Construction method of Keshan disease rat model

Abstract

The invention provides a construction method of a Keshan disease rat model, and belongs to the field of animal model construction. The construction method of the rat model comprises the following steps: constructing a rat of which the 874th basic group G of the SEPHS2 gene is deleted; the SEPHS2 gene is characterized in that the transcript number of the SEPHS2 gene is ENSRNOTT00000074114.3, and the SEPHS2 gene has a nucleotide sequence shown in The research finds that c.874delG mutation of the SEPHS2 gene is obviously related to Keshan disease in cardiomyopathy. After the 874th basic group G of the SEPHS2 gene of the SD rat is deleted, the obtained SD rat has dilated cardiomyopathy change with obvious systolic failure, which is a typical Keshan disease myocardial damage expression. Therefore, a cardiomyopathy model, especially a Keshan disease model, can be prepared by performing c.874delG mutation on the SEPHS2 gene of the SD rat, a model basis can be provided for cardiomyopathy research, especially Keshan disease research, and a good application prospect is achieved.

Description

Technical Field

[0001] This invention belongs to the field of animal model construction, specifically relating to a method for constructing a Keshan disease rat model. Background Technology

[0002] Keshan disease (KD) is an endemic cardiomyopathy characterized by myocardial degeneration and necrosis. Clinically, it manifests as acute or chronic congestive heart failure and various arrhythmias, and in severe cases, can lead to cardiogenic shock and even death. The etiology of Keshan disease is not fully understood, and it is difficult to differentiate from dilated cardiomyopathy (DCD) clinically. Furthermore, Keshan disease has a poor clinical prognosis, placing a burden on families and society. Therefore, elucidating the pathogenesis of Keshan disease and proposing effective prevention and intervention measures are crucial for improving its prognosis.

[0003] Regarding hypotheses about the etiology of Keshan disease, one hypothesis is the nutritional biogeochemical etiology hypothesis, which primarily posits that selenium deficiency is the main pathogenic factor. Another category is the biological etiology hypothesis, mainly including viral infections such as Coxsackievirus. However, neither hypothesis satisfactorily explains the pathogenesis and clinical characteristics of Keshan disease. A significant problem in Keshan disease research is the lack of suitable Keshan disease models.

[0004] Finding a method to construct a model of Keshan disease is of great significance for research on the pathogenesis and treatment of Keshan disease. Summary of the Invention

[0005] The purpose of this invention is to provide a method for constructing a rat model of Keshan disease.

[0006] This invention provides a method for constructing a rat model of cardiomyopathy, wherein the method involves constructing rats with a G deletion at base 874 of the SEPHS2 gene; the transcript number of the SEPHS2 gene is ENSRNOTT00000074114.3; the construction method is as follows: (1) Rat zygotes with G deletion at position 874 of the SEPHS2 gene were constructed using CRISPR / Cas9 technology and positive F0 generation rats were obtained by culturing; the sequence of the sgRNA used in the CRISPR / Cas9 technology is shown in SEQ ID NO:1; (2) Cross positive F0 generation rats with wild-type rats to obtain positive F1 generation rats, which are the rat models.

[0007] Furthermore, in step (1), the sequence of the targeting vector used in the CRISPR / Cas9 technology is shown in SEQ ID NO:2.

[0008] Furthermore, steps (1) and (2) include further identification of the obtained rat genotypes.

[0009] Furthermore, the identification method includes: taking a rat tail gene, amplifying the target sequence by PCR, and determining the gene mutation status by sequencing the PCR amplification product; the forward primer sequence used for identification is shown in SEQ ID NO:3; the reverse primer sequence is shown in SEQ ID NO:4.

[0010] Furthermore, the rats are SD rats.

[0011] Furthermore, the cardiomyopathy rat model is a Keshan disease rat model.

[0012] The present invention also provides the use of a rat model of cardiomyopathy obtained by the aforementioned construction method in cardiomyopathy research.

