KASP molecular marker for identifying Chinese cabbage nuclear male sterility gene and application of KASP molecular marker

Abstract

The invention discloses a KASP molecular marker for identifying a Chinese cabbage nuclear male sterility gene and application of the KASP molecular marker. The invention belongs to the field of molecular biology, and particularly relates to a KASP molecular marker for identifying a Chinese cabbage nuclear male sterility gene and application of the KASP molecular marker. The method for identifying or assisting in identifying the Chinese cabbage fertility comprises the steps that the genotype of an SNP site in a Chinese cabbage genome to be detected is detected, the Chinese cabbage fertility is identified or assisting in identifying according to the genotype, the SNP site is an SNP site on a Chinese cabbage A07 chromosome, the nucleotide type of the SNP site is C or T, and the SNP site is the 1935th nucleotide of SEQ ID No: 4 in a sequence table. The SNP locus related marker can be used for Chinese cabbage male sterility molecular marker assisted breeding, and a new gene resource is provided for Chinese cabbage heterosis utilization.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology, specifically relating to a KASP molecular marker for identifying the nuclear male sterility gene in Chinese cabbage and its application. Background Technology

[0002] Chinese cabbage ( Brassica campestris ssp. pekinensis Chinese cabbage (Brassica rapa) is a subspecies of Brassica rapa in the Brassicaceae family. It is an important vegetable crop originating in my country, characterized by cross-pollination of hermaphroditic flowers and exhibiting significant hybrid vigor. Due to its small floral organs, artificial emasculation and hybridization are difficult. Hybrids of Chinese cabbage bred using inbred lines or self-incompatible lines rarely achieve 100% hybrid purity, and the hybrid parents are easily lost. Therefore, male-sterile lines are an ideal method for producing hybrids of Chinese cabbage, and the breeding and utilization of male-sterile lines has always been a research hotspot in the utilization of hybrid vigor in Chinese cabbage.

[0003] Male sterility can be classified in many ways. Based on the inheritance pattern and location of the sterility gene in cells, male sterility in Chinese cabbage can be divided into two main categories: nuclear male sterility (GMS) and cytoplasmic male sterility (CMS). CMS is often caused by changes in nuclear genes through mitochondrial gene expression, while GMS is often caused by mutations in nuclear genes that affect stamen development, and is mostly controlled by dominant or recessive genes.

[0004] The development of Chinese cabbage pollen mainly involves multiple processes, including meiosis of microspore mother cells, development and degradation of the tapetum, formation of pollen wall, maturation of pollen grains, and anther dehiscence. Abnormal development at any of these stages can lead to pollen sterility.

[0005] Identifying the genes regulating pollen development in Chinese cabbage and elucidating the molecular biological characteristics, mechanisms, and regulatory networks of male sterility are crucial for hybrid seed production using male-sterile lines. Using classic map-based cloning to locate genes causing stamen abortion and further elucidate their functions is a primary strategy for studying the regulatory mechanisms of stamen fertility in Brassica plants. Using male-sterile materials from Chinese cabbage, several genes related to anther and pollen development have been identified, laying the foundation for further research on the regulatory mechanisms of stamen fertility in Chinese cabbage.

[0006] The molecular regulatory mechanism of stamen fertility in Chinese cabbage and its effective utilization in breeding practice is an important scientific question. However, currently, only a limited number of genes have been identified that regulate stamen fertility in Chinese cabbage, which is insufficient to meet the needs of molecular breeding. Therefore, further exploration of key genes controlling stamen fertility in Chinese cabbage and the development of molecular markers closely linked to them will not only help solve the problem of seed production methods for superior hybrid combinations of Chinese cabbage, but also provide new genetic resources for utilizing heterosis in Chinese cabbage. Summary of the Invention

[0007] The main problem this invention aims to solve is how to identify the fertility of Chinese cabbage and screen for male-sterile varieties.

[0008] To address the aforementioned problems, this invention provides a method for identifying or assisting in the identification of the fertility of Chinese cabbage.

