A primer and probe set, kit, and application for detecting Staphylococcus aureus L based on real-time fluorescence MIRA technology.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- FRUIT TREE INST OF CHINESE ACAD OF AGRI SCI
- Filing Date
- 2025-11-04
- Publication Date
- 2026-05-26
AI Technical Summary
Existing PCR technology is time-consuming and cumbersome to detect Staphylococcus aureus L, and has limited sensitivity and detection range, making it difficult to meet the needs for rapid, sensitive and accurate detection.
Using multi-enzyme isothermal rapid amplification (MIRA) technology combined with real-time fluorescence detection, a specific primer-probe set and kit were designed, including the forward primer GVL-R3F, the reverse primer GVL-R2R, and the probe GVL-P1. Through multi-enzyme isothermal rapid amplification and real-time monitoring of fluorescence signals, efficient detection of staphylococcal virus L was achieved.
It enables simple, rapid, accurate, and sensitive detection of Staphylococcus aureus L, reducing detection costs and time. It is suitable for use in grassroots units and remote areas, possesses high specificity and high sensitivity, avoids aerosol contamination, and is applicable to the differential diagnosis and rapid detection of Staphylococcus aureus L.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a primer and probe set, kit, and application for detecting staphylococcal virus L based on real-time fluorescence MIRA technology. Background Technology
[0002] Grapevine virus L (GVL) belongs to the genus *Vitivirus* of the family Betaflexiviridae. It is a novel virus identified in grape samples from China in 2019. Grapevine virus L has a wide distribution, occurring in many countries across Asia, Oceania, Europe, North America, and Africa, and its incidence is increasing. Preliminary surveys in different grape-producing areas of Liaoning Province, China, showed a GVL incidence of 15%. This virus often occurs in combination with multiple grapevine viruses, a situation increasingly reported in various countries. Given that co-infection with some *Vitivirus* species and other viruses such as grape leafroll virus can exacerbate symptoms, new viruses like grapevine virus L pose a significant potential threat. Furthermore, due to the highly differentiated nature of grapevine virus L, more sensitive and efficient molecular detection methods are needed for its accurate identification.
[0003] Staphylococcal virus L is a positive-sense single-stranded RNA virus, and currently, the main international method for its detection is reverse transcriptase-polymerase chain reaction (RT-PCR). Since its invention, PCR technology has become a widely used method for virus detection. However, PCR technology is usually time-consuming, involves cumbersome procedures, and has certain limitations in terms of detection sensitivity and range.
[0004] In recent years, next-generation point-of-care testing (POCT) technologies have developed rapidly. Among them, isothermal amplification technology, requiring only a single isothermal condition, can operate in simple equipment, thus completely eliminating the dependence on complex and precise temperature-controlled equipment for nucleic acid amplification. Multienzyme isothermalrapid amplification (MIRA) is a novel isothermal amplification technology developed domestically based on recombinases. It is homologous to recombinase polymerase amplification (RPA) and recombinase-aided amplification (RAA). MIRA technology achieves highly efficient nucleic acid amplification through the synergistic action of multiple enzymes, including recombinase, single-strand binding protein, helicase, and DNA polymerase.
[0005] The MIRA real-time fluorescence detection system is characterized by rapid response, high specificity, and high sensitivity. It enables real-time monitoring without relying on large instruments, making it advantageous for meeting the testing needs of resource-scarce areas and conducting rapid on-site detection. Currently, this technology has been reported to be applied in the rapid diagnosis of various types of pathogens across multiple fields. Summary of the Invention
[0006] The purpose of this invention is to provide a simple, rapid, accurate, highly sensitive, and highly specific method for the rapid on-site detection of Staphylococcus aureus L virus.
[0007] To achieve the above objectives, the present invention first provides a primer and probe set for detecting staphylococcal virus L.
[0008] The primer-probe set for detecting staphylococcal virus L provided by the present invention consists of forward primer GVL-R3F, reverse primer GVL-R2R, and probe GVL-P1;
[0009] The forward primer GVL-R3F is a single-stranded DNA molecule as shown in sequence 1;
[0010] The reverse primer GVL-R2R is a single-stranded DNA molecule as shown in sequence 2;
[0011] The probe GVL-P1 is a single-stranded DNA molecule as shown in sequence 3.
[0012] In the above probe primer set, the 34th nucleotide of the probe GVL-P1 is labeled with a fluorescent group, a tetrahydrofuran is inserted between the 35th and 36th nucleotides of the probe GVL-P1, the 37th nucleotide of the probe GVL-P1 is labeled with a quenching group, and the 3' end of the probe GVL-P1 is modified with a C3-Spacer.
