Retroviral vectors

Abstract

The present invention relates to a novel retroviral vector comprising a 5'long terminal repeat (LTR), a primer binding site, a heterologous intron, a transgene insertion site and a 3 'LTR wherein the heterologous intron is located immediately downstream of the 5' LTR. This vector has high titer productivity and is particularly suitable for gene therapy.

Description

Technical Field

[0001] This invention relates to improved lentiviral gene therapy vectors that minimize the production of multiple subgenomic RNAs during vector production in target cells, increase vector titers, and have an improved safety profile. These vectors have specific applications as gene therapy vectors targeting the liver. Background Technology

[0002] Retroviridae is a family of single-stranded RNA viruses. These viruses are an attractive option for gene therapy vectors due to their strong cloning ability and the ability to stably integrate virally encoded genomic information into the host DNA. Lentivirals are a genus of retroviruses derived from human immunodeficiency virus type 1 (HIV-1). Like other retroviruses, lentiviruses reverse transcribe their RNA genome into DNA, which is permanently integrated into the host genome. This gives them an advantage as viral vectors because the target gene delivered by the virus is continuously expressed in the host cell, whereas adeno-associated virus vectors are rapidly depleted from dividing cells and therefore require frequent administration. Lentiviral vectors also have a wider range of therapeutic uses compared to other vectors derived from retroviruses because they can transduce both dividing and non-dividing cells.

[0003] Despite these advantages, permanent integration of the lentiviral genome carries the risk of insertional mutagenesis. The persistent presence of cis-elements within the transgene expression cassette, particularly RNA packaging sequences such as RNA packaging signals (ψ) and Rev response elements (RREs), can lead to interactions between the host and viral genomes. Splicing sites within cis-elements have been shown to splice with nearby host genes, resulting in aberrant fusion transcripts. These cis-element sequences are also rich in CpG islands, which undergo DNA methylation in host cells, leading to transgene silencing and enabling the lentiviral genome to remobilize in cells expressing lentiviral proteins. This poses a problem for HIV-positive patients. Therefore, it is necessary to minimize the persistence of these cis-elements to improve the safety of lentiviral vectors in clinical translation.

[0004] Previous attempts to minimize insertional mutagenesis induced by lentiviral vectors have included truncating the ψ and RRE sequences, or removing these RNA packaging sequences from the lentiviral vector provirus via Cre-loxP-mediated deletion. However, these vectors are limited by low vector production efficiency and low titers.

[0005] WO2015 / 056014 discloses a retroviral vector comprising a primer binding site, a long terminal repeat (LTC) sequence, and an RNA packaging sequence, wherein the RNA packaging sequence is located at the 3' end of the LTC sequence, and no LTC sequence is located at the 3' end of the RNA packaging sequence, such that reverse transcription initiated at the primer binding site does not result in the reverse transcription of the RNA packaging sequence into the vector DNA in the target cell. It has previously been demonstrated that eliminating the HIV-1 packaging sequence from lentiviral vector proviruses improves safety and accelerates gene transfer for gene therapy (4). However, vector titers are low in both cases due to the low efficiency of vector genomic RNA production and the production of multiple subgenomic RNAs during vector production.

[0006] The object of this invention is to address one or more problems associated with prior art retroviral vectors used in gene therapy. In particular, an object of this invention is to provide a retroviral vector that reduces the production of subgenomic RNA and / or increases vector titer during vector production. Another object of this invention is to provide a lentiviral vector having an increased vector titer while maintaining a low frequency of aberrant fusion transcripts in cells exposed to the vector during gene therapy. Summary of the Invention

[0007] According to a first aspect of the invention, a retroviral vector is provided comprising a 5' long terminal repeat (LTR), a primer binding site (PBS), a heterointron, a transgene insertion site, and a 3' LTR, wherein the heterointron is located immediately downstream of the 5' LTR.

[0008] The primer binding site (PBS) is preferably located between the 5' LTR and the intron. The PBS is the binding site for the tRNA primer, which is responsible for initiating negative strand synthesis during reverse transcription.