[0009] The method for identifying or assisting in the identification of fertility in Chinese cabbage provided by this invention includes detecting the genotype of a SNP site in the genome of the Chinese cabbage to be tested, and identifying or assisting in the identification of fertility in the Chinese cabbage based on the genotype. The SNP site is a single SNP site on chromosome A07 of the Chinese cabbage, and its nucleotide type is C or T, specifically nucleotide 1935 of SEQ ID No: 4 in the sequence listing. In SEQ ID No: 4, y represents T or C.

[0010] In the above method, the SNP molecular marker is located at position 23,583,978 of the nucleotide sequence of chromosome A07, using the genome sequence of the common Chinese cabbage variety Chiifu as a reference genome (http: / / brassicadb.cn). The genotype of the SNP locus can be CC, TT, or CT. CC is the homozygous type of SNP being C, TT is the homozygous type of SNP being T, and CT is the heterozygous type of SNP being both C and T.

[0011] The Chinese cabbage samples with SNP genotypes CC and CT were male-fertile, while those with SNP genotype TT were male-sterile.

[0012] The present invention also provides a method for breeding Chinese cabbage, the method comprising detecting the genotype of the SNP mentioned above in the genome of Chinese cabbage, selecting Chinese cabbage with the genotype of the SNP being TT as the parent for male-sterile Chinese cabbage breeding, wherein TT is the homozygous type of the SNP being T.

[0013] Furthermore, the method also includes detecting the genotype of the SNP mentioned above in the Chinese cabbage genome, selecting Chinese cabbage with the genotype of CC or CT of the SNP as parents for male-fertile Chinese cabbage breeding, wherein CC is the homozygous type of the SNP being C, and CT is the heterozygous type of the SNP being C and T.

[0014] As an implementation method, the method for breeding Chinese cabbage may include the following steps: (1) Using the genomic DNA of the Chinese cabbage to be tested as a template, KASP molecular marker detection was performed using a primer set; (2) After completing step (1), perform fluorescence detection to determine the genotype of the SNP site of the Chinese cabbage to be tested; (3) Select TT genotype Chinese cabbage for male-sterile Chinese cabbage breeding.

[0015] The primer composition consists of primer A, primer B and primer C; Primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 1 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 22-40 of sequence 1 in the sequence listing; Primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or whose nucleotide sequence is single-stranded DNA at positions 22-41 of sequence 2 in the sequence listing. The primer C nucleotide sequence is a single-stranded DNA molecule of sequence 3 in the sequence listing.

[0016] In the above method, the KASP-PCR reaction was performed on a 384-well OMEGA F SNP genotyping instrument (OMEGA F Reader 96 and 384 well compatible, LGC). The reaction system consisted of 5 μL: 2 μL DNA (20 ng / μL), 1 μL primer mixture (obtained by mixing BrASY1-KASP-F1, BrASY1-KASP-F2 and BrASY1-KASP-R with ddH2O at a volume ratio of 24: 24: 48: 100 at a concentration of 100 μL / mL), and 2 μL KASP Master mix (2×).

[0017] In the above method, the reaction procedure for KASP tags can be: First stage: denaturation at 94 ℃ for 10 min; Second stage: denaturation at 94 ℃ for 20 s, annealing at 61 ℃ for 45 s, for a total of 10 cycles (starting from the second cycle, each cycle decreases by 0.6 ℃); Third stage: denaturation at 94 ℃ for 20 s, annealing at 55 ℃ for 45 s, for a total of 37 cycles; Fourth stage: 25 ℃ for 30 s.