[0013] The fluorescent group is selected from any one of the following groups: FAM, 6-FAM, VIC, HEX, TRT, CY3, CY5, ROX, JOE, FITC, TET, NED, TAMRA, LC RED640, LC RED705, Quasar705, Texas Red.
[0014] The quenching group is selected from any one of the following groups: TAMRA, BHQ1, BHQ2, BHQ3, MGB, Dabcy1.
[0015] In some embodiments, the fluorescent group is the fluorescent group FAM.
[0016] In some embodiments, the quenching group is the quenching group BHQ1.
[0017] In the above probe primer set, the molar ratio of the forward primer GVL-R3F, the reverse primer GVL-R2R, and the probe GVL-P1 is 2:2:1.
[0018] To achieve the above objectives, the present invention further provides a kit for detecting staphylococcal virus L, wherein the kit functions as any one of the following a1)-a3):
[0019] a1) To identify or assist in the identification of whether the virus to be tested is Staphylococcus aureus L;
[0020] a2) To detect or assist in the detection of whether the sample to be tested is infected with Staphylococcus aureus L;
[0021] a3) To distinguish or assist in distinguishing Staphylococcus aureus L from other viruses.
[0022] The kit for detecting staphylococcal virus L provided by this invention contains the above-mentioned primer and probe set.
[0023] Furthermore, the kit may include RNA extraction reagents (such as reagents required for RNA extraction using an adsorption column method) or crude nucleic acid extraction reagents (such as NaOH-EDTA buffer).
[0024] Furthermore, the kit may also include multi-enzyme isothermal rapid amplification reagents (such as reaction buffer A and amplification reaction initiator B derived from RNA isothermal rapid amplification kit (fluorescent type)-II).
[0025] Furthermore, the kit may also include a negative control (such as RNA or crude extract from leaves or branches of healthy grapevines) and a positive control (such as RNA or crude extract from leaves or branches of grapevines infected with grape virus L).
[0026] To achieve the above objectives, the present invention also provides new uses for the above primer-probe set or the above kit.
[0027] This invention provides the above-described primer-probe set or the above-described kit in any one of the following b1)-b6):
[0028] b1) To identify or assist in the identification of whether the virus to be tested is Staphylococcus aureus L;
[0029] b2) Detection or auxiliary detection of whether the sample to be tested is infected with Staphylococcus aureus L;
[0030] b3) To differentiate or assist in differentiating Staphylococcus aureus L from other viruses;
[0031] b4) Prepare products for identification or auxiliary identification of whether the virus to be tested is Staphylococcus aureus L;
[0032] b5) Prepare products for detecting or assisting in the detection of whether a sample is infected with Staphylococcus aureus L;
[0033] b6) Prepare products that can distinguish or help distinguish Staphylococcus aureus L from other viruses.
[0034] To achieve the above objectives, the present invention also provides a method for detecting or assisting in the detection of whether a sample to be tested is infected with Staphylococcus aureus L.
[0035] The method for detecting or assisting in the detection of whether a sample to be tested is infected with Staphylococcus aureus L provided by the present invention includes the following steps: using the above-mentioned primer and probe set or the above-mentioned kit to detect the sample to be tested.
[0036] Furthermore, the method is as follows: c1) or c2).
[0037] c1) Extract RNA from the sample to be tested, and use the RNA as a template to perform multi-enzyme isothermal rapid amplification using the primer and probe set or the kit described above to obtain multi-enzyme isothermal rapid amplification products; determine whether the sample to be tested is infected with Staphylococcus aureus L by real-time fluorescence detection of the multi-enzyme isothermal rapid amplification products.
[0038] c2) Prepare a crude nucleic acid extract of the sample to be tested. Using the crude extract as a template, perform multi-enzyme isothermal rapid amplification using the primer and probe set or the kit described above to obtain the multi-enzyme isothermal rapid amplification product. Determine whether the sample to be tested is infected with Staphylococcus aureus L by detecting the multi-enzyme isothermal rapid amplification product with real-time fluorescence.
[0039] Furthermore, in c1), RNA is extracted from the sample using an adsorption column method. The specific extraction steps of the adsorption column method can be found in the literature "Molecular detection and gene sequence analysis of grape virus E, Acta Phytopathologica Sinica, 2014, 44(5): 455-460".
[0040] In step c2), a crude nucleic acid extract of the sample to be tested is prepared using NaOH-EDTA buffer.