[0009] In some implementations, the retroviral vector contains primers with a primer overextension sequence (POS). The POS is a conserved motif, adjacent to and downstream of the primer binding site. It contains the sequence [C / T]TGAAA and provides a complementary region to the overextension products, enabling them to participate in positive-strand transfer reactions. The primer overextension sequence is adjacent to and immediately upstream of the intron.

[0010] Retroviral LTRs are typically segmented into U3, R, and U5 regions. However, in some LTRs, portions of these regions may be missing. The term "long terminal repeat" or "LTR" is intended to encompass all these variations. LTRs participate in the reverse transcription process, thereby generating vector DNA in target cells based on vector RNA. LTRs can contain many signals required for gene expression, such as transcription enhancers, promoters, transcription initiation signals, and / or polyadenylation signals.

[0011] The 5'LTR may contain an HIV-1 LTR or a derived sequence thereof. The 5'LTR has the sequence of SEQ ID No. 2 or a derived sequence having at least about 40% identity with it.

[0012] In some embodiments, if the 5'LTR sequence is a derived sequence, the derived sequence may have at least about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity with SEQ ID No. 2.

[0013] For all aspects, sequence identity is determined by comparing two aligned, substantially complementary sequences in length, and overall identity is expressed as a percentage. Measurement of nucleotide sequence identity is well-known in the art and is performed using specialized computer programs such as BLAST.

[0014] The 3'LTR preferably comprises an HIV-1 LTR or a derivative thereof. In one embodiment, the 3'LTR sequence has the sequence of SEQ ID No. 8 or a derivative sequence having at least 40% identity with it. The 3'LTR comprises a polyadenylation (polyA) site in the R domain and an HIV-1 transacting responsive (TAR) hairpin site. In some embodiments, the 3'LTR may have a mutation at the polyA site, thereby eliminating its activity (ΔpA) and / or a mutation at the TAR hairpin site (ΔTAR).

[0015] In some embodiments, if the 3'LTR sequence is a derived sequence, the derived sequence may have at least about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity with SEQ ID No. 8.

[0016] In one implementation, the 3'LTR may contain a self-inactivating (SIN)LTR. For improved safety, the 3'LTR in the vector is preferably a self-inactivating LTR in which the nucleotides in the U3 region have been deleted. This enables the inclusion of a TATA box and a transcription factor binding site. Upon reverse transcription in target cells, the deletion is transferred to the 5'LTR, resulting in transcriptional inactivation of the LTR in the provirus. SINLTRs are well known to those skilled in the art (see, for example, Retroviruses. Edited by Coffin JM, Hughes SH, and Varmus HE. Cold Spring Harbor (NY): Cold Spring Harbor Laboratory Press; 1997).

[0017] Surprisingly and advantageously, the inventors discovered that inserting a heterologous intron immediately downstream of the 5' LTR improves the efficacy and safety profile of these vectors compared to conventional third-generation lentiviral vectors. The inventors unexpectedly found that lower doses of the vectors of this invention achieve the same efficacy as previous-generation CCL vectors. Not wanting to be bound by theory, the inventors believe that lower doses will improve safety because the vectors are less likely to induce a strong immune response and result in fewer integration events, thereby minimizing potential damage to the host genome.

[0018] In some embodiments, the intron may comprise an intron of the elongation factor 1α gene. In other embodiments, the intron may comprise an intron and / or a truncated version of the β-globin gene. In alternative embodiments, the intron may comprise an intron of the chicken β-actin (CBA) gene. Preferably, the intron comprises a sequence ranging from about 100 to about 2,000 base pairs. More preferably, the intron comprises a sequence ranging from about 200 to about 1,000 base pairs.

[0019] The vector may also contain an HIV-1 psi packaging sequence and / or Rev reaction element (RRE) located downstream of the 3'LTR.

[0020] Vectors may contain other elements that facilitate vector transduction and expression. These elements are typically located between the PBS and the 3'LTR. For example, vectors may also contain post-transcriptional regulatory elements (PREs), such as marmot hepatitis virus post-transcriptional regulatory elements (WPREs).

