Transposons, vectors and genetically engineered cells

Abstract

A transposon is provided comprising a nucleic acid sequence traversing the chromatin open element (UCOE) as well as a nucleic acid sequence of a gene of interest or a fragment thereof under the control of a promoter and optionally a 3'polyadenylation sequence, both sides of which are Piggybactransposon-specific inverted terminal repeats PB 5 'ITR and PB 3' ITR.

Description

Technical Field

[0001] This invention relates to transposons comprising a ubiquitous open chromatin element (UCOE) nucleic acid sequence and a nucleic acid sequence encoding a target gene under promoter control, flanked by Piggybac™ transposon-specific inverted terminal repeat sequences PB 5' ITR and PB 3' ITR; vectors containing such transposons; cells containing such transposons or vectors; and cells that have integrated such transposons; methods for genetically manipulating iPSC cells containing such transposons or vectors and differentiating them into partially or fully mature cells (such as macrophages); and uses of such cells. Background Technology

[0002] US20200157567A1 describes a viral vector containing a transposon and a nucleic acid encoding a transposase. The transposon contains a transgene or insertion site for integration into the genome of a target cell. The expression of the transposase is controlled so that it is not expressed during the production or packaging of the viral vector. Furthermore, the transposon contains a packaging signal for the viral genome, thereby preventing the packaging of any viral genome that has had its transposon removed. Methods for generating modified mammalian cells using the viral vector of the invention and for generating mammalian cells with modified genomes are also disclosed.

[0003] US 20220033845 A1 describes an expression vector for expressing recombinant proteins (e.g., biological agents) in mammalian cells, a host cell containing the expression vector, a method for producing the recombinant protein, and a method for propagating the expression vector.

[0004] AU2019250224B2 describes constructs and methods for expressing target DNA, particularly in non-primate eukaryotic host cells, which demonstrate advantages in terms of expression quantity and quality, including high stability of expression product expression and transport out of cells.

[0005] WO 2022104155A1 describes cells, tissues, organs, and / or animals having one or more modified genes to enhance xenograft survival and / or tolerance. Methods for preparing and using cells, tissues, organs, and / or animals having one or more modified genes are also disclosed.

[0006] EP2417263B1 describes compositions for the in vitro or in vivo production of specific proteins, comprising vector components such as a vector backbone, a promoter, and a target gene encoding the target protein, as well as a transposon-based vector containing these components. Methods for preparing these compositions and methods for using these compositions to produce the desired protein in vivo or in vitro transfected cells are also described.

[0007] KR20210143897A describes a matrix attachment region (MAR), a recombinant vector containing the MAR, a transformant transformed with the recombinant vector, and a method for culturing the transformant to produce the target protein.

[0008] WO 2020164702 A1 describes a polypeptide comprising a transposase and at least one heterologous chromatin reader element (CRE), a polynucleotide encoding the polypeptide, and a carrier comprising the polynucleotide. Artificial transposable elements comprising polynucleotides can target active chromatin via a transposase coupled to a heterologous chromatin reader element.

[0009] https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC5473066 / pdf / tmh-0044- 0135.pdf Ackermann, M. et al. (2017) addressed transgene stability during hematopoietic differentiation into macrophages using genetically modified iPSC lines. They employed lentiviral vectors equipped with CBX3-UCOE or ZFN-mediated targeting of expression cassettes into human AAVS1 safe harbor cells to provide tools for stable transgene expression in iPSCs and differentiating macrophages. Different iPSC lines expressing reporter genes using randomly integrated lentiviral vector expression systems or safe harbor AAVS1 cells allowed for reporter gene expression in pluripotent cells and macrophages derived from them, demonstrating their suitability for efficient expression of therapeutic transgenes in iPSCs.

[0010] https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC4330381 / Müller-Kuller, U. et al. (2015) introduced a functional 0.7 kb minimal CBX3-UCOE and a constitutive or tissue-specific promoter to counteract epigenetic silencing of transgene expression in pluripotent and multipotent stem cells. In addition to preventing promoter silencing, the chromatin-opening function of the CBX3-UCOE element also allows diffusion to adjacent heterologous DNA regions. This characteristic of CBX3-UCOE may be concerning because vectors containing integrated CBX3-UCOEs can alter chromatin states and thus change the expression patterns of genes located near the integration site. Endogenous CBX3 The chromatin opening function of the gene appears to be concentrated in the promoter region and spans approximately 1.5 kb of DNA, as defined by the transition from unmethylated DNA to methylated DNA and the presence of active histone markers. Within the lentiviral vector used, the distance from CBX3-UCOE to the left boundary of the 5'-LTR is 1.7 kb; therefore, theoretically, the minimum distance from the cellular sequence to CBX3-UCOE exceeds the distance covered by the element's chromatin opening effect.

[0011] https: / / pubmed.ncbi.nlm.nih.gov / 31706316 / Skipper KA et al. (2019) modified CHO cells with the core fragment of the HNRPA2B1-CBX3 UCOE in the Sleeping Beauty transposon vector and compared four different protection strategies in CHO-K1 cells, finding robust protection against transgene cassette silencing mediated by ubiquitous chromatin open elements (UCOEs) derived from the HNRPA2B1-CBX3 locus. Using bioinformatics methods, a shorter HNRPA2B1-CBX3 UCOE core fragment was defined and demonstrated to maintain transgene expression in CHO-K1 cells carrying DNA transposon vectors equipped with the shorter HNRPA2B1-CBX3 UCOE core fragment after extended passages.

[0012] Research involving human macrophages has been hampered by technical difficulties in isolating / constructing them in sufficient quantities, the inability to scale them up in vitro, and challenges in genetically modifying the cells (due to their expression of viral and transgene-restricting factors). Human induced pluripotent stem cells (iPSCs) can be readily genetically modified via viral and non-viral vectors and then used to generate macrophages in large quantities. However, after differentiation from iPSCs into macrophages, transgene expression from currently used vectors typically undergoes strong or complete transcriptional silencing / repression. 1 Therefore, novel vectors that allow transgene expression to continue from iPSCs to the mature macrophage stage will be valuable tools in this field. Summary of the Invention

[0013] This invention provides: 1. A transposon comprising a ubiquitous open chromatin element (UCOE) nucleic acid sequence, a nucleic acid sequence of a gene or a fragment thereof encoding a target protein under promoter control, and optionally a 3' polyadenylated sequence, flanked by Piggybac™ transposon-specific inverted terminal repeat sequences PB 5' ITR and PB 3' ITR.

[0014] In its simplest form, the transposon will have the following structure, wherein the promoter, the coding sequence, and the polyadenylation sequence (if present) are operatively linked to express the target gene / protein or a fragment thereof.

[0015] PB 5' ITR-UCOE-promoter-gene sequence or fragment thereof-[optional dodecaA]-PB 3' ITR 2. The transposable as described in Clause 1, wherein the UCOE is a CBX3 UCOE (UCOE CBX3 Nucleic acid sequence.

[0016] 3. The transposon as described in Clause 1 or Clause 2, wherein the UCOE is the nucleic acid sequence of SEQ ID NO: 1.

[0017] 4. The transposon as described in any of the preceding clauses, wherein the Piggybac™ transposon-specific inverted terminal repeat sequences are PB 5' ITR (SEQ ID NO: 2) and PB 3' ITR (SEQ ID NO: 3).

[0018] 5. A transposon as described in any of the preceding clauses, wherein the promoter, the target gene, and optionally a 3' polyadenylated sequence are contained within an expression cassette.

[0019] 6. The transposon as described in any of the preceding clauses, wherein the expression box contains (a) Promoter, (b) At least one cloning site (restriction enzyme cleavage site) or multiple cloning site downstream of the promoter, (c) The target gene or a fragment thereof downstream of and operatively linked to the promoter. (d) A polyadenylated sequence located downstream of the target gene or a fragment thereof and operatively linked to the target gene or a fragment thereof. (e) Optional internal ribosome entry site, (f) Optionally, a second promoter sequence located downstream of the target gene and the polyadenylation sequence. (g) A fluorescent protein sequence optionally located downstream of the second promoter and operatively linked to the second promoter. (h) Self-cleaving peptide sequence (i) optionally used for selecting genes, for example, for antibiotic selection, and / or (j) Optional fluorescent protein gene, (k) Optional second polyadenylation sequence.

[0020] In embodiments of the invention, the transposon and / or expression cassette may contain one or more optional components, such as those selected from (e) to (g) and (i) to (k); in preferred embodiments of the invention, the transposon and / or expression cassette may contain all optional components (e) to (g) and (i) to (k). The component sequence of the transposon and / or expression cassette of the invention will generally be present in the listed order.

[0021] 7. The transposon as described in Clause 6, wherein the expression box contains (a) CMV promoter, (b) The multiple cloning site downstream of this promoter. (c) A target gene operatively linked downstream of and to the promoter, optionally wherein the target gene is the human SIGLEC10 gene of SEQ ID NO: 4. (d) Bovine growth hormone polyadenylation signal (bGH poly(A) signal) located downstream of and operatively linked to the target gene (SEQ ID NO: 5). (e) Optional internal ribosome entry site, (f) The EF1-α (short form) (SEQ ID NO: 6) sequence located downstream of the target gene and the polyadenylation sequence, and (g) The fluorescent protein (CopGFP (SEQ ID NO: 7)) sequence located downstream of this second promoter, (h) The T2A self-cleaving peptide sequence located downstream of the fluorescent protein sequence (SEQ ID NO: 8). (i) Purinomycin resistance gene, and (j) SV40+(A): Simian virus 40+adenosine-modified sequence.

[0022] 8. The transposon as described in Clause 6, wherein the expression box comprises: (a) CAG promoter, (b) The multiple cloning site downstream of this promoter. (c) A target gene downstream of and operatively linked to the promoter, optionally wherein the target gene is the dCas9-KRAB sequence of SEQ ID NO: 9 (an inactive / inactivated Cas9 with a repressor domain and a nuclear localization signal sequence). (d) The T2A self-cleaving peptide sequence (SEQ ID NO: 8) located downstream of the dCas9-KRAB sequence of the target gene, such as SEQ ID NO: 9, and (e) The fluorescent protein gene sequence encoding eGFP (enhanced green fluorescent protein) located downstream of the T2A self-cleaving peptide sequence (SEQ ID NO: 8), and (f) rBG polyadenylation sequence.

[0023] 9. The transposon as described in Clause 6, wherein the expression box comprises: (a) CAG promoter, (b) The multiple cloning site downstream of this promoter. (c) A target gene downstream of and operatively linked to the promoter, optionally wherein the target gene is the dCas9-VPR sequence of SEQ ID NO: 10. (d) The T2A self-cleaving peptide sequence located downstream of the dCas9-VPR sequence of the target gene, such as SEQ ID NO: 10, and (e) The fluorescent protein gene sequence encoding eGFP (enhanced green fluorescent protein) located downstream of the T2A self-cleaving peptide sequence (SEQ ID NO: 8), and (f) rBG polyadenylation sequence.

[0024] 10. A vector comprising a transposon as described in any of the preceding clauses, preferably wherein the vector is a PiggyBac™ vector, such as a plasmid vector of SEQ ID NO: 11, SEQ ID NO: 13 or SEQ ID NO: 14.

[0025] 11. A cell comprising a transposon and / or a vector as described in any one of clauses 1 to 10, optionally comprising a second vector capable of expressing a transposase, preferably wherein the transposase is a PiggyBac™ transposase.

[0026] 12. A cell comprising a transposon as described in any one of clauses 1 to 11, wherein the transposon is integrated into the cell genome.