[0018] The method described above for determining the genotype of the SNP in the Chinese cabbage to be tested can be as follows: Genotyping based on KASP technology is performed using LGC_OMEGA's genotyping software (Kluster Caller). SNP locus detection uses the fluorophores FAM and VIC to distinguish between two allogeneic loci. The passive reference dye ROX is used to correct signal differences between wells due to reaction volume errors. VIC and FAM data are plotted on the X and Y axes, respectively. The VIC and FAM values ​​for each reaction well are corrected using the value of the reference dye (ROX) for that specific well. The fluorescence values ​​are standardized to obtain the relative fluorescence values ​​corresponding to VIC and FAM for each PCR reaction well. Based on the relative fluorescence values, the samples are clustered, and the plant genotype is further determined based on the sample clusters and fluorescence type. Specifically, samples marked in red are homozygous for the VIC-labeled allele (CC), samples marked in blue are homozygous for the FAM-labeled allele (TT), and samples marked in green are heterozygous for the CT allele. Samples with no detected signal are located near the origin.

[0019] The application of the method described above in Chinese cabbage breeding also falls within the scope of protection claimed by this invention.

[0020] This invention also provides the application of a substance for detecting SNP polymorphisms or genotypes in the genome of Chinese cabbage in any of the following: (1) To identify or assist in the identification of the fertility of Chinese cabbage; (2) Chinese cabbage breeding; (3) To prepare products for identification or to assist in the identification of the fertility of Chinese cabbage; (4) Prepare products for Chinese cabbage breeding.

[0021] In the above applications, the genotype of the SNP locus can be CC, TT, or CT. CC is the homozygous type of the SNP being C, TT is the homozygous type of the SNP being T, and CT is the heterozygous type of the SNP being both C and T.

[0022] The Chinese cabbage samples with SNP genotypes CC and CT were male-fertile, while those with SNP genotype TT were male-sterile.

[0023] The present invention also provides a product containing the substance described above for detecting the polymorphism or genotype of the SNP in the genome of Chinese cabbage, wherein the product is any one of the following: C1) Products that detect single nucleotide polymorphisms or genotypes related to fertility in Chinese cabbage; C2) Products used for identification or auxiliary identification of the fertility of Chinese cabbage; C3) Products used in Chinese cabbage breeding.

[0024] In the above applications, methods, and products, the substance may be a reagent and / or instrument required to determine the polymorphism or genotype of the SNP site by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chips. The SNP chips include chips based on nucleic acid hybridization reactions, chips based on single-base extension reactions, chips based on allele-specific primer extension reactions, chips based on one-step reactions, chips based on primer ligation reactions, chips based on restriction endonuclease reactions, chips based on protein-DNA binding reactions, and chips based on fluorescent molecule-DNA binding reactions.

[0025] In the above applications and products, the substance may be D1), D2), or D3). D1) The substance is a primer composition for amplifying the genomic DNA fragment of Chinese cabbage, including the SNP site; D2) The substance is a PCR reagent containing the primer composition described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

[0026] In the above applications, methods, and products, the primer composition may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Markers include, but are not limited to, dyes; radioactive markers, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The marker can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, optionally, charge-neutral. The marker can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the marker is detectable. In some embodiments, nucleic acids are detected directly without labeling (e.g., direct sequence reading).

[0027] In one specific embodiment, the primer composition may be a primer composition consisting of single-stranded DNA whose nucleotide sequence is the 22nd-40th position of SEQ ID No: 1 in the sequence listing, single-stranded DNA whose nucleotide sequence is the 22nd-41st position of SEQ ID No: 2 in the sequence listing, and single-stranded DNA whose nucleotide sequence is the sequence 3 in the sequence listing.

[0028] The primer composition may also be a primer set consisting of single-stranded DNA as shown in Sequence 1 of the sequence listing, single-stranded DNA as shown in SEQ ID No: 2 of the sequence listing, and single-stranded DNA as shown in SEQ ID No: 3 of the sequence listing. SEQ ID No: 1 of the sequence listing consists of 40 nucleotides, with nucleotides 1-21 being the VIC adapter sequence (as a marker) and nucleotides 22-40 being the specific sequence; SEQ ID No: 2 of the sequence listing consists of 41 nucleotides, with nucleotides 1-21 being the FAM adapter sequence (as a marker) and nucleotides 22-41 being the specific sequence.

[0029] The present invention also provides a DNA molecule whose nucleotide sequence is SEQ ID No: 4 in the sequence listing.