[0041] The NaOH-EDTA buffer solution is a solution obtained by mixing a 50mM NaOH solution and a 2.5mM EDTA solution in a volume ratio of 1:1.
[0042] The formulation of the NaOH-EDTA buffer and the specific steps for preparing the crude nucleic acid extract of the sample to be tested using the NaOH-EDTA buffer can be found in the literature “Development and application of crude sap-based recombine polymerase amplification assay for the detection and occurrence of grapevine geminivirus A in Indian grapevine cultivars, Frontiers in Plant Science, 2023, Vol.14, p.1151471”.
[0043] Furthermore, the fluorescence curve can be used to determine whether the sample is infected with Staphylococcus aureus L: if the fluorescence curve shows obvious specific amplification, the sample is infected or a candidate for Staphylococcus aureus L; if the fluorescence curve is flat and has no peak, the sample is not infected or a candidate for not infected with Staphylococcus aureus L.
[0044] In the above method, the reaction system for the multi-enzyme isothermal rapid amplification is as follows: 29.4 μL of buffer A, 2 μL of forward primer, 2 μL of reverse primer, 0.6 μL of probe, 2 μL of RNA or crude extract template, 11.5 μL of ddH2O, and 2.5 μL of buffer B.
[0045] In some embodiments, the concentrations of the forward and reverse primers in the multi-enzyme isothermal rapid amplification reaction system can be 200-600 nmol / L.
[0046] In some preferred embodiments, the concentrations of the forward and reverse primers in the multi-enzyme isothermal rapid amplification reaction system are 400 nmol / L.
[0047] In some embodiments, the concentration of the probe GVL-P1 in the multi-enzyme isothermal rapid amplification reaction system can be 80-280 nmol / L.
[0048] In some preferred embodiments, the concentration of the probe GVL-P1 in the multi-enzyme isothermal rapid amplification reaction system is 160 nmol / L.
[0049] In some implementations, the reaction temperature for the isothermal rapid amplification of the multi-enzyme can be 37-42°C.
[0050] In some preferred embodiments, the reaction temperature for the multi-enzyme isothermal rapid amplification is 41°C.
[0051] In some implementations, the reaction time for the multi-enzyme isothermal rapid amplification can be 5-20 min.
[0052] In some preferred embodiments, the reaction time for the multi-enzyme isothermal rapid amplification is 15 min.
[0053] In some implementations, the multi-enzyme isothermal rapid amplification can be performed on a real-time quantitative PCR instrument (such as CFXConnect). TM This is done in a Real-Time System.
[0054] In some implementations, the multi-enzyme isothermal rapid amplification can be performed in an isothermal fluorescence PCR instrument (such as the Dhelix-Q5 isothermal fluorescence PCR 2.0 instrument).
[0055] The other viruses mentioned above include at least one of the following viruses: Grapevinevirus A (GVA), Grapevinevirus B (GVB), Grapevinevirus E (GVE), Grapevine fanleaf virus (GFLV), Grapevine fleckvirus (GFKV), Grapevine rupestris stem pitting-associated virus (GRSPaV), Grapevine Pinot gris virus (GPGV), Grapevine berry inner necrosis virus (GINV), Grapevine fabavirus (GFabV), Grapevine leafroll-associated virus 1 (GLRaV-1), Grapevine leafroll-associated virus 2 (GLRaV-2), and Grapevine leafroll-associated virus 3. 3, GLRaV-3), Grapevine leafroll-associated virus 4 (GLRaV-4), Grapevine leafroll-associated virus 7 (GLRaV-7), Grapevine leafroll-associated virus 13 (GLRaV-13).
[0056] The sample to be tested mentioned above is a grape, specifically a sample from different tissue parts of the grape.
[0057] In some implementations, the different tissue parts include grape leaves and grape branches.
[0058] This invention discloses a primer and probe set, a kit, and their applications for detecting Staphylococcus aureus L based on real-time fluorescence MIRA technology. The primer and probe set consists of single-stranded DNA sequences 1-3. Based on the aforementioned primer and probe set, this invention establishes and optimizes a real-time fluorescence MIRA detection method for Staphylococcus aureus L. Furthermore, the optimized real-time fluorescence MIRA method is innovatively combined with a simplified nucleic acid extraction method and a portable fluorescence detection device, significantly reducing extraction and time costs while enabling rapid on-site detection of the virus, making it particularly suitable for grassroots units and remote areas. In addition, the real-time fluorescence MIRA detection method for Staphylococcus aureus L established in this invention can effectively and accurately detect whether a sample is infected with or carries Staphylococcus aureus L by real-time monitoring of the amplification curve. The detection process does not require opening the container, effectively avoiding aerosol contamination, and has advantages such as high specificity, high sensitivity, and simple operation, providing an effective technical means for the differential diagnosis and rapid detection of Staphylococcus aureus L. Attached Figure Description
[0059] Figure 1 The results show the screening results for forward primers for real-time fluorescent MIRA.