[0027] 13. Cells as described in Clause 11 or Clause 12, wherein the cells are selected from undifferentiated cells, partially differentiated cells, and fully differentiated cells, optionally wherein the differentiation status is assessed by using a set of flow cytometry markers.

[0028] 14. The cell as described in any one of Clauses 11 to 13, wherein the cell is selected from induced pluripotent stem cells (iPSCs), partially or fully differentiated iPSC-derived macrophages, iPS-derived neutrophils, NK cells, monocytes, myocytes, hepatocytes, neurons, and progenitor cells.

[0029] 15. A method for: (a) To prevent the silencing of the target gene (transgenic gene), (b) Promote the expression of the target gene. (c) The product expressing the target gene, and / or (d) Expression bins with larger sizes (≥ 7.0 Kb), The method includes culturing cells as described in any one of clauses 11 to 14.

[0030] 16. A method for: (a) Preventing the silencing of the target gene (transgenic gene), and / or (b) Maintaining the expression of the target gene during differentiation. The method involves culturing cells as described in any one of clauses 11 to 14 in the presence of differentiation stimuli.

[0031] 17. A method for knocking down (downregulating) the expression of a target gene, the method comprising culturing cells containing dCas9-KRAB as described in any one of clauses 11 to 14 in the presence of a target gene-directed gRNA (e.g., delivered via a lentiviral vector).

[0032] 18. A method for inducing or upregulating the expression of a target gene, the method comprising culturing cells containing dCas9-VPR as described in any one of clauses 11 to 14 in the presence of a target gene-directed gRNA (e.g., delivered via a lentiviral vector).

[0033] 19. A composition comprising a transposon, a carrier and / or a cell, and a loading agent as described in any one of Clauses 1 to 14.

[0034] 20. A composition comprising a transposon, a vector and / or a cell as described in any one of clauses 1 to 14, and a vector capable of expressing a transposase.

[0035] 21. A gene transfer system comprising a transposon, a vector and / or a cell, and a transposase as described in any one of clauses 1 to 14.

[0036] 22. The gene transfer system as described in Clause 21, wherein the transposase is a Piggybac™ transposase.

[0037] 23. A method for regulating the expression of a target gene in cells, the method comprising: (a) Introducing the vector as described in Clause 10 into the cells. (b) Introducing a vector encoding a transposase, preferably a Piggybac™ transposase, into the cell, and (c) Introduce a vector containing a guide RNA that can control the expression of the target gene into the cell.

[0038] 24. A method for integrating a target gene into the genome of a cell, the method comprising contacting the cell with a gene transfer system as described in Clause 21, thereby integrating the target gene into the cell.

[0039] 25. A method for knocking down (downregulating) a target gene in a cell, the method comprising contacting the cell with a gene transfer system as described in Clause 21 to introduce and integrate dCas9-KRAB, and introducing gRNA (preferably delivered via a lentiviral vector) into the cell to knock down the expression of the target gene.

[0040] 26. A method for upregulating a target gene in a cell, the method comprising contacting the cell with a gene transfer system as described in Clause 21 to introduce and integrate dCas9-VPR, and introducing gRNA (delivered via a lentiviral vector) into the cell to upregulate the expression of the target gene. Detailed Implementation

[0041] The cells of this invention can be used for research, drug discovery, and development, for example, for screening methods (such as CRISPR screening) to identify novel targets, or for screening antibodies or small molecule inhibitors of target genes. The transposons, expression cassettes, vectors, cells, compositions, gene transfer systems, and methods of this invention can be used to select lead candidate molecules, for target validation of macromolecules and small molecules, and for biological, safety, and toxicological studies.

[0042] The transposons, expression cassettes, vectors, cells, compositions, gene transfer systems, and methods of the present invention can be used for biomarker discovery.

[0043] The transposons, expression cassettes, vectors, cells, compositions, gene transfer systems, and methods of the present invention can be used in cell therapy, such as for CRISPR knockdown of HLA in iPSCs, to provide universal HLA silencing knockdown cells.

[0044] The transposons, expression cassettes, vectors, cells, compositions, gene transfer systems, and methods of the present invention can be used for autologous iPSC gene editing to engineer the cells of a subject, and then the engineered cells are administered back to the patient.

[0045] This invention provides a safe, robust, and rapid method for generating genetically engineered iPSC-macrophages via modified transposon-based vectors that ensure sustained transgene expression.

[0046] Sustained transgene expression in iPSC differentiated cells can be achieved through targeted genetic engineering methods using zinc finger nucleases, TALEN, or CRISPR / Cas9, which allow transgenes to integrate into safe harbor loci such as the AAVS1 locus. 2,3 While this method is safe (it introduces a transgene into a known site in the genome) and robust, it has three main drawbacks: 1) It is very time-consuming because the efficiency of introducing a transgene into a single site implies a lower efficiency of successful genetic engineering. 2) Introducing large transgene / DNA fragments significantly reduces the efficiency of this method. 3) There is a limit to how many transgenes can be inserted into the genome in a single round of targeting (this method does not allow for larger, more complex multi-transgene approaches, such as inserting sgRNA libraries for genome-wide CRISPR-based screening).

[0047] One approach to achieving sustained transgene expression through random integration is to use lentiviral vectors equipped with elements (such as ubiquitous chromatin opening elements (UCOEs)) that can actively remodel the local chromatin environment and activate transcription. 4 Viral vectors containing a 1.5 kb unmethylated CpG island (A2UCOE) from the human HNRPA2B1-CBX3 housekeeping gene or a minimum 0.7 kb sequence covering only the CBX3 gene can prevent transgene silencing and variegation in cell lines, pluripotent and multipotent stem cells and their differentiated progeny (including macrophages). 5 This method avoids the drawback of not being able to insert several transgenes / DNA fragments / libraries in a single targeting round. It also reduces the time required to generate genetically modified iPSC lines. However, the main drawbacks of this method are twofold: lentiviral vectors have gene cargo limitations that prevent the introduction of large transgene / fusion gene sequences, and laboratories need specialized biohazard control procedures for virus packaging and virus-based gene delivery.

[0048] Based on DNA transposons (such as Piggybac™ or Sleeping Beauty (…) Sleeping Beauty Piggybac™ vectors are effective non-viral tools for gene therapy and cell genetic engineering. Compared to their viral counterparts, these vectors offer a safer, faster, and less costly way to generate genetically modified iPSC lines. This is because there is no need to package the virus or perform cumbersome quality assurance procedures such as titrating the vector and testing for replication capability. This approach involves only plasmid manipulation and can therefore be easily performed in a biosafety level 1 / 2 laboratory with basic equipment without complex biohazard control procedures. Furthermore, it has been reported that when compared to viral tools, Piggybac™ and... SB Transposon gene transfer is considered a safer tool due to its integration pattern. 6 Another advantage is that these vectors have no cargo restrictions, avoiding the problem of large transgenes not being able to be inserted into the host genome.

[0049] Promoter DNA methylation and the near-random integration patterns of transposon-based systems typically result in transgene integration into heterochromatin, making such vectors susceptible to transcriptional repression / silencing (Skipper et al., 2019, ibid.). Therefore, we infer that it may be necessary to protect transposon-embedded transgenes with anti-silencing elements to ensure sustained transgene expression. We hypothesize that integrating a minimum 0.7 kb sequence covering the CBX3 gene into the Piggybac™ vector could provide a tool for genome editing of iPSCs, allowing for sustained transgene expression in differentiated progeny such as macrophages.

[0050] The PiggyBac™ transposon system (Systems Biosciences (SBI), Palo Alto, CA; Hera BioLabs, Inc., Lexington, Kentucky) consists of a PiggyBac vector and a Super PiggyBac transposase that recognizes transposon-specific inverted terminal repeats (ITRs) and efficiently integrates the ITR and intercalated DNA into the genome at the ttaa site. The Super PiggyBac transposase is delivered to cells via a Super PiggyBac transposase expression vector (SEQ ID NO: 24), which is co-transfected with one or more PiggyBac vectors. The PiggyBac transposon system uses a cut-and-paste mechanism to transfer DNA from the PiggyBac vector into the genome.

[0051] This invention uses the transposon machine of the “ttaa” specific PiggyBac® transposon to insert a targeted functional heterologous DNA sequence (target gene) into the genome of a host cell, and uses CBX3 UCOE to prevent silencing of the target gene expression. The resulting transformed cells or cell groups are stable transformants that will pass the introduced gene to all subsequent progeny. For the purposes of this invention, the targeted functional heterologous DNA “target gene” is any heterologous DNA capable of being expressed in a host cell.

[0052] The conversion system of the present invention includes a modified piggyback-CBX3 UCOE transposon (PB-UCOE). CBX3A vector containing transposons, which may include a marker construct, such as an enhanced green fluorescent protein (EGFP) gene operatively linked to a suitable promoter. This vector can be used to transform transgenic organisms and to detect transgenic organisms based on the expression of a marker (e.g., a green fluorescent protein marker) under ultraviolet light. Following chromosomal integration and inheritance of the vector, marker expression will occur in all daughter cells. The transformation system of the present invention also includes a PiggyBac transposase vector. The generation of transformed cells requires first physically placing a vector containing functional heterologous DNA into a host cell. Various transformation techniques can be used to introduce vector DNA into cells. A DNA sequence flanked by inverted transposon repeats will be inserted into the cell's genome. This DNA will then be passaged into daughter cells. Transformed cells can be selected from untransformed cells, for example, when the transformation system includes an enhanced green fluorescent protein gene that produces an altered visible phenotype under ultraviolet light. Using standard techniques known to those skilled in the art, such as DNA blotting and polymerase chain reaction, DNA can be isolated from transformed cells to confirm that the introduced DNA has been inserted.

[0053] To the best of our knowledge, this invention represents for the first time the use of the PiggyBac system containing the UCOE CBX3 sequence to generate genetically modified iPSC lines, and most importantly, to generate genetically engineered human iPSC-derived macrophages. Integrating a minimum of 0.7 kb UCOE CBX3 sequence into the PiggyBac vector and using it to transform iPSCs allows for the generation of human genetically engineered macrophages within a shortened timeframe compared to prior art methods.

[0054] Novel vectors prevent the silencing of transgenes in differentiated cells (macrophages) derived from iPSCs. These vectors are advantageous compared to viral vectors because they offer a safer, faster, and less expensive method for generating genetically modified iPSC lines. No virus packaging or cumbersome quality assurance procedures, such as vector titration and testing for replicative viruses, are required. It involves only plasmid manipulation and can therefore be easily performed in a biosafety level 1 / 2 laboratory with basic equipment, without complex biohazard control procedures. Gene transfer based on PiggyBac and SB transposons is considered safer than viral tools due to their integration patterns. These vectors have no cargo limitations, thus avoiding the problem of large transgenes failing to insert into the host genome. Attached Figure Description

[0055] Figure 1A. Map of plasmid PB-UCOE-SIGLEC10 (SEQ ID NO: 11). PB: PiggyBac, ITR: inverted tandem repeat, UCOE: ubiquitous chromatin open element, CMV: cytomegalovirus, hSIGLEC10: optimized codon 10 sequence of human sialic acid-binding Ig-like lectin, bGH (A): bovine growth hormone polyadenylation sequence, EF1α: elongation factor 1-α, CopGFP: green fluorescent protein of copepod Pontellina plumate, T2A: 2A self-cleaving peptide, PuroR: puromycin resistance gene, SV40 (A): simian virus 40. polyadenylation sequence Figure 2 A. Representative flow cytometry histograms of CopGFP expression in untransfected SFCi55 wild-type iPS cells and SFCi55-iPSC cells transfected with PB-UCOE-SIGLEC10 + SuperPiggyBac transposase. B. Representative flow cytometry histograms of SIGLEC10 protein expression in untransfected SFCi55-iPS cells and SFCi55-iPSC cells transfected with PB-CBX3-SIGLEC10 + SuperPiggyBac transposase. C. Representative flow cytometry histograms of CopGFP expression in iPSC-derived macrophages derived from untransfected SFCi55-iPS cells and macrophages derived from SFCi55-iPSC cells transfected with PB-CBX3-SIGLEC10 + SuperPiggyBac transposase. D. Representative flow cytometry histograms of SIGLEC10 protein expression in iPSC-derived macrophages (left) derived from untransfected SFCi55-iPSC cells and macrophages derived from SFCi55-iPSC cells transfected with PB-CBX3-SIGLEC10 + Super PiggyBac transposase.

