Pharmaceutical composition of CD30 targeted drug combined glycosphingolipid synthesis inhibitor, preparation method and application

Abstract

The invention relates to the field of biological medicine, and provides a medicine composition for treating tumors and application. The pharmaceutical composition comprises a first active component and a second active component, the first active component comprises a CD30 targeted drug and a pharmaceutically acceptable small molecule compound / salt thereof, the CD30 targeted drug comprises at least one of CD30 CAR-T cells and vibtuximab, and the second active component comprises a pharmaceutically acceptable small molecule compound / salt thereof and a pharmaceutically acceptable small molecule compound / salt thereof, and the CD30 targeted drug comprises at least one of CD30 CAR-T cells and vibtuximab. The second active component comprises a glycosphingolipid synthesis inhibitor and a pharmaceutically acceptable small molecule compound / salt thereof, the glycosphingolipid synthesis inhibitor comprises at least one of eaglukast and meglumine, and the research finds that the combination of the CD30 targeted drug and the glycosphingolipid synthesis inhibitor has a synergistic effect. The invention provides an effective drug combination strategy for tumor treatment, and has a good application prospect in tumor treatment drug selection.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and more specifically, to a pharmaceutical composition, preparation method and application of a CD30-targeting drug combined with a glycosphingolipid synthesis inhibitor. Background Technology

[0002] CD30 (also known as TNFRSF8) is a member of the tumor necrosis factor receptor superfamily. As a type I transmembrane glycoprotein, CD30 expression is highly restricted in normal tissues, but it exhibits sustained and high-level specific expression on the surface of various lymphoma cells, especially on tumor cells of classical Hodgkin lymphoma (cHL) and anaplastic large cell lymphoma (ALCL). Therefore, CD30 has become an ideal tumor target.

[0003] CD30-targeted drugs refer to drugs that can precisely target the CD30 tumor target. Common targeted therapies include CAR-T cell therapy and antibody-drug conjugate therapy. CAR-T cell therapy uses genetic engineering technology to introduce chimeric antigen receptors (CARs) that specifically recognize tumor cell surface antigens into T cells, thereby endowing T cells with the ability to precisely target and efficiently kill tumor cells. CAR-T cell therapies targeting CD19 and BCMA have shown remarkable efficacy in treating B-cell lymphoma, leukemia, and multiple myeloma. After the modified CAR-T cells are reinfused into the patient, they can precisely recognize and bind to CD30-positive tumor cells, directly lysing tumor cells by activating the killing function of T cells (such as releasing perforin and granzymes), while simultaneously reducing the risk of relapse through long-term monitoring via immune memory effects.

[0004] Brentuximab vedotin (BV) is an antibody-drug conjugate (ADC) composed of an anti-CD30 monoclonal antibody and a microtubule disruptor (MMAE, a cytotoxic drug) linked by a linker. Its mechanism of action is as follows: the anti-CD30 antibody partially and specifically binds to CD30 on the surface of tumor cells, enters the cell via endocytosis, and the linker breaks down inside the cell, releasing MMAE, which disrupts the microtubule structure of tumor cells, ultimately leading to tumor cell apoptosis.

[0005] Glycosylation modifications regulate protein stability, signal transduction, and cell-cell interactions. Abnormal glycosylation is a typical feature of malignant tumors. Membrane proteins and lipid glycans may mask antigenic epitopes, blocking tumor antigen-specific T cell recognition and interaction, allowing tumor cells to escape immune surveillance. However, there are currently no reports on the combined use of glycosphingolipid synthesis inhibitors and CD30-targeting drugs in lymphoma. Summary of the Invention

[0006] In view of this, the purpose of the present invention is to provide a pharmaceutical composition for treating tumors, wherein the combination of a CD30-targeting drug and a glycosphingolipid synthesis inhibitor can significantly improve the tumor-killing efficacy of the pharmaceutical composition.

[0007] This invention provides a pharmaceutical composition for treating tumors, comprising:

[0008] The first active ingredient comprises a CD30-targeting drug and a pharmaceutically acceptable small molecule compound / salt thereof, wherein the CD30-targeting drug comprises at least one of CD30 CAR-T cells and brentuximab vedotin.

[0009] The second active ingredient comprises a glycosphingolipid synthesis inhibitor and a pharmaceutically acceptable small molecule compound / salt thereof, wherein the glycosphingolipid synthesis inhibitor comprises at least one of eligluvir and megluvir.