[0030] This invention also provides for the use of the DNA molecule described above in any of the following: (1) To identify or assist in the identification of the fertility of Chinese cabbage; (2) Chinese cabbage breeding; (3) To prepare products for identification or to assist in the identification of the fertility of Chinese cabbage; (4) Prepare products for Chinese cabbage breeding.

[0031] Optionally, in the above applications, the DNA molecule serves as a detection target.

[0032] The substance that detects the SNP site polymorphism and genotype can be combined with other substances (such as substances that detect single nucleotide polymorphisms or genotypes of other molecular markers related to the fertility of Chinese cabbage) to prepare a product for identifying the fertility of Chinese cabbage varieties.

[0033] In this article, the purpose of breeding may include developing male-sterile Chinese cabbage varieties. The Chinese cabbage may be a variety, a pure line, or an inbred line.

[0034] This invention identifies a novel gene controlling male sterility in the core of Chinese cabbage. BrASY1 The protein ASY1, which encodes the axial element of the synaptic complex, is located in... BrASY1 A base substitution from C to T occurred in the gene (A07: 23,583,978), resulting in the encoding of the amino acid proline changing to serine. Further evidence... BrASY1 By identifying the mutant SNP site of the gene, a KASP molecular marker associated with the fertility of the stamens of this Chinese cabbage was developed, and the detection primer BrASY1-KASP for detecting this marker was published. This marker can be used for marker-assisted breeding of male sterility in Chinese cabbage, providing a new genetic resource for utilizing heterosis in Chinese cabbage. Attached Figure Description

[0035] Figure 1 It consists of two parents, wild-type 'FT' (AD) and a male-sterile mutant. m0121 (EH) Floral organ morphology diagram.

[0036] Figure 2 To identify the gene mapping of male sterility in Chinese cabbage using the MutMap method. (The horizontal axis represents the name and length of each chromosome, and the vertical axis represents the SNP-index value).

[0037] Figure 3 for BrASY1 Gene cloning and sequence differences.

[0038] Figure 4 To utilize the marker BrASY1-KASP to target wild-type 'FT' and male-sterile mutants m0121 The results of KASP genotyping of F1 generation plants are shown in the figure. (The wild-type 'FT' has the genotype CC, indicating fertility; the male-sterile mutant...) m0121 The F1 genotype is TT, which indicates infertility; the F1 genotype is CT, which indicates fertility.

[0039] Figure 5 This image shows the results of KASP genotyping of 187 individual plants in the F2 segregating population using the marker BrASY1-KASP. (Plants with the same genotype as the wild-type 'FT' have the genotype CC and are fertile; those with the male-sterile mutant...) m0121 Plants with the same genotype, but with the genotype TT, are sterile; plants with the same genotype as F1 (heterozygous genotype), but with the genotype CT, are fertile. Detailed Implementation

[0040] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0041] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0042] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0043] Male sterile mutants in the following examples m0121This information is documented in: Dong Shiyao, Cloning and Identification of Male Sterility Mutant Gene in Chinese Cabbage, Doctoral Dissertation, Shenyang Agricultural University, 2024. The biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention; it may not be used for any other purpose.

[0044] The mutagenic material 'FT' in the following examples is a DH line obtained from the early-maturing Chinese cabbage variety 'Futian 50' through microspore culture, as described in: Dong Shiyao, Cloning and Identification of Male Sterile Mutant Gene in Chinese Cabbage, Doctoral Dissertation, Shenyang Agricultural University, 2024. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose.

[0045] Example 1: Investigation of test materials and phenotypic traits Male sterility mutant m0121 The stamens are completely degenerate, the anthers are shriveled and there is no pollen, and all other traits except for the stamens are consistent with those of the wild type 'FT'. Figure 1 ).