[0056] Figure 3A. Representative flow cytometry histograms of SIGLEC10 expression in iPSC cells (stem cell stage) from the parental line SFCi55 WT (wild type) and the following three PB-UCOE-SIGLEC10 engineered clone lines: SIGLEC10 1.3, SIGLEC10 2.19, and SIGLEC10 2.39. SIGLEC10 OE represents SIGLEC10 overexpression. B. Representative flow cytometry histograms of SIGLEC10 expression in cells (macrophage stage) from the parental line SFCi55 wild type and three engineered clone lines (SIGLEC10 1.3, SIGLEC10 2.19, and SIGLEC10 2.39). C. Compilation of ΔMFI (median fluorescence intensity of samples stained with SIGLEC10 antibody minus the median fluorescence intensity of samples stained with IgG1 isotype) of macrophages derived from the SFCi55 parental line and three modified clone lines (SIGLEC10 1.3, SIGLEC10 2.19, SIGLEC10 2.39), n = 3.

[0057] Figure 4 Expression profiles of the SFCi55 parental wild-type line against the following three distinct SIGLEC10 overexpression (SIGLEC10 OE) iPSC clones for the markers CD45, CD93, 25F9, CD14, CD163, and CD169: 1.3, 2.19, and 2.39. Flow cytometry histograms represent one of three independently performed replicate experiments.

[0058] Figure 5 Phagocytic levels of macrophages from parental lines and SIGLEC10-overexpressing macrophages (from clone lines SIGLEC10OE 1.3, 2.19, and 2.39). Phagocytosis was quantified as the area under the curve (AUC) of red fluorescence measured at 20-min intervals over 5 h. Engineered Jurkat cells expressing CD24 were labeled with pHrodo red and administered as bait at a ratio of 3 Jurkat cells to 1 macrophage. (n = 6 biologically independent samples, Kruskal-Wallis test and Dunn post-hoc test). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0059] Figure 6A. Map of the PB-UCOE-dCas9KRAB-eGFP plasmid. PB: PiggyBac, ITR: Inverted tandem repeat, UCOE: Pervasive chromatin open element, CAG promoter: A hybrid construct consisting of a cytomegalovirus (CMV) enhancer fused with a chicken β-actin promoter, dCas9 KRAB(ns): Inactive Cas9 with a Krüppel-associated box (KRAB) domain and a nuclear signaling sequence, T2A: 2A self-cleaving peptide, eGFP: Enhanced green fluorescent protein, rBG (A): Rabbit β-globin polyadenylation sequence. B. Representative histograms of eGFP expression in SFCi55 WT iPSC-derived macrophages and dCas9-KRAB-GFP iPSC-derived macrophages. C. Map of the LV-UCOE-U6gRNA plasmid. LTR: Lentiviral long terminal repeat; RRE: Rev response element; cPPT: Central polypurine region sequence; UCOE: Universal chromatin opening element; U6 promoter: Type III RNA polymerase III promoter; Filler fragment: Random DNA sequence that facilitates gRNA cloning; sgRNA scaffold: Single guide RNA scaffold; EF1α: Elongation factor 1-α; mTagBFP2: Basic (constitutive fluorescence) blue fluorescent protein derived from the tetracolor anemone; T2A: 2A self-cleaving peptide; PuroR: Puromycin resistance gene; WPRE: Posttranscriptional regulatory element sequence of marmot hepatitis virus (WHP); SV40+(A): Simian virus 40+adenosine-modified sequence. D. Representative histograms of eGFP (top) and mTagBFP2 (bottom) of dCas9-KRAB-GFP iPSC-derived macrophages infected with the following LV-UCOE-U6gRNA lentivirus at the iPSC stage: NTCsgRNA (non-targeting single guide RNA (middle)) and B2MsgRNA (targeting human β2-microglobulin single guide RNA (right)).

[0060] Figure 7A. Representative histograms of B2M expression (β2-microglobulin) in SFCi55 WT, uninfected dCas9-KRAB-GFP iPSC-derived macrophages, or dCas9-KRAB-GFP iPSC-derived macrophages infected with LV-UCOE-U6gRNA (NTC gRNA and B2M gRNA) at the iPSC stage. B. Representative histograms of MHC-I expression (from top to bottom: HLA-ABC, HLA-G, HLA-E, HLA-F) in uninfected dCas9-KRAB-GFP iPSC-derived macrophages or those infected with LV-UCOE-U6gRNA (NTC gRNA and B2M gRNA) at the iPSC stage.

[0061] Figure 8 A. Expression profiles of SFCi55 WT macrophages compared to macrophages derived from the dCas9-KRAB-GFP iPSC line for the markers CD45, CD93, 25F9, CD14, CD163, and CD169. B. Phagocytic index measurements of SFCi55 WT macrophages and dCas9-KRAB-GFP iPSC-derived macrophages based on polarization status. Macrophages from both lineages were either polarized with LPS + IFNγ, IL-4, and IL-10 or left unpolarized. Phagocytosis was quantified as the area under the curve (AUC) of red fluorescence measured at 20-min intervals over 5 h. Zymosan beads were used as bait; they were transparent at neutral pH but fluoresced red when taken up by macrophages (n = 8 biologically independent samples, Kruskal-Wallis test and Dunn post-hoc test); ns represents statistically insignificant.

[0062] Figure 9 Representative histograms of B2M (β2-microglobulin) expression on SFCi55 WT macrophages and dCas9-KRAB iPSC-derived macrophages. From left to right: untransduced, transduced with NTC gRNA (non-targeting single guide RNA) or B2MsgRNA (targeting single guide RNA for human β2-microglobulin).

[0063] Figure 10A. Plasmid map of PB-UCOE-dCas9VPR-eGFP. PB: PiggyBac, ITR: inverted tandem repeat, UCOE: ubiquitous chromatin open element, CAG promoter: a hybrid construct consisting of a cytomegalovirus (CMV) enhancer fused with a chicken β-actin promoter, dCas9+VPR(VP64, p65+Rta)(ns): inactive Cas9 with VPR domains (VP64, p65, Rta) and nuclear signaling sequences, T2A: 2A self-cleaving peptide, eGFP: enhanced green fluorescent protein, rBG+(A): rabbit β-globin polyadenylation sequence. B. Flow cytometry histograms representing CD4 expression in macrophages derived from the dCas9VPR-A18 clone transduced with NTC sgRNA (non-targeting single guide RNA) or CD4gRNA (CD4-targeting single guide RNA). C. Representative flow cytometry histograms of SIGLEC10 expression in dCas9VPR-A18 lineage-derived macrophages transduced with NTC gRNA or SIGLEC10 gRNA. D. Flow cytometry histograms representing one experiment of macrophages from the dCas9-VPR A18 lineage for the following pan-macrophage markers: CD45, CD93, 25F9, CD11b, CD14, CD163, and CD169. E. Phagocytic index measurements of SFCi55 WT macrophages and dCas9-VPRA18 iPSC-derived macrophages based on polarization status. Macrophages from both lineages were polarized with LPS + IFNγ, IL-4, and IL-10, or left unpolarized. Phagocytosis was quantified as the area under the curve (AUC) of red fluorescence measured at 20-min intervals over 5 h. Zymosan beads were used as bait; they were transparent at neutral pH but fluorescent red when taken up by macrophages (for all, n = 6 biologically independent samples, except for untreated macrophages: n = 11, Kruskal-Wallis test and Dunn post-hoc test); ns represents statistically insignificant.

[0064] Figure 11 An improved graphical representation of the iPSC-derived macrophage genetic engineering process, illustrating key events and timescales. Traditional methods typically take 20-24 weeks, while the system described in this invention can reduce the timescale to as little as 2 weeks.

[0065] Example Materials and Methods Cell culture Human iPSC maintenance As described in (Yang et al., 2017), the human induced pluripotent stem cell (iPSC) line SFCi55 (parental control) was generated. In short, the SFCi55 iPSC line was initially generated from fibroblasts obtained from individuals with blood type O and cytomegalovirus negative, with ethical approval granted by R Biomedical under REC 1 / AL / 0020, and programmed into iPSCs using Yamanaka factor on an adjuvant vector. The line has been confirmed to be pluripotent and possess a normal karyotype.

[0066] Human induced pluripotent stem cells (hiPSCs) from SFCi55 and all derivatives were subjected to a concentration of 0.5 μg / cm³. 2 mTESR in tissue culture-treated 6-well plates coated with hydroxylamine (Invitrogen, catalog number A31804) ™ Cells were cultured in Plus medium (Stem Cell Technologies, catalog number 100-0276). Cells were then used with ReLeSR... TM (Stem cell technology company, catalog number 05872) passaged every 5-7 days at a seeding ratio of 1:10-1:20.

[0067] Construction of iPSC lines using genome editing (PiggyBac) Through 100 µl Opti-MEM TM To prepare the DNA-lipid complex, dilute 10 µl of Lipofectamin STEM (Thermofisher, STEM00008) in Gibco (catalog number 31985062) to a solution of 10 µl of Opti-MEM. In the separate reaction, 2.5 µg of total DNA (2 µg expression plasmid + 0.5 µg transposase plasmid) was added to 100 µl of Opti-MEM. TM Mix the two reactions at a 1:1 ratio and incubate for 10 minutes.

[0068] SFCi55 wild-type iPSC cells were washed once with PBS (magnesium and calcium-free) and then incubated with Accutase (Gibberellic A1110501) for 3 minutes. 1 ml of mTESR medium was added, and the cells were dissociated, centrifuged, and counted. Cells were then cultured at 1 x 10⁻⁶ cells / mL. 4 1 cell / well seeded in a 6-well plate containing less than 2 ml of cloning medium: [Supplemented with CloneR] TM2 mTESR Plus medium (1:10, Stem Cell Technology Company, Catalogue No. 100-0691) were added dropwise to each well, leaving one well as an untransfected control. After 2 days, the medium was replaced with fresh cloning medium. From day 4 onwards, the medium was replaced with mTESR Plus medium according to the normal iPSC culture procedure.

[0069] To sort genome-edited cells, after amplification to the desired confluence, cells were dissociated using Accutase and the dominant GFP population was sorted by flow cytometry. The sorted cells were seeded into 96-well plates (1 cell per well) or into 10 cm culture dishes at a density of 600 cells / dish, pre-coated with tebuconazole and containing cloning medium. After 2 days, the medium was replaced with fresh cloning medium. From day 4, the medium was replaced with mTESR Plus according to the normal iPSC culture procedure. On day 7, colonies were picked and transferred to 24-well plates pre-coated with tebuconazole for further amplification for approximately 7 days, then transferred to 6-well plates using ReLeSR.