[0013] Furthermore, the cardiomyopathy described is Keshan disease.

[0014] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention reveals a significant association between the c.874delG mutation in the SEPHS2 gene (i.e., deletion of the G at base 874 in the coding region of the SEPHS2 gene) and Keshan disease, a type of cardiomyopathy. Deletion of the G at base 874 in the SEPHS2 gene of SD rats resulted in dilated cardiomyopathy-like changes in the SD rats, accompanied by significant systolic dysfunction, a typical manifestation of Keshan disease-related myocardial damage. Therefore, inducing the c.874delG mutation in the SEPHS2 gene of SD rats can establish a cardiomyopathy model, particularly a Keshan disease model, providing a model basis for cardiomyopathy research, especially Keshan disease research, and showing promising application prospects.

[0015] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.

[0016] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following embodiments. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Detailed Implementation

[0017] The raw materials and equipment used in this invention are all known products, obtained by purchasing commercially available products.

[0018] Example 1: Construction of a Keshan disease rat model This invention uses SD rats as the research subject.

[0019] The SEPHS2 gene (mouse-derived) is located on the reverse strand of chromosome 1, with a full length of approximately 2.3 kb and NCBI ID: 308993. The SEPHS2 gene (mouse-derived) transcript referenced in this invention is numbered ENSRNOTT00000074114.3.

[0020] I. Design Scheme 1. Targeting strategy Rat mice with point mutation gene knock-in were prepared by Biocytogen using the EGE system developed based on CRISPR / Cas9. The sgRNA was designed in the 3' UTR, and the actual sizes of the 5' and 3' homologous arms of the targeting vector used for homologous recombination were 1.4 kb and 1.0 kb, respectively.

[0021] 2. Southern Imprint Screening Strategy To screen for gene-targeted rats that have undergone correct recombination, this invention employs PCR and Southern blotting for verification, using 3' probes and LR probes to verify F1 generation positive rats. The specific design of the Southern blotting screening method is shown in Table 1.

[0022] Table 1. Specific Design of Southern Imprint Screening BglII and ScaI were used as restriction enzyme sites in Southern blotting. A 3' probe was used to detect whether correct recombination occurred. If correct recombination occurred, two bands (wild-type and mutant) would appear. An LR probe was used to detect whether random insertion was present. If no random insertion was present, two bands (wild-type and mutant) would appear.

[0023] II. Model Preparation 1. Sequencing confirmation of target sequence and design of sgRNA The target gene DNA sequences may differ between different strains. To ensure the correctness of the designed Cas9 / sgRNA, the target gene DNA sequence of the SD mouse tail was first amplified by PCR and sequenced for verification. The verification results showed that the sgRNA target sequence was completely consistent with the standard sequence provided by the Genebank database.

[0024] Based on the design principles of sgRNA, one sgRNA was designed in the target site region, and its corresponding target sequence (SEQ ID NO:1) is shown below: GCTGCCGGCATAGTGCCTCTAGG (5'-3').