[0046] This mutant m0121 By crossing with the wild-type 'FT', and then performing sibling crosses between sterile and fertile plants within the population, a stable, heritable male-sterile dual-purpose line was obtained. Observations in spring and autumn revealed that the sterility trait was not temperature-sensitive. During the vegetative growth stage, 10 wild-type and mutant plants with uniform growth were selected, and head weight, head longitudinal diameter, head transverse diameter, and head index (head longitudinal diameter / head transverse diameter) were measured. The results showed that the mutant... m0121 There was no significant difference from the wild-type 'FT' (Table 1).

[0047] Table 1. Wild-type 'FT' and mutants at the heading stage m0121 agronomic traits

[0048] To study male sterility mutants m0121 The genetic characteristics were analyzed, with the mutant as the maternal parent and the wild type as the paternal parent. The F1 generation plants exhibited the same phenotype as the wild type, showing fertility, indicating that the mutant trait was recessive. The segregation ratio in the F2 generation was 3.56:1 (χ²). 2 = 0.823<χ 2 0.05, 1 = 3.84), which matches the theoretical ratio of 3:1. Genetic analysis indicates that the mutant... m0121 The phenotype is controlled by a single recessive nuclear gene (Table 2).

[0049] Table 2. Male-sterile mutants m0121 Genetic analysis

[0050] Example 2: Genes controlling male sterility in Chinese cabbage BrASY1 Positioning Plant DNA extraction kit (Tiangen Biotech (Beijing) Co., Ltd., catalog number DP320) was used to extract DNA from two parents (wild-type 'FT' and male-sterile mutant). m0121 Genomic DNA was extracted from individual leaves of F1 and F2 populations, following the instructions in the kit. The DNA concentration was detected using a NanoDrop2000 device. The stock DNA solution was diluted to 10 ng / µL and stored at -30 °C.

[0051] With male sterile mutant m0121 An F2 segregating population was constructed using wild-type 'FT' as the parent. After vernalization, the seeds of the F2 segregating population were sown in seedling trays. At full bloom, 50 plants exhibiting a male-sterile phenotype were selected and used to construct an F2 mutant gene pool. Genomic DNA was extracted from leaves of both wild-type 'FT' and the mutant gene pool. High-throughput sequencing of these samples was performed using the Illumina NovaSeq sequencing platform.

[0052] The high-quality sequencing data obtained using bwa software were aligned to the Chinese cabbage reference genome. All potential polymorphic SNP sites were extracted from the genome using GATK software, annotated using ANNOVAR software, and SNP-index values ​​were calculated. Regions exceeding the 95th percentile threshold were selected as candidate regions associated with male sterility. Finally, a candidate region was identified on chromosome A07, with a length of 2.9 Mb (A07: 20,900,000-23,800,000). Figure 2 ), There are a total of 4 SNPs in the region (Table 3). Further screening of SNPs in the localization interval, the screening conditions are as follows: (1) SNP sites that conform to the EMS mutagenesis rules, that is, mutation from C (cytosine) to T (thymine) or mutation from G (guanine) to A (adenine); (2) SNP-index>0.95; (3) Non-synonymous mutations or premature termination occurring on exons.

[0053] Table 3. Information on candidate SNPs within the location area

[0054] Finally, SNPA07: 23,583,978 met the criteria and was located in the gene. BraA07g033770.3.5COn CT, this gene was predicted to be a candidate gene regulating male sterility in Chinese cabbage. It encodes the axial element protein ASY1 of the synaptic complex, which plays an important role in homologous chromosome recognition and pairing. It was named... BrASY1 .

[0055] In wild-type 'FT' and mutants m0121 The full length of the candidate cloned gene was determined, showing that the gene is 2,867 bp in length, containing 14 exons and 13 introns. In the mutant... m0121 In this study, a C-to-T mutation occurred at position 23,583,978 on chromosome A07. Figure 3 ). Figure 3 At position 1935bp, the base in the wild-type 'FT' is C, while in the male-sterile mutant... m0121 The base in it is T. This SNP is named SNP1.

[0056] Example 3 BrASY1 Development of KASP molecular markers Based on the information of the SNP1 site, primers for KASP typing were designed by selecting 100bp sequences upstream and downstream of the SNP1 site to convert the SNP1 site into the KASP marker BrASY1-KASP.