[0070] iPSCs differentiate into macrophages Macrophage differentiation was performed using a protocol reported in (Lopez-Yrigoyen et al., 2018, 2019, 2020) as the baseline. The maintenance medium in one confluence well of the iPSCs in a 6-well plate was replaced with 1 ml of Mix1, which consisted of mTESR Plus (Stem Cell Technology, Inc., Catalog No. 100-0276) supplemented with 50 ng / ml BMP4 (Research & Diagnostics Systems, Inc. (R&D), Catalog No. 314-BP-050), 50 ng / ml VEGF (Research & Diagnostics Systems, Inc., Catalog No. 293-VE-050), and 20 ng / ml SCF (Ingenieur, Inc., Catalog No. PHC2111). StemPro was used. TM EZPassage TMColonies were cut using a tool (EmbryoMax®, catalog 23181010) and transferred to two wells containing 2.5 ml of Mix1. These were then cultured in ultra-low adhesion 6-well plates (Greiner, catalog 657970) to induce embryoid body (EB) formation. After 2 days, the medium was filled with 500 µl of concentrated fresh Mix1 cytokines [BMP4 (300 ng / ml), VEGF (300 ng / ml), and SCF (120 ng / ml)]. On day 4, the medium was completely replaced by first collecting the EBs, allowing them to settle by gravity into 50 ml Falcon tubes, and then resuspending them in fresh Mix1 medium (3 ml / well). On day 6, the tissue culture-treated 6-well plates were coated with 1 ml / well of EmbryoMax® 0.1% gelatin solution (Merck, catalog ES-006-B) for 30 minutes. Then replace the gelatin with 3 ml of Mix2 medium supplemented with 100 ng / ml CSF1 (Biolegend, catalog 574808), 25 ng / ml IL-3 (Peprotech, catalog 200-03), 1% penicillin-streptomycin (Gibberellic Acid, catalog 15140122), 2 nM Glutamax (Gibberellic Acid, catalog 35050061), and 0.55 mM β-mercaptoethanol (Gibberellic Acid, catalog 31350010) in X-VIVO15 (Lonza, catalog BE02-060F). Collect the EB into 50 ml tubes and, after settling to the bottom by gravity, resuspend them in a small amount of Mix2 medium. Add 10–15 EB samples to each well of a gelatin-coated 6-well plate. Starting 2-3 weeks after EB plating, harvest non-adherent macrophage precursor cells every 3-4 days for up to 3 months: collect the culture medium from the EB plates and filter it using a 40 µm cell filter. Refill the EB plates with 3 ml of Mix 2 and return them to the incubator. Introduce macrophage precursors at a rate of 3-4 x 102 5 Cells / well were seeded at a density of 100 cells / well in Mix-3 medium (supplemented with 100 ng / ml CSF1, 2 nM Glutamax, and 1% penicillin-streptomycin) in 6-well tissue culture-treated plates. Macrophage precursors in Mix-3 were incubated for at least 7 days to mature into fully differentiated macrophages. On day 7, mature macrophages were used for assays, or the medium was replenished with Mix-3 and cultured for further assays. No assays were performed after day 15 following macrophage precursor collection.

[0071] Macrophage polarization / activation Adherent iPSC-derived macrophages (iPSC-DM) were activated in vitro into three distinct phenotypes: M(LPS+IFN-γ), M(IL-4), and M(IL-10) by treatment with 20 ng / ml LPS (Sigma, catalog number L2654), 20 ng / ml IFN-γ (Peptec, catalog number 300-02), 20 ng / ml IL-4 (Peptec, catalog number 200-04), or 5 ng / ml IL-10 (Peptec, catalog number 200-10), respectively. For the VPR A18 line assay, the IL-4 concentration was 10 ng / ml. Cytokine treatment was performed for 48 h.

[0072] Jurkat cell culture Jurkat E6 cells were purchased from ATCC (catalog number TIB-152), and the Jurkat CD24-overexpressing (CD24-OE) cells were internally constructed. Both cell lines were cultured in RPMI-1640 + Glutamax medium (Thermo Fisher Scientific, catalog number 61870-010) supplemented with 10% final concentration of fetal bovine serum (FBS) (Thermo Fisher Scientific, catalog number 10500064). Cells were passaged every 2–3 days to maintain a concentration of 1 x 10⁶ cells / day. 5 With 1 x 10 6 Cell density between viable cells / mL. Notably, CD24-OE cells were maintained at a final concentration of 2 mg / ml with G418 (Thermo Fisher Scientific, catalog number 10131035).

[0073] For the construction of CD24-OE cells, plasmid pcDNA3.1+C-(K)-DYK hCD24 NM_013230.3 was purchased from GenScript (Catalog No. OHu23288D). The pcDNA™ 3.1(+) vector contains a neomycin resistance gene for selecting stable cell lines using neomycin (Geneticin® or G418). To obtain stable transfectants, plasmid pcDNA3.1+C-(K)-DYK hCD24 NM_013230.3 was linearized with Pvu-I HF (New England Biolabs (NEB), Catalog No. R3150L) restriction enzyme according to the manufacturer's instructions. 1 x 10 5Cells were transfected with 0.5 μg DNA and 2.75 μl Lipofectamine® LTX (Thermo Fisher Scientific, Catalog No. 15338100) diluted to 100 μl of serum-free Opti-MEM® I serum-reduced medium (Gibco, Catalog No. 31985070). The plasmid and transfection reagent solution were mixed and incubated at room temperature for 25 min, then added directly to the cells in 12-well plates. The medium was changed 24 h post-transfection. Antibiotic selection was initiated 72 h post-transfection: G418 was added at a final concentration of 2 mg / ml and maintained under selection from then on. CD24 expression was tested by flow cytometry before each phagocytosis assay to ensure that at least 90% of cells expressed the transgene.

[0074] HEK293 culture Lenti-X HEK293T cells were purchased from Takara Clontech (catalog number 632180) and cultured in Iscove's Modified Dulbecco's Medium (IMDM) (Sigma, catalog number I3390) supplemented with Glutamax (1:100) (Gibco, catalog number 35050-038) and 10% final concentration of FBS (Thermo Fisher Scientific, catalog number 10500064). Cells were passaged every 2 to 3 days at a ratio of 1:8 or 1:10 after washing once with PBS and using trypsin (Gibco, catalog number 15050065).

[0075] Flow cytometry iPSC-derived macrophages were detached from cell culture plates by incubation for 4 minutes with cell dissociation buffer [5 mM EDTA in PBS without calcium and magnesium]. Cells were removed from the plates using P1000 pipettes and then counted. Cells were centrifuged at 200 g for 3 min, and cells <10⁻⁶ were discarded. 7 Cells were incubated on ice in 80 μl FACS buffer [cell dissociation buffer containing 2% BSA] and FcR blocking reagent (for <10 cells / year). 7 Resuspend the cells in 20 μl for 20 min. Then centrifuge the cells at 200 g for 3 min and centrifuge at 2 x 10⁻⁶ m³ / h for 20 min. 6 Resuspend cells at 100 cells / mL. 5Cells were added at a density of 100 μl per sample to 96-well U-bottom plates. The corresponding primary antibody and isotype control were added to the wells and gently mixed, followed by incubation at 4°C in the dark for 30 min. All primary antibodies were at a final concentration of 10 μg / ml (unless otherwise specified). FACS buffer (100 μl) was then added to each well, the plate was centrifuged at 200 g for 3 min, and the supernatant was removed. Cells were resuspended in FACS buffer and viability dye (DAPI or propidium iodide, diluted 1:1000) was added. Flow cytometry was performed using a 6-laser Fortessa flow cytometer and FACS Diva software.

[0076] Antibody Surface

[0077] Phagocytosis assay Cancer cell phagocytosis assay Two to three days before live-cell imaging, iPSC-derived macrophages from the SFCi55 parental line and the SIGLEC10 overexpression line were cultured at a concentration of 2 × 10⁻⁶ cells / year. 4 / The density of the wells in the imaging 96-well plate after TC treatment ( CellCarrier-96 Ultra microplate The macrophage maturation medium of less than 100 μl from Perkin Elmer (catalog number 6055300) is X-VIVO15 medium (Lonza, catalog number BE02-060F) supplemented with 100 ng / ml recombinant human CSF1 (Baijin, catalog number 574808), 2 mM Glutamax (Ingenie, catalog number 35050038) and 1% penicillin-streptomycin (Gibberco, catalog number 15140-122).

[0078] On the day of assay, 48 h / 72 h after macrophage seeding, Jurkat WT cells or Jurkat-CD24 overexpressing cells were stained using the IncuCyte® pHrodo® Orange Phagocytic Cell Marking Kit (Sartorius, catalog number 4766). Briefly, cells were collected, centrifuged at 200 g for 4 min, and washed with IncuCytepHrodo cell wash buffer (1 x 10⁻⁶). 6 Wash with 1 cell / ml washing buffer. Centrifuge at 200 g for 4 minutes, then resuspend the pellet in IncuCyte pHrodo cell labeling buffer to a density of 1 x 10⁻⁶ cells / ml. 6Cells / ml. Dissolved IncuCyte pHrodo Orange cell marker dye was added to the cell suspension at a final concentration of 600 ng / ml. The cell suspension was mixed and then incubated at 37°C for 1 h (mixing cells every 20 min incubation time). To remove excess IncuCyte pHrodo marker dye, the cells were centrifuged at 1300 rpm for 7 min. The cell pellet was then centrifuged at 1.2 x 10⁻⁶ cells / ml. 6 Macrophages were resuspended at a density of 100 cells / ml in macrophage maintenance medium. 50 μl of cell suspension (60,000 cells) was placed into each well containing macrophages (macrophage:target cell ratio of 1:3). The plate was immediately placed in the Incucyte S3 Live imaging system. Acquisitions were performed at 20X magnification, with 3 fields / wells acquired every 30 minutes for 5 hours. Image analysis was performed using Incucyte's "cell-by-cell" workflow. Briefly, macrophages were segmented based on size and morphology. Total orange fluorescence in the macrophage population at each time point was used as the first output. The area under the curve for each treatment was then calculated, and plotted for further statistical analysis.

[0079] Zymosan bead phagocytosis assay.

[0080] Two to three days prior to live-cell imaging, iPSC-derived macrophages from the SFCi55 parental line and the dCas9-KRAB 1.8 and dCas9-VPR-A18 clones were cultured at a rate of 2 × 10⁻⁶. 4 / The density of the wells in the imaging 96-well plate after TC treatment ( CellCarrier-96 Ultra Microplate Macrophage maturation medium of less than 100 μL from PerkinElmer (Catalog No. 6055300) is supplemented with X-VIVO15 medium (Lonza, Catalog No. BE02-060F) containing 100 ng / ml recombinant human CSF1 (Baijin, Catalog No. 574808), 2 mM Glutamax (Ingenieur, Catalog No. 35050038), and 1% penicillin-streptomycin (Gibberco, Catalog No. 15140-122).

[0081] On the day of the measurement, pHrodo TMThe vials of Red Zymosan Bio particles (Ingenieur, catalog number P35364) were resuspended in 10 ml PBS and vortexed at high speed for 10 min. 50 μl of the bead suspension was added to each well of the iPSC-derived macrophages. The plate was immediately placed in the Incucyte S3 Live imaging system. Acquisitions were performed at 20X magnification, with 3 fields / wells acquired every 20 or 30 minutes for 5 hours. Image analysis was performed using Incucyte's cell-by-cell workflow. Briefly, macrophages were segmented based on size and morphology. Total red / orange fluorescence in the macrophage population at each time point was used as the first output. The area under the curve for each treatment was then calculated, and plotted for further statistical analysis.

