] (6) Metabolic rate determination: 3 Chlamys variegata individuals were randomly selected from each group and placed in a sealed large-mouth bottle filled with filtered seawater. The dissolved oxygen concentration (DO; mg / L) and ammonia nitrogen (AN; mg / L) concentrations of the seawater were measured at the beginning of the experiment and after 2 hours, respectively. After the experiment, the soft part was dissected and dried in a 60°C oven to constant weight. The oxygen consumption rate (OR; mg·g -1 ·h -1 ), ammonia excretion rate (NR; mg·g -1 ·h -1 ), and oxygen-nitrogen ratio (O / N) of each group were calculated according to the following formulas:

[0080]

[0081]

[0082]

[0083] DO0 and DO t ​​respectively represent the seawater dissolved oxygen concentration measured before and after the experiment, mg / L; V represents the volume of seawater sealed in the large-mouth bottle, L; W represents the dry weight of the scallop body, g; t represents the experimental time, h; AN0 and AN t respectively represent the seawater ammonia nitrogen concentration measured before and after the experiment, mg / L.

[0084] ds EPDR1 The oxygen consumption rate of the group is significantly higher than that of the other three groups, which is increased by 71.52% compared with the control group (P < 0.05). The ammonia excretion rate and the oxygen-nitrogen ratio have no significant difference with the other three groups. The above results show that the RNAi of the bacteria containing the EPDR1-L4440 recombinant plasmid can enhance the respiratory metabolism level of the bay scallop. Figure 4 ; P <0.05). The ammonia excretion rate and the oxygen-nitrogen ratio have no significant difference with the other three groups. The above results show that the RNAi of the bacteria containing the EPDR1-L4440 recombinant plasmid can enhance the respiratory metabolism level of the bay scallop.

[0085] (7) Growth trait determination: After 41 days of interference, the growth of the scallops in each group was significantly differentiated. ds EPDR1 The shell height, shell length, shell width, body weight and meat column weight of the ds group were 43.23 ± 0.31 mm, 43.20 ± 0.98 mm, 15.98 ± 0.73 mm, 12.87 ± 1.05 g and 0.53 ± 0.14 g, respectively, which were significantly increased by 9.54%, 5.97% and 58.42% (P < 0.05) compared with the control group, and the shell width and body weight were also increased by 1.37% and 12.87% (P < 0.05), respectively. The results show that the interference of the EPDR1 gene can effectively promote the growth of the bay scallop, which further verifies that the site (chr10-38857288) is significantly related to the growth of the bay scallop. P <0.05). The ammonia excretion rate and the oxygen-nitrogen ratio have no significant difference with the other three groups. The above results show that the RNAi of the bacteria containing the EPDR1-L4440 recombinant plasmid can enhance the respiratory metabolism level of the bay scallop. Figure 5 The results show that the interference of the EPDR1 gene can effectively promote the growth of the bay scallop, which further verifies that the site (chr10-38857288) is significantly related to the growth of the bay scallop. EPDR1

[0086] In summary, the expression level of the EPDR1 gene located in the SNP site (chr10-38857288) is closely related to the growth of the bay scallop. By feeding the bacteria containing the EPDR1-L4440 recombinant plasmid, the expression of the EPDR1 gene can be effectively inhibited, thereby enhancing the respiratory metabolism of the body and ultimately promoting the growth of the scallop. EPDR1 EPDR1

[0087] The above-described embodiments are only part of the embodiments of the present application and are not used to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall belong to the protection scope of the present application.​​​

Claims

1. The application of a SNP site in the breeding of fast-growing and high-yielding bay scallops, characterized in that, The SNP site is located in the bay scallop. EPDR1 The 116th base of the intron region of the gene, the base at this site is T or C, and the base sequence of the intron region is shown in SEQ ID NO:1; The genotype of the SNP locus is identified. If the genotype is TT or TC, the tested samples are all large individuals. If the genotype is CC, the tested samples are mostly small individuals.

2. The application according to claim 1, characterized in that, The SNP site described in claim 1 was amplified by PCR using primers SEQ ID NO:2 and SEQ ID NO:

3. The PCR amplification products were then subjected to Sanger sequencing to determine the genotype of the SNP site. If the genotype was TT or TC, the tested samples were all large individuals. If the genotype was CC, the tested samples were mostly small individuals.

3. A method for breeding fast-growing and high-yield bay scallops, characterized in that, Including the following (1) and / or (2): (1) Identify the genotype of the SNP locus described in claim 1, and select individuals with the genotype TT or TC for breeding to obtain fast-growing and high-yielding bay scallops; (2) Suppressing Gulf scallops EPDR1 Gene expression to obtain fast-growing, high-yield bay scallops; the aforementioned EPDR1 The CDS sequence of the gene is shown in SEQ ID NO:

4.

4. The method according to claim 3, characterized in that, The (1) includes the following steps: The SNP site described in claim 1 was amplified by PCR using primers SEQ ID NO:2 and SEQ ID NO:

3. The PCR amplification products were then subjected to Sanger sequencing to determine the genotype of the SNP site. Individuals with the genotype TT or TC were selected for cultivation to obtain fast-growing and high-yielding bay scallops.

5. The method according to claim 3, characterized in that, The (2) includes the following steps: 1) Targeting Gulf scallops EPDR1 The CDS sequence of the gene was used to design an siRNA interference fragment; the base sequence of the siRNA interference fragment is shown in SEQ ID NO:9; 2) Construct the L4440 recombinant plasmid containing the interfering fragment; and transform the recombinant plasmid into HT115 Escherichia coli competent cells to obtain Escherichia coli containing the recombinant plasmid; 3) Induction of dsRNA expression via IPTG; 4) Mixing dsRNA-expressing bacteria with Chlorella vulgaris and feeding the mixture to Gulf scallops to inhibit their growth. EPDR1 Gene expression is used to obtain fast-growing and high-yield bay scallops.

Citation Information

Patent Citations

  • SNP locus related to growth characteristics of patinopecten yessoensis and detection and application thereof

    CN103740729A