[0010] In some embodiments, the CD30 CAR-T cells include a coding sequence targeting a CD30 CAR, as shown below:

[0011]

[0012] In some embodiments, the coding sequence of the CD30 CAR includes at least one of the following sequences: CD8a signal peptide sequence SEQ ID NO: 2, CD30-targeting single-chain antibody sequence SEQ ID NO: 3, CD8α hinge region sequence SEQ ID NO: 4, co-stimulatory molecule signal region sequence SEQ ID NO: 5, and CD3zeta signal region sequence SEQ ID NO: 6.

[0013] In some embodiments, the sequence of the CD8a signal peptide is shown below:

[0014] ATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTGGCCTTGCTGC TCCACGCCGCCAGGCCG (SEQ ID NO: 2).

[0015] In some embodiments, the single-chain antibody targeting CD30 is a BerH2 antibody, with the sequence shown below:

[0016] CTTCACGAGTCTGGGGCTGAAGTGGCAAAACCTGGGGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTTACTACCTACTGGATGCACTGGATAAAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGATACATTAATCCTAGCACTGGTTATACTGACTACAATCAGAACTTCAAGGACAAGGCCACATTGACTGCAGACAAATCCTCCAGAACAGCCTACATGCAACTGAGCAGCCTGACATCTGAGGACTCTACAGTCTATTACTGTACAAGAAGGGGACCCTCGTATGGTAACCACGGGGCCTGGTTTCCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCAGTCTCGAGCGGTGGAGGCGGTTCAGGCGGAGGTGGCAGCGGCGGTGGCGGGTCGACGAACATTGTAATGACCCAATCTCCCAGATCCATGTCCATGTCTGTAGGAGAGAGGGTCACCTTGAGCTGCAAGGCCAGTGAGAATGTGGATACTTATGTATCCTGGTATCAACAGAAACCAGAGCAGTCTCCTAAACTCCTGATATACGGGGCATCCAACCGGTACACTGGGGTCCCCGATCGCTTCACAGGCAGTGGATCTGCAACAGATTTCACTCTGACCATCAGCAGTGTGCAGGCTGAAGACCTTGCAGATTATCACTGTGGACAGAGTTACAGATATCCTCCCACGTTCGGAGGGGGGACCAAGCTGGAAATA(SEQ ID NO:3)。

[0017] In some embodiments, the sequence of the CD8α hinge region is as follows: ACCACGACGCCAGCGCCGCGACCACCAACACCGGCGCCCACCATCGCGTCGCAGCCCCTGTCCCTGCGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGCGCAGTGCACACGAGGGGGCTGGACTTCGCCTGTGATATCTACATCTGGGCGCCCTTGGCCGGGACTTGTGGGGTCCTTCTCCTGTCACTGGTTATCACCCTTTACTGC (SEQ ID NO: 4).

[0018] In some embodiments, the co-stimulatory molecule is 4-1BB, and the sequence of its signal region is shown below:

[0019] AAACGGGGCAGAAAGAAACTCCTGTATATTCAAACAACCATTT ATGAGACCAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGA TTTCCAGAAGAAGAAGAAGGAGGATGTGAACTG (SEQ ID NO: 5).

[0020] In some embodiments, the sequence of the CD3 zeta signal region is as follows:

[0021] AGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGG CCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCTCGC(SEQ ID NO: 6).

[0022] In some embodiments, when the glycosphingolipid synthesis inhibitor and the CD30-targeting drug are administered in combination, the glycosphingolipid synthesis inhibitor is administered first, followed by the CD30-targeting drug.

[0023] In another aspect of the present invention, the present invention provides a method for preparing the aforementioned pharmaceutical composition, comprising the following steps:

[0024] a) The coding sequence of CD30 CAR is cloned into a lentiviral vector to form a CD30 CAR-targeting vector;

[0025] b) Prepare CD30-targeted recombinant lentivirus products by co-transfection of CD30-targeted CAR vector and lentivirus packaging plasmid;

[0026] c) After activating human peripheral blood mononuclear cells, add CD30-targeted CAR recombinant lentiviral products to culture to obtain CD30-targeted CAR-T cells, and prepare at least one of CD30-targeted CAR-T cells or brentuximab vedotin into a first formulation;

[0027] The glycosphingolipid synthesis inhibitor was prepared into a second formulation to obtain the pharmaceutical composition of the present invention.