[0082] Lentiviral preparation / packaging 2.3 x 10 5 HEK293T cells were seeded in 1 ml of IMDM in the wells of a 12-well plate (approximately 30% confluence). 24 hours after seeding, the medium was changed, and the cells were transfected with the desired lentiviral plasmid (transfer plasmid). The transfection reaction was prepared by mixing 100 μl of serum-free Opti-MEM® I serum-reduced medium (Gibberco, catalog 31985070), 250 ng of transfer plasmid, 750 ng of pC-Pack2 (Cellecta, catalog CPCP-K2A), and 3 μl of Transit293 (Mirus, catalog MIR 2704) and incubating at room temperature for 25 minutes. The transfection reaction was added dropwise to the wells. 24 hours after transfection, the medium was replaced. The medium containing the lentiviral particles was collected and stored at -80°C.

[0083] Preparation of Vpx-virus-like particles (VLPs) VLPs containing Vpx were generated by transfecting HEK293T cells as described in the previous section. In this case, the transfer plasmid was pSIV3+(VLP Vpx+) (Nègre et al., 2000).

[0084] Lentiviral infection iPSC iPSCs require reverse transduction. Wash 80% confluence wells of iPSCs with PBS, then incubate with 0.5 ml Stempro-Accutase (Gibco, catalog number A1110501) at 37°C to dissociate cells and obtain a single-cell suspension. Add 1 ml mTSER plus medium and collect and count the cells. Seed a total of 30,000 cells per well into a previously vitrin-coated cloning medium containing 2 ml of CloneR supplemented. TM Cells were placed in 6-well plates containing 2% mTESR Plus medium (1:10) (Stem Cell Technology Company, Catalogue No. 100-0691). Lentiviral particles were added dropwise to the desired wells. A total volume of lentiviral particles was added, and the MOI was calculated to be 10. Cells were incubated at 37°C and 5% CO2 for 2 days. 48 hours post-infection, the medium was completely replaced with cloning medium. Cells were then allowed to grow and passage as described in the maintenance section.

[0085] Human iPSC-derived macrophages iPSC-derived macrophages were sized at 2.5 x 10⁻⁶. 5 Seed at a density of 1.33 x 10⁶ cells / ml in 1 ml (12-well plate) or at a density of 1.33 x 10⁶ cells / ml. 5 Macrophages were seeded at a density of 100 cells / ml in 3 ml (6-well plate) of the following macrophage maturation medium: X-VIVO15 medium (Lonza, catalog BE02-060F) supplemented with 100 ng / ml recombinant human CSF1 (Baijin, catalog 574808), 2 mM Glutamax (Ingenieur, catalog 35050038), and 1% penicillin-streptomycin (Gibberellic Acid, catalog 15140-122). Macrophages were transduced at 24 or 48 hours post-inoculation by adding internally generated Vpx-VLP particles and lentiviral particles, with a target MOI of 3 to 5.

[0086] Plasmid synthesis / cloning The plasmid vector PL-21.0001 PB-UCOE-SIGLEC10 (SEQ ID NO: 11) was constructed by cloning the UCOE sequence (SEQ ID NO: 1), the full-length human SIGLEC10 ORF (codon-optimized), and CopGFP into the basic vector PL-20.0002 PiggyBacDualProm (SEQ ID NO: 12) (PB-CMV-restriction enzyme fragment-EF1α short / truncated-copGFP-T2A-PuroR) (purchased from Gentaur) via restriction enzyme digestion. Cloning was performed by Genewiz.

[0087] The plasmid PL-22.003 PB-UCOE-dCas9-KRAB-eGFP (SEQ ID NO: 13) was designed internally and then synthesized from scratch by Vector Builder.

[0088] The PL-22.0071 PB-UCOE-dCas9-VPR-eGFP plasmid (SEQ ID NO: 14) was constructed internally by cloning a gene block containing the dCas9-VPR sequence into the PB-UCOE-dCas9-KRAB-eGFP plasmid (SEQ ID NO: 13) via Gibson assembly. Gibson PCR products were added to a restriction-digested PiggyBac backbone (using AgeI and AvrII restriction enzymes) using the Gibson assembly protocol from New England Biolabs. Enzymatic digestion of the PCR products was then added to the restriction-digested PiggyBac backbone (using AgeI and AvrII restriction enzymes) using the T4 ligase protocol from New England Biolabs.

[0089] The mTagBFP2 sequence was cloned into the basal vector PL-21.0067 LV-UCOE via Gibson assembly. CBX3 PL-22.0050LV-UCOE is generated internally in the pU6-filled fragment-pEF1a-eGFP-T2A-Puro-WPRE (SEQ ID NO: 16). CBX3 -U6gRNA-mTagBFP2 (SEQ ID NO: 15), the base vector was internally designed but synthesized de novo by Vectorbuilder. The full plasmid sequence is provided.

[0090] Single gRNAs were cloned into PL-22.0050 LV-UCOE using an all-in-one digestion-ligation method. CBX3 -U6gRNA-mTagBFP2 (SEQ ID NO: 15). LV-UCOE CBX3 -U6gRNA-mTagBFP2 has a filler region that can be cleaved by IIS-type restriction enzymes AarI or PaqCI, leaving 5'-GTTG and GTTT-3' overhangs, which are then ligated into the sgRNA oligonucleotide. IIS-type restriction enzymes allow digestion of the vector containing the filler region while simultaneously ligating the annealed sgRNA oligonucleotide into the cleaved vector.

[0091] The sgRNA sequence was obtained from the Weissman laboratory's CRISPRi and CRISPRa annotation libraries ( https: / / (elifesciences.org / articles / 19760 / figures#SD3-data). And ordered as DNA oligonucleotides with adaptors for cloning with PaqCl restriction enzyme.

[0092] sgRNA sequence CRISPRi SEQ ID NO: 17 NTC#3i gtgtgcaacctccgccgttg (CRISPRi.v2 Weissman Library) SEQ ID NO: 18 B2M#1i ggcgagcacagctaaggcca (CRISPRi.v2 Weissman Library) SEQ ID NO: 19 B2M#3i ggccacggagcgagacatct (CRISPRi.v2 Weissman library) CRISPRa SEQ ID NO: 20 NTC#1a tgtcgtgatgcgtagacgg (CRISPRa.v2 Weissman library) SEQ ID NO: 21 SIGLEC10#1a aaggtgggccggagagtgt (CRISPRa.v2 Weissman library) SEQ ID NO: 22 CD4#1a gtgaaaatgccaaagtcaa (CRISPRa.v2 Weissman Library) SEQ ID NO: 23 PDL1#1a cggcggaagctttcagttt (CRISPRa.v2 Weissman Library) Oligonucleotide annealing and phosphorylation were performed using the following reaction setup: 6.5 µL H₂O, 0.5 µL 10x T4 DNA ligase buffer, 1 µL forward oligonucleotide (100 µM), 1 µL reverse oligonucleotide (100 µM), and 1 µL T4PNK enzyme. The tubes were placed in a PCR machine using the following program: 37°C for 30 min, 95°C for 5 min, followed by a gradual cooling to 4°C at 0.1°C / s. The annealed oligonucleotides were diluted to 200 µL with H₂O and maintained at 4°C. The digestion and ligation of plasmid and annealed sgRNA oligonucleotides were performed using the following reaction setup: 1 µL 10x CutSmart buffer, 1 µL diluted annealed oligonucleotides (+ H2O negative control), 100 ng plasmid, 1 µL 10 mM DTT, 1 µL 10 mM ATP, 0.5 µL PaqCI, 0.25 µL PaqCI activator, 0.25 µL T4 ligase, and H2O down to 10 µL. The reaction was then placed in a PCR machine and the following protocol was run: 6 cycles (37°C - 5 min, 16°C - 5 min), followed by 1 cycle at 60°C for 5 min.

[0093] The ligated plasmid was then transformed into *E. coli*, plated on LB-ampicillin plates, and incubated overnight at 30°C. The gRNA clone was confirmed by Sanger sequencing.

[0094] Statistical analysis Data are expressed as mean ± standard deviation (SD). The statistical tests used are indicated in the legend and were performed using GraphPad software version 6.0c. A p-value < 0.05 was considered statistically significant (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, ns not significant).

[0095] Example 1: Macrophages overexpressing SIGLEC10 A novel PiggyBac plasmid, PB-UCOE-SIGLEC10 (SEQ ID NO: 11), was designed and synthesized. Figure 1A), used for protein expression in mammalian cells. The main features of this plasmid are: two transposon-specific inverted terminal repeat sequences (PB 5' ITR and PB 3' ITR), a 0.7 kb CBX3 UCOE (ubiquitous chromatin open element sequence) sequence (SEQ ID NO: 1) just upstream of the CMV promoter, a multiple cloning site, the human SIGLEC10 gene (target gene), bovine growth hormone polyadenylation signal (bGH poly(A) signal), a second promoter: EF1-α (short form), a CopGFP sequence just upstream of the T2A self-cleaving peptide sequence, and a puromycin resistance gene.

[0096] To test this new plasmid, the full-length human SIGLEC10 ORF plasmid was cloned into PB-CBX3 (SEQ ID NO: 12) to obtain the PB-UCOE-SIGLEC10 plasmid (SEQ ID NO: 11). Figure 1 A), and then human iPSCs were co-transfected with PB-UCOE-SIGLEC10 and a plasmid containing the Super PiggyBac transposase sequence (SEQ ID NO: 24). Starting 48 hours post-transfection, stably transfected cells were selected in complete culture medium with 0.5 μg / ml puromycin for 1.5 weeks. During this period, the expression of SIGLEC10 and CopGFP was examined by flow cytometry. 99.65% showed detectable levels of CopGFP protein (…). Figure 2 A), while 93.9% of iPSCs from the transfection pool expressed SIGLEC10 (A). Figure 2 B). The puromycin-resistant cell pool differentiated into macrophages, and the expression of CopGFP and SIGLEC10 was again tested by flow cytometry. Figure 2 C and Figure 2 D). SIGLEC10 was detected in over 58.85% of iPSC-derived macrophages; however, CopGFP fluorescence was not detected in the cells. After iPSCs differentiated into macrophages, the CMV promoter-SIGLEC10 cassette, located just downstream of the UCOE sequence, was protected from gene silencing. However, the EF1-α promoter / copGFP cassette, further downstream of the UCOE sequence, was completely silenced.

[0097] Next, three cloned iPSC lines expressing the SIGLEC10 protein were constructed. Figure 3A). This was done firstly to generate a homogeneous population of macrophages expressing SIGLEC10 at comparable levels, and secondly to estimate whether this method of obtaining cloned cells was faster than the UCOE-based lentiviral vector method. For this purpose, human iPSCs were co-transfected as a single-cell suspension with PB-UCOE-SIGLEC10 and the Super PiggyBac transposase plasmid, and then at a low density (0.8 x 10⁻⁶ cells / year). 6 Cells were seeded at 10 ml per 10 cm culture dish. Antibiotic selection was initiated 48 hours post-transfection, followed by puromycin selection for one week. Well-separated colonies were then picked and individually seeded into wells of a 24-well plate. When confluenced, cells were transferred to 6-well plates, and SIGLEC10 and CopGFP expression were tested by flow cytometry. Three SIGLEC10 overexpression (OE) iPSC clones were selected: 1.3, 2.19, and 2.39, which had different levels of SIGLEC10 expression. Figure 3 A). These clones then differentiated into macrophages. At this level of differentiation, SIGLEC10 expression was maintained. Figure 3 B and Figure 3 C). These results confirm that the presence of a UCOE sequence precisely upstream of the CMV promoter and the target gene in a PiggyBac-based vector allows for sustained transgene expression in differentiated progeny of iPSC cells (in this case, macrophages). Furthermore, this system allows for the generation of clonal lines with varying levels of transgene expression. Figure 3 B and Figure 3 C). This is useful for investigating the function of certain genes at their expression levels.