[0060] Figure 2 The results show the screening results for reverse primers for real-time fluorescent MIRA.
[0061] Figure 3 The results show the optimized primer concentrations in the real-time fluorescence MIRA reaction system.
[0062] Figure 4 The results show the optimized probe concentration in the real-time fluorescence MIRA reaction system.
[0063] Figure 5 The results show the optimized reaction time for real-time fluorescence MIRA.
[0064] Figure 6 The results show the optimized reaction temperature for real-time fluorescence MIRA.
[0065] Figure 7 This is a comparison of the sensitivity of real-time fluorescence MIRA and conventional RT-PCR.
[0066] Figure 8 This is the result of a real-time fluorescence MIRA specificity assay.
[0067] Figure 9 This is the amplification result of real-time fluorescence MIRA on GVL-positive grape RNA samples.
[0068] Figure 10 This is the amplification result of real-time fluorescence MIRA on GVL-positive crude grape extract samples.
[0069] Figure 11This study aims to improve the sensitivity of real-time fluorescence MIRA in crude extract samples. Detailed Implementation
[0070] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0071] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0072] The following examples involve a total of 16 grape viruses: Grapevine virus L (GVL), Grapevine virus A (GVA), Grapevine virus B (GVB), Grapevine virus E (GVE), Grapevine fanleaf virus (GFLV), Grapevine fleck virus (GFKV), Grapevine rupestris stempitting-associated virus (GRSPaV), Grapevine Pinot gris virus (GPGV), Grapevine berry inner necrosis virus (GINV), Grapevine fabavirus (GFabV), Grapevine leafroll-associated virus 1 (GLRaV-1), and Grapevine leafroll-associated virus 2. 2, GLRaV-2), Grapevine leafroll-associated virus 3 (GLRaV-3), Grapevine leafroll-associated virus 4 (GLRaV-4), Grapevine leafroll-associated virus 7 (GLRaV-7), Grapevine leafroll-associated virus 13 (GLRaV-13). Grapevine plant samples infected with any of the above 16 viruses, as well as healthy grapevine plant samples, were collected from the virus source preservation nursery of the National Deciduous Fruit Tree Virus Elimination Center of the Fruit Tree Research Institute of the Chinese Academy of Agricultural Sciences in Xingcheng City, Liaoning Province.
[0073] The 10×PCR Buffer, dNTPs, Taq polymerase, DNA Marker DL2000, and M-MLV reverse transcriptase used in the following examples are all products of Takara Bio Inc. (TaKaRa); the RNA Isothermal Rapid Amplification Kit (Fluorescent Type)-II (Catalog No.: WLRE8208KIT) is a product of Weifang Anpu Future Biotechnology Co., Ltd.; and the real-time quantitative PCR instrument is CFXConnect.TM The Real-Time System (BIO-RAD, USA) and the Dhelix-Q5 isothermal fluorescence PCR 2.0 instrument are products of Guangzhou Double Helix Gene Technology Co., Ltd.
[0074] Example 1: Design and screening of primers and probes for detecting Staphylococcus aureus L.
[0075] I. Design and Synthesis of Primers and Probes
[0076] Extensive sequence alignment analysis was performed based on the reported L genome sequence of Staphylococcus aureus (GLV-P1) on NCBI to identify a highly conserved target region. An optimal 51 bp fragment was designed as a fluorescent probe targeting this region. Specifically, the 34th base (T) of the fluorescent probe GLV-P1 is labeled with the FAM fluorescent group, a tetrahydrofuran (THF) molecule is inserted between the 35th and 36th nucleotides as a dSpacer, the 37th base (T) is labeled with the BHQ1 quencher group, and a C3 Spacer is modified at the 3' end. Three forward primers and three reverse primers were then designed around the fluorescent probe GLV-P1. The specific sequences of the primers and probe are shown in Table 1, and the primer and probe sequences in Table 1 were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0077] Table 1. Primer and probe sequences
[0078] II. Screening of specific primers for detecting Staphylococcus aureus L
[0079] 1. Reverse primer screening
[0080] To obtain the optimal reverse primers, the forward primer R1F was paired with three reverse primers to obtain the following three primer pairs: GVL-R1F / 1R, GVL-R1F / 2R, and GVL-R1F / 3R. Total RNA was extracted from grape leaves infected with grape virus L using a modified adsorption column method, and then real-time fluorescence MIRA amplification was performed using the total RNA as a template. Healthy grape leaves were used as a negative control. The specific extraction steps of the total RNA were performed according to the method in the literature "Molecular detection and gene sequence analysis of grape virus E, Acta Phytopathologica Sinica, 2014, 44(5): 455-460".