[0028] In some specific embodiments of the present invention, in step a), the lentiviral vector includes at least one of pRRLSIN-CMV-GFP, FUGW, pLenti6 / V5-D-TOPO, pRRLSIN-mCherry, and pLenti-CMV-EGFP-2A-Puro, preferably pRRLSIN-CMV-GFP.

[0029] In some specific embodiments of the present invention, in step b), the lentiviral packaging plasmid includes at least one of the second-generation lentiviral packaging plasmids pMD2.G and psPAX2, or the third-generation lentiviral packaging plasmids pMDlg, pRRE and pRSV-Rev. Preferably, in the present invention, the lentiviral packaging plasmid includes pMD2.G and psPAX2.

[0030] In another aspect of the invention, the invention provides the use of the aforementioned pharmaceutical composition or the pharmaceutical composition prepared by the aforementioned preparation method in the preparation of a drug for treating tumors.

[0031] In some of these embodiments, the tumor being prevented or treated is CD30-positive lymphoma.

[0032] In some of these embodiments, the CD30-positive lymphoma includes at least one of Hodgkin's lymphoma, anaplastic large cell lymphoma, peripheral T-cell lymphoma, diffuse large B-cell lymphoma, primary mediastinal large B-cell lymphoma, mycosis fungoides, or lymphomatoid papulosis. Attached Figure Description

[0033] Figure 1 The image shows the results of the killing rate of KMH2 cells when CD30 CAR-T cells were used in combination with iligrolucept.

[0034] Figure 2 The image shows the results of the killing rate of L1236 cells when CD30 CAR-T cells were used in combination with iligrolucept.

[0035] Figure 3 The image shows the results of the killing rate of KMH2 cells when CD30 CAR-T cells and megroot are used in combination.

[0036] Figure 4 A statistical graph showing the results of detecting the level of cytokine IFNγ by enzyme-linked immunosorbent assay for the combined use of CD30 CAR-T cells and iliglusil.

[0037] Figure 5 A statistical graph showing the results of detecting TNFα levels by enzyme-linked immunosorbent assay (ELISA) for the combined use of CD30 CAR-T cells and iliglusil.

[0038] Figure 6 A statistical graph showing the results of detecting the level of cytokine IL-2 by enzyme-linked immunosorbent assay for the combined use of CD30 CAR-T cells and iliglucalcide.

[0039] Figure 7 To investigate the combined use of CD30-targeting CAR-T cells and iligluvir, Granzyme B was statistically analyzed using CAR-T cell cytotoxicity assays. + A graph showing the percentage of CAR-T cells.

[0040] Figure 8 To investigate the combined use of CD30-targeting CAR-T cells and iligluvir, CAR-T cell cytotoxicity assays were conducted to statistically analyze CD107a. + A graph showing the percentage of CAR-T cells.

[0041] Figure 9 The graph shows the tumor volume growth curves of KMH2 tumor-bearing NSG mice in each experimental group.

[0042] Figure 10 Statistical graph showing the killing rate of KMH2 cells when brentuximab and iligrolucept are used in combination;

[0043] Figure 11 Statistical chart showing the killing rate of Karpas-299 cells when brentuximab and iligrolucept are used in combination. Detailed Implementation

[0044] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0045] The applicant's long-term research revealed that while low-dose glycosphingolipid synthesis inhibitors do not directly induce tumor cell apoptosis, they can enhance the killing effect of CD30-targeting drugs on CD30-positive tumor cells, increase the activity of CAR-T cell-secreted effector factors, and improve the efficacy of brentuximab vedotin. In in vitro co-culture systems of tumor cells and CAR-T cells, as well as in anti-tumor mouse models, the use of glycosphingolipid synthesis inhibitors enhanced the tumor-killing efficacy of CD30-targeting drugs against CD30-positive tumor cells without observing any additional toxicity.

[0046] [Pharmaceutical Composition]

[0047] In view of this, the present invention provides a pharmaceutical composition for treating tumors, the pharmaceutical composition comprising a first active ingredient, the first active ingredient comprising a CD30-targeting drug and a pharmaceutically acceptable small molecule compound thereof, wherein the CD30-targeting drug comprises at least one of CD30 CAR-T cells and brentuximab vedotin.

[0048] The second active ingredient comprises a glycosphingolipid synthesis inhibitor and a pharmaceutically acceptable small molecule compound thereof, wherein the glycosphingolipid synthesis inhibitor comprises at least one of eligluvir and megluvir.