[0098] As a next step, we examined whether genome editing methods had an impact on macrophage phenotype. SIGLEC10 macrophages from three different clonal lines expressed major lineage markers such as CD45, 25F9, CD163, and CD169 (similar to levels in the SFCi55 parental line) and expressed no or low levels of CD93, similar to macrophages derived from parental iPSC cells. Figure 4 SIGLEC10 is a type I lectin belonging to the immunoglobulin superfamily and has been found to be expressed by tumor-associated macrophages. SIGLEC10 binds to CD24 via its V-set domain, and this binding negatively regulates phagocytosis by tumor cells. 8To test the function of SIGLEC10-expressing macrophages, a cancer cell phagocytosis assay was performed. It was hypothesized that SIGLEC10 expression on iPSC-derived macrophages would be negatively correlated with the ability of macrophages to phagocytose CD24-expressing tumor cells. CD24-expressing Jurkat cells were stained with pHrodo orange. When labeled Jurkat cells were phagocytosed, the dye emitted bright orange fluorescence, allowing for quantification of phagocytosis. Images were taken every 20 minutes for 5 hours, and the area under the curve for each treatment was calculated. Macrophages from parental lines (without SIGLEC10 expression) exhibited the highest levels of phagocytosis, while macrophages with the highest SIGLEC10 expression had the lowest levels of phagocytosis. Figure 5 This indicates that the cell line is functional and confirms reported data regarding the "do not eat" signal of macrophage-tumor cell SIGLEC10-CD24.

[0099] Importantly, a pure clonal population of transgenic macrophages is generated significantly faster compared to when using viral vector methods. Lentiviral methods require 5 weeks from plasmid design to iPSC infection (this time includes plasmid amplification and purification, as well as lentivirus packaging and quality control checks for viral transduction), while the PiggyBac method of this invention requires less than a week from plasmid design to iPSC transfection (requiring only plasmid amplification and purification). Furthermore, PiggyBac transfection induces less cell death compared to lentiviral infection, resulting in a shorter time between transgene insertion and colony picking in iPSCs.

[0100] Example 2: Generation of the CRISPRi iPSC-DM system (UCOE dCas9KRAB iPSC line was knocked down in iPSC-derived macrophages) CRISPR / Cas9 technology has transformed our ability to elucidate mammalian cell biology and represents a valuable tool for exploring gene function across diverse environments. Large-scale CRISPR-Cas9-based gene screening has been conducted in cancer cell lines, rather than in more biologically relevant systems such as healthy differentiated macrophages. Constructing clonal iPSC lines expressing Cas9 can facilitate large-scale gene screening across different cell types. Recently developed screening methods have utilized Cas9 systems that avoid double-strand breaks to circumvent cytotoxic effects or other on-target effects, such as allele loss, chromosomal abnormalities, and p53 activation due to DNA damage responses. An example of such a system is CRISPR interference (CRISPRi). This system uses inactivated / non-active Cas9 (dCas9), which binds to target genomic regions with the same efficiency as Cas9 but does not produce double-strand breaks. dCas9 fuses with a repressor domain, and when used with a guide RNA, it targets the promoter region of a specific gene and drives its transcriptional repression or knockdown. To our knowledge, only one approach has been successful to date in iPSC differentiated cells (neurons and microglia). 9,10 Therefore, the dCas9-KRAB iPSC line (CRISPRi system) was constructed by targeting the following safe harbor loci: CYBL Following a lengthy genome-editing cell line construction process, cells differentiated into neurons or microglia (6 days and 8 days, respectively) through forced gene expression of transcription factors (artificial differentiation system). The biologically relevant iPSC macrophage differentiation system took an average of 4 weeks. This CYBL genome-editing method requires testing silencing within a longer differentiation protocol.

[0101] We adopted a different strategy. Using our UCOE-plasmid approach, we constructed a cloning line expressing an inactivated Cas9 gene with a KRAB domain (Krüppel-associated cassette repression domain) and a reporter gene (eGFP: enhanced green fluorescent protein). Figure 6 A). It is noteworthy that packaging dCas9-KRAB boxes into viruses is very difficult because cargo sizes exceeding the recommended 7 kb cargo size cannot achieve satisfactory viral titers. To address this issue, it has been proposed in the art to segment the dCas9 protein into different domains and integrate them into the cell. 11This approach would involve co-infection of two boxes and a more cumbersome cell selection process, and would still require pervasive chromatin-opening elements in both boxes to ensure transgene expression in differentiated cell states. We infer that the UCOE PiggyBac system of this invention would allow delivery of the dCas9-KRAB transgene along with a reporter gene (such as eGFP) into iPSC cells without separating any sequences. To attempt and avoid reporter gene silencing (as we observed in the SIGLEC10 example), we used a T2A self-cleaving peptide downstream of the dCas9-KRAB sequence, so that dCas9 KRAB and eGFP would be in the same transcript ( Figure 6 A). The main features of this plasmid are: two transposon-specific inverted terminal repeat sequences (PB 5' ITR (SEQ ID NO: 2) and PB 3' ITR (SEQ ID NO: 3)), a 0.7 kb CBX3 sequence just upstream of the CAG promoter, a multiple cloning site, dCas9-KRAB (SEQ ID NO: 9), an inactive / inactivated Cas9 (target gene) with a repressor domain and a nuclear localization signal sequence, T2A (autocleavage peptide) (SEQ ID NO: 8), and eGFP (enhanced green fluorescent protein).

[0102] Use PB-UCOE to transfer human iPSC CBX3 -dCas9KRAB-GFP ((SEQ ID NO: 13)PL-22.003 PB-UCOE CBX3 - pCAG-dCas9-KRAB-T2A-eGFP-pA (CRISPRi plasmid) ( Figure 6 A) and a plasmid containing the sequence of the Super PiggyBac transposase (SEQ ID NO: 24) were co-transfected. One week after transfection, cells were sorted based on GFP expression and seeded at clonal density. The clonal lines then differentiated into macrophages. dCas9-KRAB-GFP engineered macrophages expressed GFP ( Figure 6 Therefore, no transgene silencing occurred in the differentiated cell state (B). To test the function of the dCas9-KRAB-GFP iPSC line, sgRNA delivery was required. A lentiviral vector (LV-UCOE) was designed. CBX3 -U6gRNA-mTagBFP2 (SEQ ID NO:15) has a CBX3 UCOE upstream of the U6 promoter to drive sgRNA expression. Separate promoters were used to drive the expression of the mTagBFP2 reporter gene and the puromycin resistance gene. Figure 6C). The LV method was chosen for this specific plasmid because the cargo was suitable (3.8 kb size). Furthermore, lentiviruses with small cargoes can be used to infect cells at different stages: iPSC levels and iPSC-derived macrophage stages. iPSCs can be infected using different forms of LV-UCOE. CBX3 -U6gRNA infection: non-targeting gRNA (NTC) and (β2-microglobulin gene, B2M). eGFP from the dCas9-KRAB-eGFP lineage and from two forms of LV-UCOE. CBX3 -U6gRNA line mTagBFP2 is expressed at the macrophage level. Figure 6 D). This indicates that both dCas9-KRAB and sgRNA will also be expressed at the macrophage level. Macrophages expressing sgRNA targeting B2M showed reduced gene expression (D). Figure 7 A). This indicates that the system is functional and can achieve gene knockdown in iPSC-derived macrophages.

[0103] Generating universal human induced pluripotent stem cells and their differentiation products with anti-immune rejection properties is desirable for clinical applications. B2 microglobulin is part of the polypeptide chain of the HLA-I class antigen complex and is found on the surface of all nucleated human cells. Mutations or knockouts of B2M have been performed to generate cells with anti-immune rejection capabilities in several hosts. We hypothesize that CRISPRi dCas9 KRAB macrophages containing B2M gRNA will also have low levels of HLA-I class molecules. dCas9KRAB macrophages do indeed have low levels (isotype-comparative fluorescence) of HLA-ABC, HLA-G, HLA-E, and HLA-F (…). Figure 7 B). Using this method, we were able to generate MHC-I-free / low iPSC-derived macrophages.

[0104] The expression of cell surface markers in dCAS9 KRAB iPSC-derived macrophages was examined. The macrophages expressed pan-macrophage markers at levels comparable to wild-type WT macrophages. Figure 8 A) showed that the insertion of the dCas9-KRAB-eGFP transgene had no significant effect on macrophage phenotype. Furthermore, macrophages from the dCas9 KRAB line were able to phagocytose Zymosan™ beads (the phagocytic level was the same as that of SFCi55 WT macrophages). Figure 7B). Engineered macrophages from the dCas9 KRAB line also responded to stimulation. Following IL-10 stimulation, they were able to phagocytose more Zymosan beads, while stimulation with LPS + IFNγ downregulated their phagocytic capacity. Similarly, this was comparable to the response shown by SFCi55 WT macrophages. Figure 8 B).

[0105] This dCas9 KRAB lineage and sgRNA delivery at the iPSC stage significantly reduces the time required to generate genetically engineered macrophages. All that's needed is to design the gRNAs, clone them, and package them. After packaging, iPSCs can be infected and differentiate into iPSC-derived macrophages within 4 weeks.

[0106] Example 3: dCas9KRAB iPSC line, infected with gRNA at the macrophage stage (genome-engineered macrophages can be obtained within 2 weeks).

[0107] Compared with SFCi55-WT macrophages and dCas9KRAB macrophages transduced with lentiviruses containing NTC gRNA, dCas9KRAB macrophages transduced with lentiviruses containing B2M gRNA and virus-like particles containing VPX (Vpx-VLP) downregulated B2M. Figure 9 Cultured dCas9-KRAB iPSC macrophages now allow for genetic modification of these cells over a two-week span. This lineage and this macrophage stage infection system enable larger-scale screening by co-infecting macrophages with multiple gRNAs targeting different genes and evaluating macrophage phenotypes.

[0108] Example 4: Generation of the CRISPRa iPSC-DM system (UCOE dCas9VPR iPSC line activates / upregulates genes in iPSC-derived macrophages) The CRISPRa system (dCas9-VPR lineage) upregulates genes not normally expressed in iPSC-derived macrophages and / or further increases the expression of genes already expressed in the system. This tool can improve current in vitro models by activating genes to alter the phenotype of cultured macrophages, such as directing them to more tumor-associated macrophage behavior. Because gene activation is faster than gene downregulation, this system allows for the production of genetically modified macrophages within one week. The CRISPRa system uses inactivated / non-active Cas9 (dCas9), which binds to target genomic regions with the same efficiency as Cas9 but does not produce double-strand breaks. dCas9 fuses with the activation domain, and when used with a guide RNA, it targets the region preceding the promoter of a specific gene and drives its transcriptional activation.

[0109] Using PL-22.0071 PB-UCOE CBX3 -pCAG-dCas9-VPR-T2A-GFP-Pa SEQ ID NO: 14 (CRISPRa plasmid) We constructed the following clone lines containing dCas9-VPR boxes ( Figure 10 A): dCas9 VPR A18 lineage. The gene cargo contains approximately 10.4 kb, which is very large. Producing lentiviruses with good titers using this cargo will be very challenging. dCas9 VPR macrophages transduced with lentiviruses containing CD4 gRNA or SIGLEC10 gRNA and virus-like particles (Vpx-VLP) upregulated their respective genes compared to dCas9 VPR macrophages transduced with lentiviruses containing NTC gRNA. Figure 10 B, Figure 10 C).