[0025] 2. Construction of the target carrier A targeting vector was constructed, and its correct construction was confirmed by enzyme digestion and sequencing. A targeting vector for microinjection was then prepared. The sequence of the targeting vector (SEQ ID NO:2) is shown below: agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggcacgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc tcactcattaggcaccccag gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa ttgtgagcgg ataacaatttcacacaggaa acagctatga ccatgattac gccaagctat ttaggtgacg cgttagaata ctcaagctatgcatcaagct tatccgacgc tttaggagtg aataccttta agaaggagat atacatgaat tcccagagcttccttctata agtaacttat tcttcggtaa agcgattcca tgactttggt agaggtgact tccccccagccaactcaaag accaggttca cagtggaatg gggggaaggg aacacgacac gcacaggtaa cgtggctcccacctgtaaca ccagcactta ggaatctgag acagacagat ggatgcgagt tcgagttcat cctgatctatacagagaact gcgttccagg ccagttacaa gggattcacg tgacgacctc gcggggaccg gtggtgcaagcagacggtta atttgttata cacctttttg aataaaggaa gcccgcctct cggtacgaga atgatcattggatggagcga ctgtcaatca tgctgtatat aaatacaggc cgctcggcgc tcggacaggc agcgtggcttgagtcttccg atcggtttct cttggtagat catctccagg cctaaccttt acccaccgtg gcaattagaatcgcctgcag gtaccagggc cttctggttc gcacggcctc ccgggcgggc ggtgcgatgg cggaagcggcggcaggcgcc agcggagaagccatggcggc actagtggcc gcggaaggtt ccttgggccc ggcgggctggtctgctggcc ggagtttctc caactaccgg ccgttcgagc cccagacact gggcttcagc ccgagctggcggctgacgag cttctccggc atgaaaggct gaggctgcaa ggtcccccag gagaccctgc tcaaactcctggagggactg acgcggcccg cgctgcagcc cccgcttacc tcgggtctgg tcgggggcca ggaagagacggtgcaggaag ggggcctgac caccaggccc ggcccgggct cagccttccc ctcgctgagc attgggatggactcctgcgt catccccctg aggcacggag gcctgtcgct ggtgcagacc accgacttct tttaccccttggtggaagat ccctatatga tggggcgcat agcttgtgcc aatgtgctca gtgacctcta tgccatgggcattaccgagt gtgacaacat gttgatgtta ctcagtgtga gccagagcat gagtgaaaag gaacgagagaaggtaacgcc gctcatgatc aaaggctttc gtgacgctgc ggaagaggga ggaactgcag tgactggtggacagacagtg gtcaaccctt ggattatcat cggtggggtt gccactgtgg tgtgtcagca aaatgaattcataatgcctg acagcgctgt ggtaggagat gtgctggtat taaccaagcc tttaggaacc caggttgctgccaatgccca ccaatggctg gataatcctg agaaatggaa taaaatcaag atggtggttt ccagagaggaagtagagcta gcctatcaga agctatgttc aacatggcta ctctgaacag gactgctgct ggcttgatgcacacttttaa tgctcacgca gccacggatatcacaggctt tggcatatta ggacactccc agaacctcgcaaacagcaa aaaaatgaag tgtccttgt cattcacaat ctgccaatca tgccaagat tggctcctcctc caggaacat cagccactgaggagaac ct agaacaggcg gcccgctttt gttcggaaat caaatctcc aagtacggag agggtcaccaagcttgttgtcg tggagaaggg aaaccggaca gcccggatca tgacagcc tcgcttattgaagttctac ctcggggagc ttcgcctcagtct gctcgggagc gcctctgagcctagttcttg aagatctatg catagtactg agctcaatgg atagccctt gttgggaact cggagccattctacacgctc acagactgtt ggccaggtt gattttaaga cctttccaa ggctgccgc atagcctcctagctactcctt gtcagcgt tcagctagc agaagtgcag gggatgtgtgctcatctgtt gagagaatga ggagtaaaa aaccttttcc haaagcaaga tgaggtatt ccagttttaggttttg cactgagttg atcattct gcacagggag taagattatt agattacatacat acagaaggatacaacaaaactcat tgataagtct aaattgttag gagaactcttacttat tgtcaaattt gtcattaatttttctga gcaactgcct ctttcctgt tctgagcaagtgagcaa cttgtccagc caggaagga aggccatagccacctgactt ggtctctgat aatgatgtttctccctttaa ctcctaataa ggactgggag aggctgatca aacctcagag ccaggtgttg gcggccgttaagatactaaa tcttacactg aaaatttcca gagatttaat taataaaaaa aatttcttaa cagctaactaataaaaggg actttgttgg aaaactcttg tggctaatgc ttggttctgt gggtcacttt atcttgtttcagacaggttc ttgggtcctg gagaatggcc ttgaaccctt gatgttgctt ctgcctccaa tctgctgccaggaccagctg gaactctgac ttcttatccc ttgacattgc acccagagcc tgcagaatag aaagtagatgttgcccttgc ccctgagcca agggatttgg gtttgcactg tccccccgaga tgaaaaaga ggactcgaatggatataaat tctggagatt ttagggggaa aaaaacttaa aagatggctt aggagcatag aagaggccatctgaagatgg ggacgataac caaaagctct agaaggattc