[0049] In specific embodiments of the present invention, the CD30-targeting drugs and their pharmaceutically acceptable small molecule compounds mentioned in the present invention are administered by injection, including intravenous injection, subcutaneous injection, intradermal injection, etc., with intravenous injection being the most common.

[0050] In specific embodiments of the present invention, the glycosphingolipid synthesis inhibitors and their pharmaceutically acceptable small molecule compounds mentioned in the present invention are typically administered orally, including sublingual administration or dissolution, and in mice by gavage.

[0051] In a specific embodiment of the present invention, when CD30-targeting drugs and glycosphingolipid synthesis inhibitors are administered in combination, the usual administration method is to administer the glycosphingolipid synthesis inhibitor first, and it can be administered multiple times, followed by the administration of the CD30-targeting drug, thereby enhancing the killing effect of the CD30-targeting drug on CD30-positive tumor cells.

[0052] In a specific embodiment of the present invention, CD30 CAR-T cells are described as including a coding sequence targeting CD30 CAR. This coding sequence includes several functional regions: a signal peptide sequence, a single-chain antibody sequence targeting CD30, a hinge region sequence, and a co-stimulatory molecule signaling region sequence. It should be further noted that the signal peptide sequence in the CD30 CAR coding sequence includes the CD8a signal peptide sequence SEQ ID NO: 2 or other sequences with equivalent functions; the single-chain antibody sequence targeting CD30 includes SEQ ID NO: 3 or other sequences with equivalent functions; the hinge region sequence includes the CD8α hinge region sequence SEQ ID NO: 4 or other sequences with equivalent functions; the co-stimulatory molecule signaling region sequence includes the co-stimulatory molecule 4-1BB signaling region sequence SEQ ID NO: 5 or other sequences with equivalent functions; and the stimulatory molecule CD3 zeta signaling region sequence SEQ ID NO: 6 or other sequences with equivalent functions. It should also be noted that the coding sequence targeting CD30 CAR-T cells contains sequences of multiple different functional regions, each with a different function, and these sequences can be replaced by sequences with similar functions.

[0053] In embodiments of the present invention, the coding sequence of the CD30 CAR includes a signal peptide sequence, the main function of which is to guide protein localization and transport, and promote protein expression and processing. In a preferred embodiment of the present invention, the signal peptide in the coding sequence of the CD30 CAR is the CD8a signal peptide, the sequence of which is shown in SEQ ID NO: 2. Other signal peptides with similar functions, including the CD4 signal peptide and the CD3ζ signal peptide, can also achieve the purpose of the present invention.

[0054] In embodiments of the present invention, the coding sequence of the CD30 CAR includes the sequence of a single-chain antibody targeting CD30. Its main function is to specifically recognize and bind to the CD30 antigen on the surface of tumor cells, enabling CAR-T cells to accurately locate CD30-positive tumor cells. As an example, in this application, the single-chain antibody sequence targeting CD30 is selected as the BerH2 antibody, and the sequence is shown in SEQ ID NO: 3. It should be further noted that, as understood by those skilled in the art, antibodies that can specifically recognize and bind to the CD30 antigen on the surface of tumor cells include at least one of BerH2 antibody, cAC10 antibody, 5F11 antibody, etc. The coding sequence of the CD30 CAR constructed in this invention can achieve the function of specifically recognizing and binding to the CD30 antigen on the surface of tumor cells as long as it contains any of the aforementioned antibodies.

[0055] In an embodiment of the present invention, the coding sequence of the CD30 CAR includes a hinge region, which is a key structure connecting the antigen-binding domain and the transmembrane region. In a preferred embodiment of the present invention, the hinge region is selected as the CD8α hinge region, as shown in SEQ ID NO: 4. Other hinge regions with similar functions, including the CD28 hinge region and the CD4 hinge region, can also achieve the purpose of the present invention.

[0056] In embodiments of the present invention, the coding sequence of the CD30 CAR includes a sequence of the co-stimulatory molecule 4-1BB signaling region. By adding this functional region to the coding sequence of the CD30 CAR, the survival time, proliferation capacity, and cytokine secretion capacity of T cells can be enhanced, while T cell exhaustion can be reduced, thereby maintaining the long-term anti-tumor activity of CAR-T cells. Other co-stimulatory molecules, such as the signaling region sequence of CD28, can also be used in the construction of the CD30-targeting CAR vector described in this invention.