[0110] The expression of cell surface markers in dCas9 VPR iPSC-derived macrophages was examined, and pan-macrophage markers were expressed in dCas9VPR differentiated cells. Figure 10 D). Furthermore, macrophages from the dCas9VPR lineage were able to phagocytose Zymosan™ beads (the phagocytic level was the same as that of SFCi55 WT macrophages). Figure 10 E). Engineered macrophages from the dCas9 VPR line also responded to stimulation. Following IL-10 stimulation, they were able to phagocytose more Zymosan beads, while stimulation with LPS + IFNγ downregulated their phagocytic capacity. Similarly, this was comparable to the response shown by SFCi55 WT macrophages. Figure 10 E).

[0111] Notably, upregulating genes in macrophages via this dCas9-VPR system offers several advantages over traditional gene overexpression systems: 1) gene activation within as little as one week; 2) larger-scale screening by co-infecting macrophages with multiple gRNAs targeting different genes and activating multiple genes simultaneously; and 3) activation of endogenous gene transcription and translation. Compared to overexpressing genes via exogenous promoter and codon optimization, this gene activation system is less artificial.

[0112] References 1. Luo, Y. et al.Stable Enhanced Green Fluorescent Protein ExpressionAfter Differentiation and Transplantation of Reporter Human InducedPluripotent. Stem Cells Trans Med 3, 821–835 (2014). 2.Lopez-Yrigoyen, M., Fidanza, A., Cassetta, L., Axton, R. A.,Taylor, A. H., Meseguer-Ripolles, J., Tsakiridis, A., Wilson, V., Hay, D. C.,Pollard, J. W.,&Forrester, L. M. (2018). A human iPSC line capable ofdifferentiating into functional macrophages expressing ZsGreen: a tool forthe study and in vivo tracking of therapeutic cells. Philosophical Transactions of the Royal Society B: Biological Sciences , 373 (1750). https: / / doi.org / 10.1098 / RSTB.2017.0219 3.Lopez-Yrigoyen, M., Yang, C. T., Fidanza, A., Cassetta, L., Taylor,A. H., McCahill, A., Sellink, E., von Lindern, M., van den Akker, E.,Mountford, J. C., Pollard, J. W.,&Forrester, L. M. (2019). Geneticprogramming of macrophages generates an in vitro model for the humanerythroid island niche. Nature Communications 2019 10:1 , 10 (1), 1–11. https: / / doi.org / 10.1038 / s41467-019-08705-0 4.Ackermann, M. et al. Ex vivo Generation of Genetically ModifiedMacrophages from Human Induced Pluripotent Stem Cells. Transfusion Medicine and Hemotherapy 44, 135–142 (2017). 5.Müller-Kuller, U. et al. A minimal ubiquitous chromatin openingelement (UCOE) effectively prevents silencing of juxtaposed heterologouspromoters by epigenetic remodeling in multipotent and pluripotent stemcells. Nucleic Acids Research 43, 1577–1592 (2015). 6.Yant, S. R. et al. High-Resolution Genome-Wide Mapping of TransposonIntegration in Mammals. Molecular and Cellular Biology 25, 2085–2094 (2005). 7.Lopez-Yrigoyen, M., May, A., Ventura, T., Taylor, H., Fidanza, A.,Cassetta, L., Pollard, J. W.,&Forrester, L. M. (2020). Production andcharacterization of human macrophages from pluripotent stem cells. Journal of Visualized Experiments , 2020 (158). https: / / doi.org / 10.3791 / 61038 8.Barkal, A. et al. CD24 signalling through macrophage Siglec-10 is atarget for cancer immunotherapy. Nature572, 392–396 (2019) 9.Tian R. et al . CRISPR Interference-Based Platform for MultimodalGenetic Screens in Human iPSC-Derived Neurons. Neuron ,104(2):239-255 (2019) 10.Drager, Nina et al . A CRISPRi / a platform in iPSC-derived microgliauncovers regulators of disease states Biorxiv, preprint (2022) 11.Huang, Xinbo et a l. A Light-Inducible Split-dCas9 System forInhibiting the Progression of Bladder Cancer Cells by Activating p53 and E-cadherin. Front. Mol. Biosci 7:(2021) 12.Skipper KA, Hollensen AK, Antoniou MN, Mikkelsen JG. Sustainedtransgene expression from sleeping beauty DNA transposons containing a corefragment of the HNRPA2B1-CBX3 ubiquitous chromatin opening element (UCOE).BMC Biotechnol. (2019). 13. Nègre, D., Mangeot, P. E., Duisit, G., Blanchard, S., Vidalain, P.O., Leissner, P., Winter, A. J., Rabourdin-Combe, C., Mehtali, M., Moullier, P., Darlix, J. L., & Cosset, F. L. (2000). Characterization of novel safe lentiviral vectors derived from simian immunodeficiency virus (SIVmac251) that efficiently transduce mature human dendritic cells. Gene Therapy 2000 7: 19 , 7 (19), 1613–1623. https: / / doi.org / 10.1038 / sj.gt.3301292 14. Yang, C. T., Ma, R., Axton, R. A., Jackson, M., Taylor, A. H., Fidanza, A., Marenah, L., Frayne, J., Mountford, J. C., & Forrester, L. M. (2017). Activation of KLF1 Enhances the Differentiation and Maturation of Red Blood Cells from Human Pluripotent Stem Cells. Stem Cells (Dayton, Ohio) , 35 (4), 886–897. https: / / doi.org / 10.1002 / STEM.2562 Sequence Listing Information SEQ ID NO: 1 UCOE ctcgagcccgggaggtggtccctgcagttacgccaatgataacccccgccagaaaaatcttagtagccttccctttttgttttccgtgccccaactcggcggattgactcggccccttccggaaacacccgaatcaacttctagtcaaattattgttcacgccgcaatgacccacccctggcccgcgtctgtggaactgacccctggtgtacaggagagttcgctgctgaaagtggtcccaaaggggtactagtttttaagctcccaactccccctcccccagcgtctggaggattccacaccctcgcaccgcaggggcgaggaagtgggcggagtccggttttggcgccagccgctgaggctgccaagcagaaaagccaccgctgaggagactccggtcactgtcctcgccccgcctcccccttccctccccttggggaccaccgggcgccacgccgcgaacgttaagtgccgcggtcgtcggcgcctccgccctcccccttgggccccaattcccagcgggcgcggcgcgcggcccctccccccgccgggcgcgcgcccgctgccccgcccttcgtggccgcccggcgtgggcggtgccacccctccccccggcggccccgcgcgcagctcccggctccctcccccttcggatgtggcttgagctgtaggcgcggagggccggctagc SEQ ID NO: 2 PB 5' ITR ttaaccctagaaagatagtctgcgtaaaattgacgcatgcattcttgaaatattgctctctctttctaaatagcgcgaatccgtcgctgtgcatttaggacatctcagtcgccgcttggagctcccgtgaggcgtgcttgtcaatgcggtaagtgtcactgattttgaactataacgaccgcgtgagtcaaaatgacgcatgattatcttttacgtgacttttaagatttaactcatacgataattatattgttatttcatgttctacttacgtgataacttattatatatatattttcttgttatagatatc SEQ ID NO: 3 PB 3' ITR tttgttactttatagaagaaattttgagtttttgtttttttttaataaataaataaacataaataaattgtttgttgaatttattattagtatgtaagtgtaaatataataaaacttaatatctattcaaattaataaataaacctcgatatacagaccgataaaacacatgcgtcaattttacgcatgattatctttaacgtacgtcacaatatgattatctttctagggttaa SEQ ID NO: 4 Human SIGLEC10 SEQ ID NO: 5 Bovine growth hormone polyadenylation signal (bGH poly(A) signal) ctgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatgg SEQ ID NO: 6 EF1-α (short form) gggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaacgggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacag SEQ ID NO: 7 Fluorescent protein CopGFP sequence atgcctgccatgaagattgagtgccgcatcacgggaaccctgaacggagtggagtttgagctggtcggaggtggagaagggactcctgagcagggacgtatgaccaacaagatgaagtctaccaagggcgccttgaccttctccccctaccttctctctcatgtcatgggatacgggttctaccactttggtacctatcccagtgggtatgagaatcccttcctgcatgccatcaacaacggggggtacaccaacaccaggattgagaagtatgaggatggaggagttcttcatgttagctttagctacagatatgaagcaggcagggtgattggggatttcaaggttgtcgggacaggattccctgaggacagtgtgatcttcaccgacaagatcatccggtccaatgctaccgtggagcacttgcacccaatgggagacaacgttcttgtgggctccttcgcgagaaccttttccctgagggatggaggctactactcatttgtggttgacagccacatgcacttcaagagtgccatccacccatccatcctccagaacggggggcccatgtttgccttcaggagagttgaggaacttcactccaacactgaacttggcattgtagagtatcaacatgccttcaagactcccatagcatttgcttaa SEQ ID NO: 8 T2A self-cleaving peptide sequence ggaagcggagagggcaggggaagtcttctaacatgcggggacgtggaggaaaatcccggcccc SEQ ID NO: 9 dCas9-KRAB (inactive / dead Cas9 with inhibitory domain and nuclear localization signal sequence) SEQ ID NO: 10 dCas9-VPR sequence plasmid sequence SEQ ID NO: 11PL-21.0001PB-UCOE CBX3 -DUO-CMV-SIGLEC10-EF1 short-copGFP-PURO The base vector is PiggyBacDualProm (SEQ ID NO: 12). The human SIGLEC10 codon-optimized sequence is inserted immediately after the CMV promoter, and the UCOE sequence is inserted immediately upstream of the CMV promoter.

[0113] atgctgctgcctctgctgctgagctctctgctcggaggatcccaagccatggacggaagattct ggatcagagtgcaagagagcgtgatggtgcccgagggactgtgtatttccgtcccttgctccttctcctaccctag acaagactggaccggcagcacccccgcctacggatactggttcaaagccgtcaccgagaccaccaaaggcgctccc gtcgccaccaatcaccagtctagggaagtggaaatgtccacaaggggcagattccaactgaccggagatcccgcca aaggcaactgctctctggtgattagagacgcccagatgcaagacgagtcccagtacttctttagagtcgagagagg cagctatgtgaggtacaacttcatgaacgacggcttctttctgaaggtgacagctctcacccagaagcccgacgtc tacatccccgagacactggaacccggccagcccgtgaccgtgatctgcgtctttaactgggccttcgaagagtgtc ctccccctagctttagctggaccggcgctgctctgagcagccaaggcaccaaacccacaacctcccatttcagcgt gctctcctttacccctagacctcaagaccacaacaccgatctgacatgccacgtggacttcagcagaaagggcgtc tccgctcagaggaccgtgaggctcagagtggcttatgcccctagggatctggtcattagcatctctagggacaaca cacccgctctcgagcctcagcctcaaggcaacgtgccctatctggaggcccagaaaggacagtttctgagactgct gtgcgctgctgattcccagcctcccgctacactgagctgggtgctccagaatagagtgctgagcagctcccaccct tggggacctagacctctgggactggagctgcccggcgtcaaggccggcgattccggaagatatacatgcagagctg agaacagactcggcagccagcagagggctctcgatctgagcgtgcagtacccccccgagaatctgagggtcatggt ctcccaagccaatagaaccgtgctggaaaatctcggcaacggcacatctctgcccgtgctggagggccagtctctg tgtctggtgtgcgtgacccactcctccccccccgccagactcagctggacccagagaggacaagtgctgagccctt cccagcctagcgaccccggcgtgctggagctgcccagagtgcaagtggagcacgaaggagagtttacatgccatgc taggcatcctctgggctcccaacatgtctctctgtctctgagcgtccattatagccccaagctgctcggacctagc tgcagctgggaagctgagggactgcactgcagctgcagcagccaagccagccccgccccctctctgagatggtggc tgggagaggagctgctggaaggcaactccagccaagacagctttgaggtgacaccttccagcgctggcccttgggc caatagctccctctctctgcatggcggactgtccagcggactgagactgagatgcgaggcttggaacgtccacggc gctcagtccggctccatcctccagctgcccgataagaagggactgatcagcaccgcctttagcaacggcgcctttc tgggaattggaatcaccgctctgctgtttctgtgtctcgctctgatcatcatgaagattctgcccaagagaaggac acagaccgagacacctagacctagattcagcagacatagcaccattctggactacatcaacgtggtgcctacagcc ggccctctggctcagaagagaaaccagaaggctacccccaattcccctaggacacccctccctcccggcgctcctt cccccgagtccaagaagaatcagaagaagcagtatcagctgcccagctttcccgagcccaagagctccacacaagc ccccgaatcccaagagagccaagaggagctccactacgctacactgaattttcccggcgtgagacctaggcccgag gctagaatgcccaaaggcacccaagccgactacgccgaggtgaaattccagtga SEQ ID NO: 12PL-20.0002 PiggyBacDualProm: Base vector PB-CMV-restriction enzyme fragment-EF1α short / truncated-copGFP-T2A-PuroR 。

[0114] Purchased from Kintore (not used as is in the construction line, but used to first construct the Macomics overexpression plasmid).