[0081] The preparation method for the real-time fluorescence MIRA amplification system (50 μL) is as follows: Add 29.4 μL of buffer A, 2 μL each of different combinations of 10 μM upstream and downstream primers, 0.6 μL of 10 μM probe, 11.5 μL of ddH2O, 2 μL of RNA template, and finally 2.5 μL of buffer B to a 0.2 mL reaction tube containing lyophilized enzyme powder. Add buffer B to the tube cap last, invert the tube 8-10 times to mix thoroughly, and then shake (or rapidly centrifuge) the mixture to the bottom of the tube. Immediately place the tube in a real-time fluorescence quantitative PCR instrument (BIO-RAD, USA). The 0.2 mL reaction tube containing lyophilized enzyme powder, buffer A, and buffer B were all obtained from the RNA Isothermal Rapid Amplification Kit (Fluorescent Type)-II.
[0082] The real-time fluorescence MIRA amplification reaction conditions were as follows: reaction temperature 42℃, reaction time 20 min. The results were interpreted using amplification curves.
[0083] The results are as follows Figure 1 As shown in the figure, the results indicate that all three primer combinations can amplify and produce fluorescent signals. Among them, the GVL-R1F / 2R primer combination has the fastest amplification rate and the highest relative fluorescence intensity, indicating that GVL-R2R is the best reverse primer.
[0084] 2. Forward primer screening
[0085] Using the optimal reverse primer R2R selected in step 1, and combining it in pairs with the three forward primers, the following three primer combinations were obtained: GVL-R1F / 2R, GVL-R2F / 2R, and GVL-R3F / 2R. Real-time fluorescence MIRA amplification was performed on different primer combinations according to the method in step 1, while healthy grape leaves were used as a negative control to further screen for the optimal forward primers.
[0086] The results are as follows Figure 2 As shown in the figure, the results indicate that all three primer pairs exhibited significant amplification curves. Among them, the GVL-R3F / 2R primer pair reached the amplification start point earliest and had a high fluorescence value. Therefore, GVL-R3F is the best forward primer.
[0087] Based on the above screening results, forward primer GVL-R3F and reverse primer GVL-R2R were selected as the optimal MIRA amplification primer pair for detecting GVL.
[0088] Example 2: Optimization of Real-Time Fluorescence MIRA Reaction System and Reaction Conditions
[0089] I. Optimization of primer concentration in real-time fluorescence MIRA reaction system
[0090] To obtain the optimal primer concentration for real-time fluorescence MIRA reaction, real-time fluorescence MIRA amplification was performed using the following five primer concentrations according to the method in step 2.1 of Example 1: 200 nmol / L, 300 nmol / L, 400 nmol / L, 500 nmol / L and 600 nmol / L. Healthy grape leaves were used as a negative control. The optimal primer concentration was selected based on the amplification effect.
[0091] The results are as follows Figure 3 As shown, the results indicate that all five primer concentrations could detect Staphylococcus aureus L and showed no significant amplification in negative samples. While the amplification curves showed shorter peak times at primer concentrations of 400 nmol / L and 600 nmol / L, the former exhibited a higher fluorescence value. Therefore, 400 nmol / L was determined to be the optimal primer concentration for the real-time fluorescent MIRA amplification system of this invention.
[0092] II. Optimization of probe concentration in real-time fluorescence MIRA reaction system
[0093] To obtain the optimal probe concentration for the reaction, real-time fluorescence MIRA amplification was performed using the following six different probe concentrations, following the method in step 2.1 of Example 1: 80 nmol / L, 120 nmol / L, 160 nmol / L, 200 nmol / L, 240 nmol / L, and 280 nmol / L. Healthy grape leaves were used as a negative control. The optimal probe concentration was selected based on the amplification effect.
[0094] The results are as follows Figure 4 As shown, the results indicate that all six probe concentrations could detect Grape Virus L and showed no significant amplification in negative samples. Among them, the amplification effect was better and the amplification rate was faster when the probe concentration was 160 nmol / L. Therefore, 160 nmol / L was determined to be the optimal probe concentration for the real-time fluorescence MIRA amplification system of this invention.