[0057] In embodiments of the present invention, the coding sequence of the CD30 CAR includes a sequence of the co-stimulatory molecule CD3zeta signaling region. By adding this functional region to the coding sequence of the CD30 CAR, T cell activation can be triggered, inducing T cells to release cytotoxic granules, activating apoptosis pathways, and achieving specific killing of target cells. In the design of the coding sequence of CD30 CAR-T cells, different co-stimulatory molecule signaling regions are introduced, and these different co-stimulatory molecule signaling regions can work synergistically to optimize the function of CD30 CAR-T cells. The co-stimulatory molecule signaling regions include at least one of the 4-1BB signaling region, the CD3zeta signaling region, and the CD28 signaling region. As an example, the present invention selects to add the co-stimulatory molecule 4-1BB signaling region and the co-stimulatory molecule CD3zeta signaling region to the construction of the CD30 CAR coding sequence.

[0058] [Preparation method of pharmaceutical composition]

[0059] In another aspect of the present invention, a method for preparing the aforementioned pharmaceutical composition is provided, comprising the following steps:

[0060] a) The coding sequence of CD30 CAR is cloned into a lentiviral vector to form a CD30 CAR-targeting vector;

[0061] b) Prepare CD30-targeted recombinant lentivirus products by co-transfection of CD30-targeted CAR vector and lentivirus packaging plasmid;

[0062] c) After activating human peripheral blood mononuclear cells, add CD30-targeted CAR recombinant lentiviral products to culture to obtain CD30-targeted CAR-T cells, and prepare at least one of CD30-targeted CAR-T cells or brentuximab vedotin into a first formulation;

[0063] The glycosphingolipid synthesis inhibitor was prepared into a second formulation to obtain the pharmaceutical composition of the present invention.

[0064] In some specific embodiments of the present invention, in step a), the coding sequence of CD30CAR is cloned into a lentiviral vector to form a CD30CAR-targeting vector. In this process, the coding sequence needs to be cut into the lentiviral vector through an enzyme restriction site. The enzyme restriction site includes at least one of BamHI and MluI. The lentiviral vector includes at least one of pRRLSIN-CMV-GFP, FUGW, pLenti6 / V5-D-TOPO, pRRLSIN-mCherry, and pLenti-CMV-EGFP-2A-Puro. Preferably, in the present invention, the lentiviral vector is pRRLSIN-EF1α-GFP.

[0065] In some specific embodiments of the present invention, step b) is the step of preparing recombinant lentivirus from the CD30-targeting CAR vector. In this step, the CD30-targeting CAR vector and the lentivirus packaging plasmid are mixed, and the lentivirus is transfected into packaging cells using a transfection reagent. After 48 hours, the viral stock solution is collected, and impurities are removed by centrifugation to obtain an infective CD30-targeting CAR recombinant lentivirus product. It should be further noted that the role of the packaging cells is to help the recombinant lentivirus vector assemble into infective viral particles. The packaging cells include at least one of 293T cells, 293FT cells, PA317 cells, and GP2-293 cells. In the present invention, 293T cells are selected as the packaging cells. The role of the packaging plasmid is to provide functional regions such as structural proteins, envelope proteins, and enzymes. In the present invention, pMD2.G and psPAX2 are selected.

[0066] In some embodiments of the present invention, step c) mainly involves the preparation of CD30-targeted CAR-T cells and the combination of pharmaceutical compositions. In step c), the isolated human peripheral blood mononuclear cells (PBMCs) are placed in cell culture flasks pre-coated with RetroNectin and anti-CD3 antibodies and cultured in X-VIVO 15 medium. The purpose of this is to screen and activate T cells. Then, the aforementioned prepared CD30-targeted CAR recombinant lentiviral product is added to the activated T cells, and the infection efficiency of the recombinant lentiviral product is improved by physical actions such as centrifugation. Subsequently, the prepared CD30-targeted CAR-T cells are expanded in an incubator, and the infection efficiency of the CD30-targeted CAR-T cells is detected by flow cytometry. The prepared CD30-targeted CAR-T cells or purchased brentuximab vedotin are prepared into a first formulation, and the glycosphingolipid synthesis inhibitor is prepared into a second formulation to obtain the pharmaceutical composition of the present invention.