agtgaggtga aggcaaggag ttggcatgagaagagacggt ggctaaaagc ttgtaataca gggggatcct gagatccgg tgctaacaac cgacgctttaggagtgaata cctctagagg gcccaattcg ccctatagtg agtcgtatta caattcactg gccgtcgttttacaacgtcg tgactgggaa aaccctggcg ttacccaact taatcgcctt gcagcacatc cccctttcgccagctggcgt aatagcgaag aggcccgcac cgatcgccct tcccaacagt tgcgcagcct atacgtacggcagtttaagg tttacaccta taaaagagag agccgttatc gtctgtttgtggatgtacag agtgatattattgacacgcc ggggcgacgg atggtgatcc ccctggccag tgcacgtctg ctgtcagata aagtctcccgtgaactttac ccggtggtgc atatcgggga tgaaagctgg cgcatgatga ccaccgatat ggccagtgtgccggtctccg ttatcgggga agaagtggct gatctcagcc accgcgaaaa tgacatcaaa aacgccattaacctgatgtt ctggggaata taaatgtcag gcatgagatt atcaaaaagg atcttcacct agatccttttcacgtagaaa gccagtccgc agaaacggtg ctgaccccgg atgaatgtca gctactgggc tatctggacaagggaaaacg caagcgcaaa gagaaagcag gtagcttgca gtgggcttac atggcgatag ctagactgggcggttttatg gacagcaagc gaaccggaat tgccagctgg ggcgccctct ggtaaggttg ggaagccctgcaaagtaaac tggatggctt tcttgccgcc aaggatctga tggcgcaggg gatcaagctc tgatcaagagacaggatgag gatcgtttcg catgattgaa caagatggat tgcacgcagg ttctccggcc gcttgggtggagaggctatt cggctatgac tgggcacaac agacaatcgg ctgctctgat gccgccgtgt tccggctgtcagcgcagggg cgcccggttc tttttgtcaa gaccgacctg tccggtgccc tgaatgaact gcaagacgaggcagcgcggc tatcgtggct ggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaagcgggaaggga ctggctgcta ttgggcgaag tgccggggca ggatctcctg tcatctcaccttgctcctgccgagaaagta tccatcatgg ctgatgcaat gcggcggctg catacgcttg atccggctac ctgcccattcgaccaccaag cgaaacatcg catcgagcga gcacgtactc ggatggaagc cggtcttgtc gatcaggatgatctggacga agagcatcag gggctcgcgc cagccgaact gttcgccagg ctcaaggcga gcatgcccgacggcgaggat ctcgtcgtga cccatggcga tgcctgcttg ccgaatatca tggtggaaaa tggccgcttttctggattca tcgactgtgg ccggctgggt gtggcggacc gctatcagga catagcgttg gctacccgtgatattgctga agagcttggc ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg ccgctcccgattcgcagcgc atcgccttct atcgccttct tgacgagttc ttctgaatta ttaacgctta caatttcctgatgcggtatt ttctccttac gcatctgtgc ggtatttcac accgcatcag gtggcacttt tcggggaaatgtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta tccgctcatg agacaataaccctgataaat gcttcaataa tagcacgtga ggagggccac catggccaag ttgaccagtg ccgttccggtgctcaccgcg cgcgacgtcg ccggagcggt cgagttctgg accgaccggc tcgggttctc ccgggacttcgtggaggacg acttcgccgg tgtggtccgg gacgacgtga ccctgttcat cagcgcggtc caggaccaggtggtgccgga caacaccctg gcctgggtgt gggtgcgcgg cctggacgag ctgtacgccgagtggtcggaggtcgtgtcc acgaacttcc gggacgcctc cgggccggcc atgaccgaga tcggcgagca gccgtggggcgggagttcg ccctgcgcga cccggccggc aactgcgtgc acttcgtggc cgaggagcag gactgacacgtgctaaact tcatttttaa tttaaaagga tctaggtgaa gatccttttt gataatctca tgaccaaaaatcccttaacgt gagttttcgt tccactgagc gtcagacccc gtagaaaaga tcaaaggatc ttcttgagatccttttttc tgcgcgtaat ctgctgcttg caaacaaaaa aaccaccgct accagcggtg gtttgtttgccggatcaaga gctaccaact cttttccga aggtaactgg cttcagcaga gcgcagatac caaatactgttcttctagtg tagccgtagt taggccacca cttcaagaac tctgtagcac cgcctacata cctcgctctgctaatcctgt taccagtggc tgctgccagt ggcgataagt cgtgtcttac cgggttggac tcaagacgatagttaccgga taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca cagcccagct tggagcgaacgacctacacc gaactgagat acctacagcg tgagctatga gaaagcgcca cgcttcccga agggaaaaggcggacaggt atccggtaag cggcagggtc ggaacaggag agcgcacgag ggagcttcca gggggaaacgcctggtatct ttatagtcct gtcgggtttc gccacctctg acttgagcgt cgatttttgt gatgctcgtcaggggggcgg agcctatgga aaaacgccag caacgcggcc tttttacggt tcctggccttttgctggccttttgctcaca tgttctttcc tgcgttatcc cctgattctg tggataaccg tattaccgcc tttgagtgagctgataccgc tcgccgcagc cgaacgaccg agcgcagcga gtcagtgagc gaggaagcgg aag 3. Microinjection CRISPR / Cas9-related reagents, such as sgRNA and targeting vectors, were microinjected into 222 rat zygotes, and F0 generation rats were born after injection.