[0095] III. Optimization of Real-Time Fluorescence MIRA Reaction Time
[0096] To obtain the optimal reaction time, real-time fluorescence MIRA amplification was performed at four different times according to the method in step 2 of Example 1: 5 min, 10 min, 15 min, and 20 min. Healthy grape leaves were used as a negative control. The optimal reaction time was selected based on the amplification effect.
[0097] The results are as follows Figure 5As shown, the results indicate that amplification can occur in all samples within a reaction time of 5-20 min. The fluorescence curve tends to flatten out after 15 min of amplification, and all samples have high fluorescence values at this time. To avoid false positive results, 15 min is selected as the optimal reaction time for the real-time fluorescence MIRA amplification system of this invention.
[0098] IV. Optimization of Real-Time Fluorescence MIRA Reaction Temperature
[0099] To obtain the optimal reaction temperature, real-time fluorescence MIRA amplification was performed at the following six different temperatures, following the method in step 2 of Example 1: 37℃, 38℃, 39℃, 40℃, 41℃, and 42℃. Healthy grape leaves were used as a negative control. The optimal reaction temperature was selected based on the amplification effect.
[0100] The results are as follows Figure 6 As shown in the figure, the results indicate that good fluorescence amplification curves can be obtained in the reaction temperature range of 37-42℃. Among them, the peak time is the shortest and the relative fluorescence intensity is the highest at 41℃, indicating that the optimal primer pair at this temperature has a fast amplification speed and good effect. Therefore, 41℃ is determined to be the optimal reaction temperature of the real-time fluorescence MIRA amplification system of this invention.
[0101] Example 3: Sensitivity test of real-time fluorescence MIRA
[0102] RNA extracted from grape leaves infected with GVL was serially diluted tenfold with sterile water to obtain 10... 0 10 -1 10 -2 10 -3 10 -4 10 -5 10 -6 10 -7 RNA dilution buffers were prepared at eight different dilution ratios, and real-time fluorescent MIRA amplification was performed using these RNA dilution buffers as templates. Simultaneously, cDNA obtained by reverse transcription from RNA dilution buffers at different dilution ratios was used as templates for conventional RT-PCR amplification. The sensitivity of the two methods was compared, with healthy grape leaves serving as a negative control. The MIRA amplification method followed step 2.1 of Example 1 (primer and probe concentrations in the reaction system were as optimal as in Example 2, and reaction time and temperature were as optimal as in Example 2).
[0103] The standard RT-PCR method includes the following steps: First, total RNA is reverse transcribed to obtain cDNA. 2 μL of cDNA is then added to a solution containing 18.8 μL ddH2O, 2.5 μL 10×PCR buffer, and 0.5 μL 2.5 mmol / L sodium phosphate buffer. -1dNTPs, 0.5µL 10mmol -1 Forward and reverse primers (GVL-forward: AGTTGAAGTCTAGGTGCACAC / GVL-reverse: GTACTCAGACTTCCCCGATCTA) and 0.2µL 5U·mL -1 A total of 25 μL of Taq enzyme premix was added to the reaction system. The specific reaction program was as follows: 94℃ for 3 min; 94℃ for 30 s, 53℃ for 45 s, 72℃ for 1 min, repeated 35 times; 72℃ for 7 min.
[0104] The results are as follows Figure 7 As shown in the figure, the results indicate that the real-time fluorescence MIRA method of the present invention can detect 10 -6 RNA from GVL-positive samples diluted by a factor of 10, while conventional RT-PCR can detect 10. -2 cDNA from GVL-positive samples diluted to a certain degree indicates that the detection sensitivity of the real-time fluorescent MIRA of this invention is 10,000 times that of conventional RT-PCR.
[0105] Example 4: Specificity test of real-time fluorescence MIRA
[0106] RNA was extracted from grape leaves infected with grape virus A, grape virus B, grape virus E, grape fanleaf virus, grape spot virus, sandy grape stempox-associated virus, grape Pinot Gris virus, grape berry necrosis virus, grape broad bean wilt virus, grape leafroll-associated virus 1, grape leafroll-associated virus 2, grape leafroll-associated virus 3, grape leafroll-associated virus 4, grape leafroll-associated virus 7, and grape leafroll-associated virus 13. Real-time fluorescent MIRA amplification was performed using the RNA of these viruses as templates. Healthy grape leaves served as negative controls, and grape leaves infected with grape virus L served as positive controls. The MIRA amplification method was performed according to step 2.1 of Example 1 (the primer and probe concentrations in the reaction system were the optimal concentrations in Example 2, and the reaction time and temperature were the optimal times and temperatures in Example 2).