[0021] The vector may also contain a central polypurine tract (cPPT). This is the region that serves as a primer during retroviral replication to synthesize the positive strand. Preferably, it is located downstream of an intron. More preferably, it is located between the intron and the transgene promoter, wherein the promoter is downstream of the cPPT. The vector may also contain a central termination site (CTS).

[0022] The vector preferably contains a promoter to drive transcription of the vector genome. This can be any suitable promoter, including the Rous sarcoma virus (RSV) promoter, the human cytomegalovirus (CMV) immediate early promoter, the spleen focal formation virus (SFFV) promoter, or the HIV-1 U3 promoter. The promoter is preferably located at the 5' end of the vector.

[0023] Preferably, the primer binding site of the vector is precisely located at the transcription start site of the promoter, thereby driving the transcription of the vector genome.

[0024] These components preferably include:

[0025]

[0026] Retroviral vectors can also contain expressible transgenes or multiple transgenes at the transgene insertion site.

[0027] In some embodiments, the transgene is a non-retroviral gene and can be any gene desired in the target cell. The transgene should be located between the PBS and the 3' LTR. The transgene may encode a peptide or protein into non-coding RNA. In some embodiments, the transgene encodes a peptide or protein. Preferably, the peptide or protein should be available for gene therapy. In some embodiments, the transgene is controlled by a promoter (e.g., the PGK, LP1, or GADPH promoter). It will be apparent to those skilled in the art that a variety of different promoters can be employed.

[0028] The expression of a transgene may contribute to normal cell growth or maintain the health of the subject. In some embodiments, the transgene encodes a peptide or protein that is absent or poorly expressed in the subject. Alternatively, the transgene may encode a peptide or protein that helps prevent or improve a medical condition. The peptide or protein may be one used to treat diseases such as cancer, atherosclerosis, sickle cell anemia, infection, metabolic disorders, neurological disorders, and thalassemia. Examples of such peptides and proteins include hemoglobin, hematopoietic growth factors such as granulocyte-macrophage colony-stimulating factor (GM-CSF), macrophage colony-stimulating factor (M-CSF), granulocyte colony-stimulating factor (G-CSF), erythropoietin (EPO), common γ-chain, Wiskott Aldrich Syndrome Protein (WASp), GP91phox, and ABCD1. Another example is tumor necrosis factor (TNF), a molecule that can be used to treat cancer, particularly tumors. Tumor suppressor p53 and retinoblastoma (RB) are also considered. Various cytokines, such as mast cell growth factor (MGF) and interleukin-1-11, are also proteins considered in this invention. Multidrug resistance genes (mdRs) encoding p-glycoproteins are also considered as transgenes. Peptides or proteins can also be selection markers for antibiotic resistance in eukaryotes. Other types of selection markers are also included, such as adenine phosphoribosyltransferase (APRT) genes in APRT-deficient cells, fluorescent proteins, or firefly luciferase genes. Peptides or proteins can be proteins that provide additional or altered enzymatic activity to the host (such as herpes simplex virus thymidine kinase protein used in “suicide therapy” for reactive grafts), or toxins (such as diphtheria toxin protein used to treat cancer). Transgenes encoding these proteins can be provided by a variety of methods, such as conventional cloning procedures (Sambrook et al. (1989), Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY), excision from a vector containing the target gene, or chemical or enzymatic synthesis based on publicly available sequence information. In many cases, the DNA encoding the target protein is commercially available. In another embodiment, the transgene encodes a protein that enables experimental manipulation of the cell, such as toxin or fluorescent or drug-selective labeling.