[0067] In another aspect of the present invention, the present invention provides the use of the aforementioned pharmaceutical composition in the preparation of a drug for treating tumors. It should be further noted that the aforementioned tumors include CD30-positive lymphomas, which include at least one of Hodgkin's lymphoma, anaplastic large cell lymphoma, peripheral T-cell lymphoma, diffuse large B-cell lymphoma, primary mediastinal large B-cell lymphoma, mycosis fungoides, or lymphomatoid papulosis.

[0068] The present invention has the following beneficial effects:

[0069] The pharmaceutical composition provided by this invention, as discovered by the applicant, does not directly induce tumor cell apoptosis when using low-dose glycosphingolipid synthesis inhibitors, but can enhance the killing effect of CD30-targeting drugs on CD30-positive tumor cells, and significantly enhance the tumor-killing activity of CD30-targeting drugs.

[0070] Secondly, the applicant found in long-term research that the use of glycosphingolipid synthesis inhibitors in in vitro co-culture systems of tumor cells and CAR-T cells and anti-tumor mouse models can enhance the tumor-killing efficacy of CD30-targeting CAR-T cells against CD30-positive tumor cells, and no additional toxicity was observed.

[0071] To further illustrate the present invention, the following embodiments will be described in detail.

[0072] Example 1: Preparation of CD30-targeted CAR-T cells

[0073] Construction of CD30-targeted CAR lentiviral vector

[0074] The CD30-targeting CAR coding sequence (SEQ ID NO: 1) was cloned into the vector pRRLSIN-EF1α-GFP to synthesize the CD30-targeting CAR vector. The successful construction of the vector was confirmed by sequencing.

[0075] Preparation of CD30-targeted CAR recombinant lentivirus

[0076] Resuscitate 293T cells, and prepare a plasmid mixture by mixing the constructed CD30-targeting CAR vector, lentiviral packaging plasmids psPAX2 and pMD2.G in a ratio of 6:2:1. Transfect 293T cells with Lipo3000 transfection reagent. Collect the viral stock solution after 48 hours, centrifuge to remove impurities, filter, and aliquot and store at -80℃ for the CD30-targeting CAR recombinant lentiviral product.

[0077] Preparation of CD30-targeted CAR-T cells

[0078] Human peripheral blood mononuclear cells (PBMCs) were isolated and placed in T75 cell culture flasks pre-coated with RetroNectin and anti-CD3 antibody, and cultured at a rate of 5 × 10⁻⁶ cells / year. 7 Cells were cultured in 30 mL of X-VIVO 15 medium. After lymphocyte activation, the prepared CD30 CAR virus stock solution was added at a rate of 2 mL / well to 6-well plates pre-coated with RetroNectin. After centrifugation, 2 × 10⁻⁶ cells / well were added to each well. 6 Lymphocytes were cultured in 1.5 mL VIVO medium (containing polybrene and IL-2) by centrifugation. After expansion, CD30-targeted CAR-T cells were obtained, and the infection efficiency of CD30-targeted CAR-T cells was detected by flow cytometry.

[0079] Example 2

[0080] Resuscitate Hodgkin lymphoma cell line KMH2 cells, infect with mCherry lentivirus and obtain mCherry + KMH2 cells were treated with PBS or 400 nM eliglustat for 24 hours, serving as the control group and the eliglustat experimental group, respectively, as KMH2 target cells. CD30-targeted CAR-T cells were prepared as effector cells and co-cultured with the control group or the eliglustat experimental group KMH2 target cells at a certain effector-target ratio (e.g., 2:1, 4:1). A negative control group (containing only tumor cells) was also included. After 24 hours, the number of tumor cells in each group was detected by flow cytometry, and the killing rate of CD30-targeted CAR-T cells against KMH2 cells in each group was statistically analyzed. The tumor killing rate (%) was calculated as [1 - (number of tumor cells in the treated group / number of tumor cells in the negative control group)] × 100. The experimental results are shown below. Figure 1 As shown.

[0081] Example 3

[0082] Resuscitate Hodgkin lymphoma cell line L1236, infect with mCherry lentivirus and obtain mCherry + L1236 cells were treated with PBS or 400 nM levofloxacin for 24 hours, serving as the control group and the levofloxacin experimental group, respectively, as L1236 target cells. Prepared CD30-targeted CAR-T cells were used as effector cells and co-cultured with the control group or the levofloxacin experimental group L1236 target cells at a certain effector-target ratio (e.g., 2:1, 4:1). A negative control group (containing only tumor cells) was also included. After 24 hours, the number of tumor cells in each group was detected by flow cytometry, and the killing rate of CD30-targeted CAR-T cells on L1236 cells in each group was statistically analyzed. The tumor killing rate (%) was calculated as [1 - (number of tumor cells in the treated group / number of tumor cells in the negative control group)] × 100. The experimental results are shown below. Figure 2 As shown.