[0107] The results are as follows Figure 8 As shown, the results indicate that only two samples infected with GVL exhibited significant fluorescence amplification curves, while samples infected with other viruses did not show significant amplification curves. This demonstrates that the real-time fluorescence MIRA method of this invention can specifically detect staphylococcal virus L.
[0108] Example 5: Real-time fluorescence MIRA amplification of GVL-positive RNA samples using a simple isothermal fluorescence instrument
[0109] Total RNA from 12 positive samples (leaves and branches) of six GVL-infected grapevines (numbered LN-Ita, LN-AS, HB-Mar, HB-CS-2, HN-ZJ, and HN-SS) was used as templates for real-time fluorescent MIRA amplification, following step 1 of Example 1 (primer and probe concentrations in the reaction system were as optimized in Example 2, and reaction time and temperature were as optimized in Example 2). The amplification results were interpreted using a Dhelix-Q5 isothermal fluorescent PCR 2.0 instrument. Healthy grape leaves were used as negative controls.
[0110] The results are as follows Figure 9 As shown, the results indicate that all 12 GVL positive samples can be significantly amplified by the real-time fluorescence MIRA method of this invention, and the amplification results can be interpreted by a more portable and simple isothermal fluorescence instrument.
[0111] Example 6: Detection of field grape samples by real-time fluorescence MIRA
[0112] Total RNA was extracted from 134 vine samples of different grape varieties from different grape-producing regions in eight provinces of China, and cDNA was obtained by reverse transcription. The total RNA was amplified by real-time fluorescent MIRA according to step 1 of Example 1 (primer and probe concentrations in the reaction system were at the optimal concentrations in Example 2, and reaction time and temperature were at the optimal times and temperatures in Example 2). Simultaneously, the cDNA was amplified by conventional RT-PCR according to the method in Example 3, with healthy grape leaves serving as a negative control.
[0113] The results showed that among 134 grape samples from different grape-producing regions, the detection rate of GVL by conventional RT-PCR was 14.9% (20 / 134), while the positive detection rate of the real-time fluorescence MIRA method of this invention was 20.1% (27 / 134). This indicates that the real-time fluorescence MIRA method of this invention has a higher detection rate and efficiency for GVL.
[0114] Example 7: Detection of plant crude extracts by real-time fluorescence MIRA
[0115] I. Preparation of Crude Plant Extracts
[0116] Following the method described in the literature "Development and application of crude sap-based recombinase polymerase amplification assay for the detection and occurrence of grapevine geminivirus A in Indian grapevine cultivars, Frontiers in Plant Science, 2023, Vol.14, p.1151471", crude extracts were prepared from 12 positive samples of leaves and branches from 6 grapevines infected with GVL (numbered LN-Ita, LN-AS, HB-Mar, HB-CS-2, HN-ZJ, and HN-SS).
[0117] II. Real-time fluorescence MIRA
[0118] Using the crude extract prepared in step one as a template, MIRA amplification was performed according to the method in step two of Example 1 (the primer and probe concentrations in the reaction system were the optimal concentrations in Example 2, and the reaction time and temperature were the optimal time and temperature in Example 2). The amplification results were interpreted using a Dhelix-Q5 isothermal fluorescence PCR 2.0 instrument. Healthy grape leaves were used as a negative control.
[0119] The results are as follows Figure 10 As shown, the results indicate that both the crude extracts from branches and leaves showed significant amplification when detected using the real-time fluorescence MIRA method of this invention, while the negative controls showed no significant amplification.
[0120] Example 8: Sensitivity test of real-time fluorescence MIRA on crude plant extracts
[0121] The crude extract of branches extracted with NaOH-EDTA buffer was serially diluted tenfold using sterile water to obtain 10... 0 10 -1 10 -2 10 -3 10 -4 10 -5 10 -6 10 -7The crude extracts were diluted to eight different ratios, and then MIRA amplification was performed using each of these eight diluted crude extracts as templates, following the method in step 2.1 of Example 1 (the primer and probe concentrations in the reaction system were the optimal concentrations in Example 2, and the reaction time and temperature were the optimal time and temperature in Example 2). RT-PCR testing was also performed using the same template, with healthy grape leaves used as a negative control.
[0122] The results are as follows Figure 11 As shown in the figure, the results indicate that the real-time fluorescence MIRA method of the present invention can detect 10 -3 The crude extract of a GVL-positive sample was diluted several times, and the relative fluorescence intensity was still above 1000. No amplification was observed in the RT-PCR reaction using the same template, indicating that only the real-time fluorescence MIRA method of this invention can detect the crude extract sample.