[0029] In another preferred embodiment, the transgene is transcribed into a non-coding RNA molecule. In some embodiments, the transgene may encode a non-coding RNA that can alter the expression level of an intracellular gene or is a component of a ribonucleoprotein complex with enzymatic activity. Examples of such non-coding RNAs include short interfering RNA (siRNA), microRNA, nucleolar small RNA (snoNA), small nuclear RNA (snRNA), piwi-interacting RNA (piRNA), long non-coding RNA, transfer RNA (tRNA), and ribosomal RNA (rRNA). In some embodiments, the transgene may encode a non-coding RNA that is sufficiently complementary to hybridize with the target mRNA or DNA. This RNA molecule is an antisense RNA and can be used to prevent or limit the expression of overproduction, defective, or other unwanted molecules, or for studying gene function. The vector of the present invention can contain a sequence encoding antisense RNA as a transgene, the antisense RNA being sufficiently complementary to the target sequence such that it binds to the target sequence. For example, the target sequence can be part of an mRNA encoding a polypeptide, such that it binds and prevents the translation of the mRNA encoding the polypeptide. In another embodiment, the target sequence is a segment of a gene essential for transcription, such that the antisense RNA binds to said segment (e.g., a promoter or coding region) and blocks or restricts transcription. Therefore, the antisense RNA must be of sufficient length or complementarity to block the translation of its target mRNA or the transcription of its target DNA. Those skilled in the art can identify antisense molecules that are sufficiently complementary to the target sequence, enabling the antisense molecule to bind to the target and thereby inhibit translation or transcription. The transgenic sequence can be provided, for example, by chemical or enzymatic synthesis, or from commercial sources.

[0030] Vectors can also contain post-transcriptional regulatory elements (PREs). PREs can be located between the transgene insertion site and the 3'LTR.

[0031] Retroviral vectors can be based on any suitable retrovirus capable of delivering genetic information to eukaryotic cells. For example, retroviral vectors can be alpha retroviral vectors, gamma retroviral vectors, lentiviral vectors, or spuma retroviral vectors. These vectors are widely used in gene therapy and other gene delivery applications. In some embodiments, the retroviral vector is a lentiviral vector. In certain cases, the retroviral vector can be based on HIV-1. Preferably, the vector is derived from a lentivirus.

[0032] The vector contains an RNA packaging sequence located downstream of the 3' LTR, preventing the RNA packaging sequence from being reverse transcribed into vector DNA in the target cells. The RNA packaging sequence is essential for the fundamental process of packaging the retroviral RNA genome into viral particles, as it is assembled by the producing cells. The RNA packaging sequence is capable of binding to viral proteins within the nascent viral particles. In some embodiments, the RNA packaging sequence contains an RNA packaging signal (ψ). The RNA packaging signal may contain the HIV-1 psi packaging sequence. In HIV-1, a portion of the gag gene has been found to be involved in RNA packaging. In some embodiments, a point mutation is introduced downstream of the gag start codon to prevent most of the translation of this signal (ΔGag). The RNA packaging sequence may also contain a Rev response element (RRE). The RNA packaging sequence may contain ΔGag-RRE. ΔGag-RRE contains the psi packaging sequence, the RRE, and portions of the retroviral env and gag genes. RNA packaging sequences and the components that make up them are well known to those skilled in the art (see, for example, *Retroviruses*. Edited by Coffin JM, Hughes SH, and Varmus HE. ColdSpring Harbor (NY): Cold Spring Harbor Laboratory Press; 1997).

[0033] In some implementations, the vector also contains a foreign nucleotide sequence for delivery into target cells. This foreign nucleotide sequence can be any sequence that someone might want to insert into the target cells. For example, the foreign nucleotide sequence could be an expressible transgene, an RNA interference cassette, or a molecular barcode, such as for labeling lineages of different cells. The foreign nucleotide sequence should be located between the PBS and the 3' LTR.

[0034] According to another aspect of the invention, a host cell containing the vector described above is provided.

[0035] The host cell can be any suitable eukaryotic cell into which the vector can be introduced.

[0036] The plasmid encoding the retroviral vector of the present invention is transfected into suitable host cells (or packaging cells) using standard methods known to those skilled in the art. Suitable packaging cells are defined herein as cells containing helper viruses sufficient to allow packaging of RNA transcribed from the retroviral vector and the release of vector viral particles or viral particles. Typically, additional plasmids encoding trans-acting viral sequences but lacking the cis-acting sequences required for packaging are co-transfected. These provide the structural and enzymatic proteins required for packaging and generating the viral genome. Such packaging cells are known and available to those skilled in the art and include, for example, HEK293T cells.