[0083] Example 4

[0084] Resuscitate Hodgkin lymphoma cell line KMH2 cells, infect with mCherry lentivirus and obtain mCherry + KMH2 cells were treated with PBS or 200 μM Miglustat for 24 hours, serving as the control group and the Miglustat experimental group, respectively, as KMH2 target cells. CD30-targeted CAR-T cells were prepared as effector cells and co-cultured with the control group or the Miglustat experimental group's KMH2 target cells at a 2:1 effector-target ratio. A negative control group (containing only tumor cells) was also included. After 24 hours, the number of tumor cells in each group was detected by flow cytometry, and the killing rate of CD30-targeted CAR-T cells against KMH2 cells in each group was statistically analyzed. The tumor killing rate (%) was calculated as [1 - (number of tumor cells in the treated group / number of tumor cells in the negative control group)] × 100. The experimental results are shown below. Figure 3 As shown.

[0085] Analysis of Examples 1-3 shows that, under different effector-to-target ratios, compared with the control group KMH2 cells or L1236 cells, the killing rate of CD30-targeted CAR-T cells against KMH2 cells or L1236 cells pretreated with levofloxacin was significantly increased. Example 4 shows that, compared with the control group KMH2 cells, the killing rate of CD30-targeted CAR-T cells against KMH2 cells pretreated with megludec was significantly increased.

[0086] Example 5

[0087] Human Hodgkin's lymphoma cell line KMH2 was resuscitated and treated with PBS or 400 nM eliglustat for 24 hours as the control group and eliglustat experimental group, respectively. After washing the cells with PBS, CD30-targeted CAR-T effector cells were added at an effector-to-target ratio of 4:1. After co-culturing for 24 hours, the culture supernatant was collected, centrifuged, and the levels of cytokines (IFNγ, TNFα, and IL-2) were detected by enzyme-linked immunosorbent assay (ELISA). The statistical results are shown in the figure below. Figures 4-6 As shown.

[0088] Through analysis Figures 4-6 The results showed that, compared with the control group, the ability of CD30-targeted CAR-T cells to secrete effector cytokines was significantly enhanced when KMH2 cells pretreated with eliglusil were co-cultured.

[0089] Example 6

[0090] Human Hodgkin's lymphoma cell line KMH2 was resuscitated and treated with 400 nM eligliflozin for 24 hours as the control group and eligliflozin experimental group, respectively. After washing the cells with PBS, CD30-targeted CAR-T cells were co-cultured with either the control group or the eligliflozin experimental group KMH2 cells at a ratio of 4:1 for 20 hours. Then, a protein transport inhibitor was added for 4 hours. Cells were collected, first stained for membrane molecules, then ruptured and fixed, and intracellular molecules were labeled. Flow cytometry was used to detect and statistically analyze CD107α. + Or Granzyme B + The proportion of CAR-T cells among the total cells. Experimental results are as follows: Figures 7-8 As shown.

[0091] Through analysis Figures 7-8 The results showed that, compared with the control group, when CD30-targeted CAR-T cells were co-cultured with KMH2 cells pretreated with eliglusil, the expression levels of Granzyme B or CD107a were significantly increased, indicating that the killing efficacy of CAR-T cells was enhanced.

[0092] Example 7

[0093] Human Hodgkin lymphoma cells KMH2 cells (2×10) 6 Subcutaneous inoculation was performed on NSG mice until the tumor volume reached 100 mm. 3Approximately 5 mice were randomly divided into three groups of five each: a blank control group, a CD30-targeted CAR-T (CART30) monotherapy group, and a CART30 plus elliglustat combination therapy group. The blank control group received saline via tail vein infusion, while the combination therapy group received elliglustat (10 mg / kg) via gavage daily, followed by tail vein infusion of 8 × 10⁸ CD30 CAR-T cells the next day. 6 Tumor volume was measured every two days, and tumor growth curves were plotted for each group. Tumor volume = 1 / 2 × length × width. Experimental results are shown below. Figure 9 As shown.

[0094] pass Figure 9 The experimental results show that the antitumor effect of CD30-targeted CAR-T cell monotherapy is weak. However, when iliglucalcide is used in combination with CAR-T cell therapy, tumor cell growth is significantly inhibited, indicating that iliglucalcide has a CAR-T therapy sensitizing effect.