[0123] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. A primer-probe set for detecting Staphylococcus aureus L, the primer-probe set comprising a forward primer GVL-R3F, a reverse primer GVL-R2R, and a probe GVL-P1; The forward primer GVL-R3F is a single-stranded DNA molecule as shown in sequence 1; The reverse primer GVL-R2R is a single-stranded DNA molecule as shown in sequence 2; The probe GVL-P1 is a single-stranded DNA molecule as shown in sequence 3; The 34th nucleotide of the probe GVL-P1 is labeled with a fluorescent group, and a tetrahydrofuran is inserted between the 35th and 36th nucleotides of the probe GVL-P1. The 37th nucleotide of the probe GVL-P1 is labeled with a quenching group, and the 3' end of the probe GVL-P1 is modified with a C3-Spacer.
2. The primer-probe set according to claim 1, characterized in that: The fluorescent group is the fluorescent group FAM; The quenching group is the quenching group BHQ1.
3. A kit for detecting Staphylococcus aureus L, said kit comprising the primer and probe set as described in claim 1 or 2; said kit having the function of any one of the following a1)-a3): a1) To identify or assist in the identification of whether the virus to be tested is Staphylococcus aureus L; a2) To detect or assist in the detection of whether the sample to be tested is infected with Staphylococcus aureus L; a3) To distinguish or assist in distinguishing Staphylococcus aureus L from other viruses.
4. The primer-probe set of claim 1 or 2 or the kit of claim 3, in any one of the following (b1)-b6): b1) To identify or assist in the identification of whether the virus to be tested is Staphylococcus aureus L; b2) Detection or auxiliary detection of whether the sample to be tested is infected with Staphylococcus aureus L; b3) To differentiate or assist in differentiating Staphylococcus aureus L from other viruses; b4) Prepare products for identification or auxiliary identification of whether the virus to be tested is Staphylococcus aureus L; b5) Prepare products for detecting or assisting in the detection of whether a sample is infected with Staphylococcus aureus L; b6) Prepare products that can distinguish or help distinguish Staphylococcus aureus L from other viruses.
5. A method for detecting or assisting in the detection of whether a sample to be tested is infected with Staphylococcus aureus L, comprising the following steps: using the primer and probe set according to claim 1 or 2 or the kit according to claim 3 to detect the sample to be tested.
6. The method according to claim 5, characterized in that: The method is as follows: c1) or c2): c1) Extract RNA from the sample to be tested, and use the RNA as a template to perform multi-enzyme isothermal rapid amplification using the primer and probe set described in claim 1 or 2 or the kit described in claim 3 to obtain multi-enzyme isothermal rapid amplification products; determine whether the sample to be tested is infected with Staphylococcus aureus L by real-time fluorescence detection of the multi-enzyme isothermal rapid amplification products. c2) Prepare a crude nucleic acid extract of the sample to be tested. Using the crude extract as a template, perform multi-enzyme isothermal rapid amplification using the primer and probe set described in claim 1 or 2 or the kit described in claim 3 to obtain the multi-enzyme isothermal rapid amplification product. Determine whether the sample to be tested is infected with Staphylococcus aureus L by detecting the multi-enzyme isothermal rapid amplification product with real-time fluorescence.
7. The method according to claim 6, characterized in that: In c1), RNA is extracted from the sample to be tested using an adsorption column method.
8. The method according to claim 6, characterized in that: In step c2), a crude nucleic acid extract of the sample to be tested is prepared using NaOH-EDTA buffer.
9. The method according to claim 6, characterized in that: The final concentrations of the forward primer GVL-R3F and the reverse primer GVL-R2R in the multi-enzyme isothermal rapid amplification system were 400 nmol / L. The final concentration of the probe GVL-P1 in the multi-enzyme isothermal rapid amplification system was 160 nmol / L.
10. The method according to any one of claims 6-9, characterized in that: The reaction temperature for the isothermal rapid amplification of the multi-enzyme is 41℃. The reaction time for the multi-enzyme isothermal rapid amplification is 15 minutes.
Citation Information
Patent Citations
RT-qPCR detection kit and oligonucleotides for detecting grapevine virus E
CN104818345A
Primer probe group and kit for detecting grape berry necrosis virus based on MIRA technology and application of primer probe group and kit
CN118326081A
Cited By
A rapid visual detection of grapevine virus l test strip detection reagent kit and application thereof
CN122235379A