[0026] 4. Genotyping of F0 generation rats This invention uses sgRNA injection into fertilized eggs to prepare gene point mutation knock-in rats. Due to the rapid cleavage rate in early embryonic development, the resulting F0 rats are chimeras. Therefore, the F0 genotype obtained by identifying the tail of the F0 rat is for reference only and does not necessarily represent a heritable gene mutation. The heritable genotype needs to be determined after testing the tail of the F1 rat.

[0027] 4.1 Primer Design for Identification Primer information is shown in Table 2: Table 2. Primer Information PCR conditions are shown in Table 3: Enzyme: KOD-FX Table 3. PCR conditions 4.2 Genotyping of F0 generation rat tails The obtained F0 generation rats were subjected to tail genotyping according to the PCR conditions in section 4.1. Three positive F0 generation rats were obtained through PCR amplification and product sequencing.

[0028] 5. Genotyping of F1 generation rats The F0 generation rats that tested positive were mated with wild-type SD rats to obtain F1 generation rats with stable genotypes. The tail genotypes of the F1 generation rats were identified using the same methods as for the F0 generation rats. Eight positive F1 generation rats were obtained.

[0029] 5.1 Southern blot detection in F1 generation PCR-positive rats DNA was extracted from the tails of F1 generation rats that tested positive in the initial PCR screening and then analyzed by Southern blot. Southern blot analysis revealed that all positive F1 generation rats underwent correct recombination and contained no random insertions. These rats were all SD rats with the c.874delG mutation in the SEPHS2 gene.