[0057] The BrASY1-KASP marker consists of three primers: BrASY1-KASP-F1 (primer A) and BrASY1-KASP-F2 (primer B) are two allele-specific forward primers, and BrASY1-KASP-R (primer C) is a common reverse primer. BrASY1-KASP-F1 is the fertile genotype-specific primer, and BrASY1-KASP-F2 is the sterile genotype-specific primer.

[0058] BrASY1-KASP-F1:5'- GAAGGTCGGAGTCAACGGATT CAGCCACCAGATTACGAGC-3' (SEQ IDNo: 1); BrASY1-KASP-F2:5'- GAAGGTGACCAAGTTCATGCT GCAGCCACCAGATTACGAGT-3' (SEQID No: 2); BrASY1-KASP-R:5'-CGTCCAGACATGCTGAGCT-3' (SEQ ID No: 3).

[0059] KASP-PCR reactions were performed on a 384-well OMEGA F SNP genotyping instrument (OMEGA F Reader 96 and 384well compatible, LGC). The reaction mixture consisted of 5 μL: 2 μL DNA (20 ng / μL), 1 μL primer mixture (prepared by mixing BrASY1-KASP-F1, BrASY1-KASP-F2 and BrASY1-KASP-R with ddH2O at a volume ratio of 24:24:48:100 at a concentration of 100 μL / mL), and 2 μL KASP Master mix (2×).

[0060] The KASP-PCR amplification program is as follows: Stage 1: denaturation at 94 ℃ for 10 min; Stage 2: denaturation at 94 ℃ for 20 s, annealing at 61 ℃ for 45 s, for a total of 10 cycles (starting from the second cycle, the temperature is reduced by 0.6 ℃ for each cycle); Stage 3: denaturation at 94 ℃ for 20 s, annealing at 55 ℃ for 45 s, for a total of 37 cycles; Stage 4: 25 ℃ for 30 s.

[0061] Genotyping based on KASP technology was performed using LGC_OMEGA's Kluster Caller software. SNP locus detection used the fluorophores FAM and VIC to distinguish between two allogeneic loci. Passive reference dye ROX was used to correct for signal differences between wells due to reaction volume errors. VIC and FAM data were plotted on the X and Y axes, respectively. The VIC and FAM values ​​for each reaction well were corrected using the value of the specific well's reference dye (ROX). Fluorescence values ​​were standardized to obtain the relative fluorescence values ​​for VIC and FAM for each PCR reaction well. Based on the relative fluorescence values, samples were clustered, and the genotype of the plants was further determined based on the sample clusters and fluorescence patterns. Samples marked in red were homozygous for the VIC-labeled allele, samples marked in blue were homozygous for the FAM-labeled allele, and samples marked in green were heterozygous.

[0062] Using the marker BrASY1-KASP to target wild-type 'FT' and mutant 'FT' m0121 Genotyping was performed on F1 generation plants, such as Figure 4 As shown, the signal point for wild-type 'FT' is red, indicating that the genotype at the SNP1 locus is CC; the mutant... m0121 The signal point is blue, indicating that the genotype of SNP1 is TT; the signal point of F1 generation plants is green, indicating that the genotype of SNP1 is heterozygous CT.

[0063] The BrASY1-KASP marker can significantly distinguish between two homozygous genotypes and identify heterozygous genotypes, exhibiting codominance. A method for identifying genotypes using the KASP marker BrASY1-KASP has been successfully developed.

[0064] Example 4 BrASY1 Application of KASP molecular markers in genes The KASP marker BrASY1-KASP identification method developed in Example 3 was used to perform KASP genotyping on 187 F2 segregating populations. The results are shown in Table 4.

[0065] The fertility phenotype of the tested samples was studied using morphological observation combined with pollen viability assessment. The results are shown in Table 4.

[0066] Table 4. Results of SNP1 genotype and fertility phenotype study in 187 F2 segregating populations.