[0095] Example 8

[0096] Human Hodgkin's lymphoma cell line KMH2 and human degenerated large cell lymphoma Karpas-299 cells were resuscitated and included in three groups: a PBS control group, a brentuximab monotherapy group (100 μg / mL), and a brentuximab (100 μg / mL) + iligrastare (400 nM) combination therapy group. After 72 hours of treatment, the apoptosis rate was detected by flow cytometry. The experimental results are as follows: Figures 9-10 As shown.

[0097] pass Figures 10-11 The experimental results showed that, compared with the control group, brutus vedotin could induce apoptosis in CD30-positive tumor cells (KMH2 and Karpas-299). When iligrolukast was used in combination with brutus vedotin, the apoptosis rate of tumor cells was significantly increased compared with brutus vedotin monotherapy, indicating that iligrolukast has a sensitizing effect on brutus vedotin.

[0098] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A pharmaceutical composition for treating tumors, characterized in that, The pharmaceutical composition comprises: The first active ingredient comprises a CD30-targeting drug and a pharmaceutically acceptable small molecule compound / salt thereof, wherein the CD30-targeting drug comprises at least one of CD30 CAR-T cells and brentuximab vedotin. The second active ingredient comprises a glycosphingolipid synthesis inhibitor and a pharmaceutically acceptable small molecule compound / salt thereof, wherein the glycosphingolipid synthesis inhibitor comprises at least one of eligluvir and megluvir.

2. The pharmaceutical composition according to claim 1, characterized in that, The CD30 CAR-T cells include a coding sequence targeting CD30 CAR, which includes the sequence SEQ ID NO:

1.

3. The pharmaceutical composition according to claim 2, characterized in that, The coding sequence of the CD30 CAR includes at least one of the following sequences: CD8a signal peptide sequence SEQ ID NO: 2, CD30-targeting single-chain antibody sequence SEQ ID NO: 3, CD8α hinge region sequence SEQ ID NO: 4, co-stimulatory molecule signal region sequence SEQ ID NO: 5, and CD3 zeta signal region sequence SEQ ID NO:

6.

4. The pharmaceutical composition according to claim 1, characterized in that, When the glycosphingolipid synthesis inhibitor and the CD30-targeting drug are administered in combination, the glycosphingolipid synthesis inhibitor is administered first, followed by the CD30-targeting drug.

5. A method for preparing the pharmaceutical composition according to any one of claims 1 to 4, characterized in that, Includes the following steps: a) The coding sequence of CD30 CAR is cloned into a lentiviral vector to form a CD30 CAR-targeting vector; b) Prepare CD30-targeted recombinant lentivirus products by co-transfection of CD30-targeted CAR vector and lentivirus packaging plasmid; c) After activating human peripheral blood mononuclear cells, add CD30-targeting CAR recombinant lentiviral products, culture to obtain CD30-targeting CAR-T cells, and prepare at least one of CD30-targeting CAR-T cells or brentuximab vedotin into a first formulation; The glycosphingolipid synthesis inhibitor was prepared into a second formulation to obtain the pharmaceutical composition of the present invention.

6. The preparation method according to claim 5, characterized in that, In step a), the lentiviral vector includes at least one of pRRLSIN-CMV-GFP, FUGW, pLenti6 / V5-D-TOPO, pRRLSIN-mCherry, and pLenti-CMV-EGFP-2A-Puro.

7. The preparation method according to claim 5, characterized in that, In step b), the lentiviral packaging plasmid includes at least one of the second-generation lentiviral packaging plasmids pMD2.G and psPAX2, or the third-generation lentiviral packaging plasmids pMDlg, pRRE, and pRSV-Rev.

8. Application in a tumor treatment drug, characterized in that... This includes the pharmaceutical composition according to any one of claims 1 to 4 or the pharmaceutical composition prepared by the preparation method according to claims 5 to 7.

9. The application according to claim 8, characterized in that, The tumors include CD30-positive lymphomas.

10. The application according to claim 8, characterized in that, The CD30-positive lymphomas include at least one of Hodgkin's lymphoma, anaplastic large cell lymphoma, peripheral T-cell lymphoma, diffuse large B-cell lymphoma, primary mediastinal large B-cell lymphoma, mycosis fungoides, or lymphomatoid papulosis.

Images