[0115] SEQ ID NO: 13PL-22.003 PB-UCOE CBX3 -pCAG-dCas9-KRAB-T2A-eGFP-pA (CRISPRi plasmid) The PiggyBac expression vector contains UCOE CBX3 To protect dCas9-KRAB expression in iPSC-derived macrophages with an eGFP reporter gene fused via a T2A-cleavable peptide linker. Designed by McCormick and synthesized by Vector Builder. SEQ ID NO: 14PL-22.0071PB-UCOE CBX3 -pCAG-dCas9-VPR-T2A-GFP-Pa (CRISPRa plasmid) Manufactured by McCormick. This is a derivative of PL-22.003 (SEQ ID NO: 13). The dCAS9 KRAB sequence has been replaced with the dCas9 VPR sequence to achieve CRISPRa. eGFP is retained as a selection marker.

[0116] SEQ ID NO: 15PL-22.0050LV-UCOE CBX3 -pU6-fill fragment-pEF1a-mTagBFP2-T2A-Puro-dWPRE Manufactured by McCormick. A derivative of PL-22.008 with an exchanged WPRE to introduce a point mutation that inactivates any potential expression of oncogene X.

[0117] SEQ ID NO: 16PL-21.0067 LV-UCOE CBX3 -pU6-Spacer-pEF1a-eGFP-T2A-Puro- WPRE Designed by McCormick and synthesized by Vector Builder. A lentiviral expression vector containing UCOE. CBX3 Human U6 promoter driving sgRNA expression and eGFP-T2A-Puro R The EF1a promoter is expressed. The sgRNA is cloned into this base vector by restriction digestion (to remove filler fragments) and ligation of the sgRNA DNA sequence.

[0118] sgRNA sequence CRISPRi SEQ ID NO: 17NTC#3i gtgtgcaacctccgccgttg (CRISPRi.v2 Weissman library) SEQ ID NO: 18B2M#1i ggcgagcacagctaaggcca (CRISPRi.v2 Weissman Library) SEQ ID NO: 19B2M#3i ggccacggagcgagacatct (CRISPRi.v2 Weissman Library) CRISPRa SEQ ID NO: 20NTC#1a tgtcgtgatgcgtagacgg (CRISPRa.v2 Weissman library) ​ aaggtgggccggagagtgt (CRISPRa.v2 Weissman library) ​ gtgaaaatgccaaagtcaa (CRISPRa.v2 Weissman library) ​ PDL1#1a cggcggaagctttcagttt(CRISPRa.v2 Weissman Library) SEQ ID NO: 24PL-20.004 Super PiggyBac transposase Purchased from Kintoir. Co-transfected to mediate genome integration of the PiggyBac expression vector. SEQ ID NO: 25PL-20.0005 pcDNA3.1+C-(K)-DYK hCD24 NM_013230.3 Used for building ​ plasmid

Claims

1. A transposon comprising a ubiquitous chromatin opening element (UCOE) nucleic acid sequence, a nucleic acid sequence of a gene of interest or fragment thereof under the control of a promoter and optionally a 3' polyadenylation sequence, flanked by Piggybac™ transposon specific inverted terminal repeat sequences PB 5' ITR and PB 3' ITR.

2. The transposon of claim 1, wherein the UCOE is a CBX3-UCOE nucleic acid sequence prior to CBX3.

3. The transposon of claim 1 or claim 2, wherein the UCOE is the nucleic acid sequence of SEQ ID NO:

1.

4. The transposon of claim 1, wherein the Piggybac™ transposon specific inverted terminal repeat sequences are PB 5' ITR (SEQ ID NO: 2) and PB 3' ITR (SEQ ID NO: 3).

5. The transposon of any preceding claim, wherein the promoter, the gene of interest or fragment thereof and optionally 3' polyadenylation sequence are comprised within an expression cassette.

6. The transposon of any preceding claim, wherein expression cassette comprises: (a) a promoter, (b) at least one cloning site (restriction enzyme cleavage site) or a multiple cloning site downstream of the promoter, (c) a gene of interest downstream of the promoter and operably linked to the promoter, (d) a polyadenylation sequence downstream of the gene of interest and operably linked to the gene of interest, (e) optionally an internal ribosome entry site, (f) optionally a second promoter sequence downstream of the gene of interest and the polyadenylation sequence, (g) optionally a fluorescent protein sequence downstream of the second promoter, (h) a self-cleaving peptide sequence, (i) optionally a gene for selection, e.g. for antibiotic selection, (j) optionally a fluorescent protein gene, and (k) optionally a second polyadenylation sequence.

7. The transposon of claim 6, wherein the expression cassette comprises: (a) a CMV promoter, (b) a multiple cloning site downstream of the promoter, (c) a gene of interest downstream of the promoter and operably linked to the promoter, optionally wherein the gene of interest is a human SIGLEC10 gene of SEQ ID NO: 4, (d) a bovine growth hormone polyadenylation signal (bGH poly(A) signal) (SEQ ID NO: 5) downstream of the gene of interest and operably linked to the gene of interest, (e) optionally an internal ribosome entry site, (f) an EF1-alpha (short form) (SEQ ID NO: 6) sequence downstream of the gene of interest and the polyadenylation sequence, and (g) a fluorescent protein (CopGFP (SEQ ID NO: 7)) sequence downstream of the second promoter, (h) a T2A self-cleaving peptide sequence (SEQ ID NO: 8) downstream of the fluorescent protein sequence, (i) a puromycin resistance gene, and (j) a second polyadenylation sequence. (j) SV40 poly(A): simian virus 40 polyadenylation sequence.

8. The transposon of claim 6, wherein the expression cassette comprises: (a) a CAG promoter, (b) a multiple cloning site downstream of the promoter, (c) a gene of interest downstream of and operably linked to the promoter, optionally wherein the gene of interest is a dCas9-KRAB sequence of SEQ ID NO: 9 (an inactive / inert Cas9 with an inhibitory domain and a nuclear localization signal sequence), (d) a T2A self-cleaving peptide sequence (SEQ ID NO: 8) downstream of the gene of interest, e.g., the dCas9-KRAB sequence of SEQ ID NO: 9, and (e) a fluorescent protein gene sequence encoding eGFP (enhanced green fluorescent protein) downstream of the T2A self-cleaving peptide sequence (SEQ ID NO: 8), (f) a rBG polyadenylation sequence.

9. The transposon of claim 6, wherein the expression cassette comprises: (a) a CAG promoter, (b) a multiple cloning site downstream of the promoter, (c) a gene of interest downstream of and operably linked to the promoter, optionally wherein the gene of interest is a dCas9-VPR sequence of SEQ ID NO: 10, (d) a T2A self-cleaving peptide sequence downstream of the gene of interest, e.g., the dCas9-VPR sequence of SEQ ID NO: 10, and (e) a fluorescent protein gene sequence encoding eGFP (enhanced green fluorescent protein) downstream of the T2A self-cleaving peptide sequence (SEQ ID NO: 8), (f) a rBG polyadenylation sequence.

10. A vector comprising the transposon of any preceding claim, preferably wherein the vector is a PiggyBac® vector, such as the plasmid vector of SEQ ID NO: 11, SEQ ID NO: 13, or SEQ ID NO:

14.

11. A cell comprising the transposon and / or vector of any one of claims 1 to 10, optionally comprising a second vector capable of expressing a transposase, preferably wherein the transposase is a PiggyBac™ transposase (e.g., the Super PiggyBac™ transposase plasmid vector of SEQ ID NO: 24).

12. A cell comprising the transposon of any one of claims 1 to 11, wherein the transposon (expression construct / transgene) is integrated into the genome of the cell.

13. The cell of claim 11 or claim 12, wherein the cell is selected from the group consisting of an undifferentiated cell, a partially differentiated cell, and a fully differentiated cell, optionally wherein the state of differentiation is assessed by using a panel of flow cytometry markers.

14. The cell of any one of claims 11 to 13, wherein the cell is selected from the group consisting of induced pluripotent stem cells (iPSCs), partially or fully differentiated iPSC-derived macrophages, iPS-derived neutrophils, NK, monocytes, myocytes, hepatocytes, neurons, and progenitor cells.

15. A method for: (a) preventing silencing of a gene of interest (transgene), (b) promoting expression of a gene of interest, (c) expressing a product of a gene of interest, and / or (d) expressing a large (> 7.0 Kb) expression cassette, the method comprising culturing a cell of any one of claims 11 to 14.

16. A method for: (a) preventing silencing of a gene of interest (transgene), and / or (b) maintaining expression of a gene of interest during differentiation, the method comprising culturing a cell of any one of claims 11 to 14 in the presence of a differentiation stimulus.

17. A method for knockdown (downregulation) of target gene expression, the method comprising culturing a cell of any one of claims 11 to 14 comprising dCas9-KRAB in the presence of a target gene-directed gRNA (e.g., delivered via a lentiviral vector).

18. A method for inducing or upregulating target gene expression, the method comprising culturing a cell of any one of claims 11 to 14 comprising dCas9-VPR in the presence of a target gene-directed gRNA (e.g., delivered via a lentiviral vector).

19. A composition comprising a transposon, vector, and / or cell of any one of claims 1 to 14 and a carrier.

20. A composition comprising a transposon, vector, and / or cell of any one of claims 1 to 14 and a vector capable of expressing a transposase.

21. A gene transfer system comprising a transposon, vector, and / or cell of any one of claims 1 to 14 and a transposase.

22. The gene transfer system of claim 21, wherein the transposase is a Piggybac™ transposase.

23. A method for modulating expression of a gene of interest in a cell, the method comprising (a) introducing a vector of claim 10 into a cell, (b) introducing a vector encoding a transposase, preferably a Piggybac™ transposase, into the cell, and (c) introducing a vector containing a guide RNA capable of controlling expression of the target gene into the cell.

24. A method for integrating a gene of interest into the genome of a cell, the method comprising contacting a cell with a gene transfer system of claim 21, thereby integrating the gene of interest into the cell.

25. A method for knockdown (downregulation) of a target gene in a cell, the method comprising contacting a cell with a gene transfer system of claim 21, thereby introducing and integrating dCas9-KRAB, and introducing a gRNA (preferably delivered via a lentiviral vector) into the cell to knockdown expression of the target gene.

26. A method for upregulating a target gene in a cell, the method comprising contacting the cell with the gene transfer system of claim 21 to introduce and integrate dCas9-VPR, and introducing gRNA (preferably via a lentiviral vector) into the cell to upregulate expression of the target gene.

Images