[0067] The results showed that the BrASY1-KASP marker could clearly divide the 187 F2 segregating populations into three groups. Of these, 24 strains showed red signal points, consistent with the wild-type 'FT' genotype, indicating fertility; 49 strains showed green signal points, consistent with the F1 genotype, indicating heterozygotes and also fertility; and 114 strains showed blue signal points, consistent with the mutant genotype. m0121 The genotypes were identical, resulting in infertility. The complete genotype-phenotype match among all materials indicates the usefulness of this marker.

[0068] In summary, the BrASY1-KASP marker can enable high-throughput detection. BrASY1 The genotype of the SNP1 locus can provide a new genetic marker for molecular marker-assisted selection breeding of male sterility in Chinese cabbage. It can be applied to the breeding and utilization of male sterile lines in Chinese cabbage and has important application value.

[0069] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A method for identifying or assisting in the identification of the fertility of Chinese cabbage, characterized in that: This includes detecting the genotype of the SNP site in the genome of the Chinese cabbage to be tested, and identifying or assisting in the identification of the fertility of the Chinese cabbage based on the genotype. The SNP site is an SNP site on chromosome A07 of the Chinese cabbage, and its nucleotide type is C or T, which is the 1935th nucleotide of SEQ ID No: 4 in the sequence listing.

2. A method for breeding Chinese cabbage, characterized by: The method includes detecting the genotype of the SNP in claim 1 in the genome of Chinese cabbage, selecting Chinese cabbage with the genotype TT of the SNP as the parent for male-sterile Chinese cabbage breeding, wherein TT is the homozygous type of the SNP locus T.

3. The application of the method according to claim 1 or 2 in the breeding of Chinese cabbage.

4. Application of substances used to detect SNP polymorphisms or genotypes in the genome of Chinese cabbage in any of the following: (1) To identify or assist in the identification of the fertility of Chinese cabbage; (2) Chinese cabbage breeding; (3) To prepare products for identification or to assist in the identification of the fertility of Chinese cabbage; (4) Prepare products for Chinese cabbage breeding; The SNP site is an SNP site on chromosome A07 of Chinese cabbage, and its nucleotide type is C or T, which is the 1935th nucleotide of SEQ ID No: 4 in the sequence listing.

5. The application according to claim 5, characterized in that: The SNP has a genotype of CC, TT, or CT, where CC is the homozygous type of the SNP being C, TT is the homozygous type of the SNP being T, and CT is the heterozygous type of the SNP being both C and T. The Chinese cabbage tested with genotypes CC and CT of the SNP is male-fertile, and the Chinese cabbage tested with genotype TT of the SNP is male-sterile.

6. The product, characterized in that: The product contains the substance described in claim 5 or 6, wherein the product is any one of the following: C1) Products that detect single nucleotide polymorphisms or genotypes related to fertility in Chinese cabbage; C2) Products used for identification or auxiliary identification of the fertility of Chinese cabbage; C3) Products used in Chinese cabbage breeding.

7. The application according to claim 4 or 5, or the product according to claim 6, characterized in that: The substance is either D1), D2), or D3). D1) The substance is a primer composition for amplifying the genomic DNA fragment of Chinese cabbage, including the SNP site; D2) The substance is a PCR reagent containing the primer composition described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

8. The application according to claim 7, characterized in that: The primer composition consists of primer A, primer B and primer C; Primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 1 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 22-40 of sequence 1 in the sequence listing; Primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or whose nucleotide sequence is single-stranded DNA at positions 22-41 of sequence 2 in the sequence listing. The primer C nucleotide sequence is a single-stranded DNA molecule of sequence 3 in the sequence listing.

9. A DNA molecule, characterized by: The nucleotide sequence of the DNA molecule is SEQ ID No: 4 in the sequence listing.

10. The use of the DNA molecule of claim 9 in any of the following: (1) To identify or assist in the identification of the fertility of Chinese cabbage; (2) Chinese cabbage breeding; (3) To prepare products for identification or to assist in the identification of the fertility of Chinese cabbage; (4) Prepare products for Chinese cabbage breeding.

Images