[0030] III. The relationship between the c.874delG mutation in the SEPHS2 gene and Keshan disease Echocardiography was used to examine SD rats with the c.874delG mutation in the SEPHS2 gene (the eight positive F1 generation rats mentioned above) and wild-type rats (two rats) to observe whether the Keshan disease model was successfully established. LVIDd (left ventricular end-diastolic diameter) and EF (ejection fraction) are important echocardiographic markers for the successful establishment of the Keshan disease myocardial injury model. Echocardiography was performed on two wild-type SD rats and eight positive F1 generation SD rats with the c.874delG mutation in the SEPHS2 gene. The results are shown in Tables 4-13.

[0031] Table 4. Ultrasound detection results of wild-type SD rats (M224) Table 5. Ultrasound detection results of wild-type SD rats (M229) Table 6. Ultrasound detection results of positive F1 rats (B204) Table 7. Ultrasound detection results of positive F1 rats (B203) Table 8. Ultrasound detection results of positive F1 rats (B206) Table 9. Ultrasound detection results of positive F1 rats (B205) Table 10. Ultrasound detection results of positive F1 rats (B202) Table 11. Ultrasound detection results of positive F1 rats (B201) Table 12. Ultrasound detection results of positive F1 rats (B207) Table 13. Ultrasound detection results of positive F1 rats (B208) Based on the echocardiographic results of the SD rats, compared with wild-type rats, SD rats with the c.874delG mutation in the SEPHS2 gene showed a significantly increased LVIDd (left ventricular end-diastolic diameter) and a significantly decreased EF (ejection fraction), indicating that the SD rats exhibited dilated cardiomyopathy-like changes accompanied by significant systolic dysfunction. This is a typical manifestation of myocardial damage in Keshan disease. Therefore, the Keshan disease model in SD rats was successfully established.

[0032] In summary, this study found that the c.874delG mutation in the SEPHS2 gene (i.e., deletion of the G at base 874 in the coding region of the SEPHS2 gene) is significantly associated with Keshan disease, a type of cardiomyopathy. Deletion of the G at base 874 in the SEPHS2 gene of SD rats resulted in dilated cardiomyopathy-like changes in the SD rats, accompanied by significant systolic dysfunction, which is a typical manifestation of myocardial damage in Keshan disease. Therefore, inducing the c.874delG mutation in the SEPHS2 gene of SD rats can establish a cardiomyopathy model, particularly a Keshan disease model, providing a model basis for cardiomyopathy research, especially Keshan disease research, and has promising application prospects.

Claims

1. A method for constructing a rat model of cardiomyopathy, characterized in that: The construction method involves creating rats with a G deletion at base 874 of the SEPHS2 gene; the SEPHS2 gene transcript number is ENSRNOTT00000074114.3; the construction method is as follows: (1) Rat zygotes with G deletion at position 874 of the SEPHS2 gene were constructed using CRISPR / Cas9 technology and positive F0 generation rats were obtained by culturing; the sequence of the sgRNA used in the CRISPR / Cas9 technology is shown in SEQ ID NO:1; (2) Cross positive F0 generation rats with wild-type rats to obtain positive F1 generation rats, which are the rat models.

2. The construction method according to claim 1, characterized in that: In step (1), the sequence of the targeting vector used in the CRISPR / Cas9 technology is shown in SEQ ID NO:

2.

3. The construction method according to claim 1, characterized in that: Steps (1) and (2) include further identification of the obtained rat genotypes.

4. The construction method according to claim 3, characterized in that: The identification method includes: taking a rat tail gene, amplifying the target sequence by PCR, and determining the gene mutation status by sequencing the PCR amplification product; the forward primer sequence used for identification is shown in SEQ ID NO:3; the reverse primer sequence is shown in SEQ ID NO:

4.

5. The construction method according to any one of claims 1 to 4, characterized in that: The rats in question were SD rats.

6. The construction method according to any one of claims 1 to 4, characterized in that: The rat model of cardiomyopathy is the Keshan disease rat model.

Images