[0037] Recombinant retroviruses generated from transfected cells are harvested using standard methods. The harvested retroviruses, in the form of viral particles, are transduced into permitted target cells using standard techniques. Target cells are defined herein as any cells permissible for infection by viruses generated from the retroviral vector of this invention. Target cells can be in vivo or in vitro. Representative target cells include, for example, bone marrow stem cells, hepatocytes, myocytes, tumor cells, neurons, retinal cells, and airway epithelial cells. The proviruses formed in the target cells are then capable of expressing transgenes. Because the proviruses do not contain RNA packaging sequences, any present endogenous accessory proteins cannot trigger any provirus to produce infectious viruses.

[0038] According to another aspect of the invention, viral particles containing the vector described above are provided.

[0039] Retroviral vectors or viral particles can be used as drugs.

[0040] Retroviral vectors or viral particles can be used to treat diseases that require gene therapy.

[0041] In some implementations, the retroviral vector or viral particle is used for administration to the liver. The retroviral vector or viral particle can be used to treat a variety of conditions, such as metabolic disorders and / or liver diseases.

[0042] According to another aspect, a pharmaceutical composition comprising the carrier or viral particles is provided.

[0043] The pharmaceutical composition may also contain one or more pharmaceutically acceptable excipients.

[0044] The composition can be a liquid or a solid, such as a powder, gel, or paste. Preferably, the composition is a liquid, and more preferably an injectable liquid. Such an injectable solution is preferably suitable for hepatic artery infusion. The composition may also contain one or more excipients, and such excipients are known to those skilled in the art.

[0045] The composition may be combined with or co-administered with an immunosuppressant (sequentially or simultaneously). This immunosuppression may be selected from one or more of the following: tacrolimus, mycophenolate mofetil, and prednisolone. Those skilled in the art will understand that other immunosuppressants may also be used.

[0046] The vector or viral particles can be used to deliver transgenes to subjects undergoing gene therapy.

[0047] According to another aspect, a method for delivering a gene to target cells is provided, the method comprising administering an effective amount of a vector or viral particle to the target cells, wherein the vector or viral particle contains an expressible transgene. This method can be used to create cell lines expressing a target gene. For example, the gene may encode a biotherapeutic agent, causing the cell line to produce the biotherapeutic agent, such as a therapeutic protein or antibody.

[0048] According to another aspect of the invention, cells produced by said method are provided.

[0049] According to another aspect of the present invention, a transgenic animal produced by said method is provided.

[0050] Features, elements, properties, compounds, molecules, chemical parts, or groups described in conjunction with a particular aspect, embodiment, or example of the invention should be understood to be applicable to any other aspect, embodiment, or example described herein, unless incompatible therewith. All features disclosed in this specification (including any appended claims, abstract, and drawings) and / or all steps of any disclosed method or process may be combined in any combination, except that at least some of these features and / or steps are mutually exclusive combinations. The invention is not limited to the details of any of the foregoing embodiments. The invention covers any novel feature or any novel combination disclosed in this specification (including any appended claims, abstract, and drawings), or any novel step or any novel combination of steps in any disclosed method or process. Attached Figure Description

[0051] Figure 1 The diagrams and graphs taken from (4) show the LTR1 structures developed based on conventional previous-generation lentiviral vectors, and a comparison of their respective vector titers (prior art). (a) is a schematic diagram showing the vectors with LTR1 backbone modifications. (b) is a graph showing the EGFP titers (%) generated with each vector relative to the CCL / RRL vector. The bars represent the mean, and the error bars represent the standard error (SEM) of the mean.

[0052] Figure 2 These are some schematic diagrams and graphs illustrating how novel LTR1 vector designs can be generated by reintroducing the HIV-1 5' LTR. (a) is a schematic diagram of the vectors showing the included elements, including the length of the genomic RNA (including gag-RRE) and the expected size of the DNA provirus (excluding gag-RRE). (b) is a graph where the left panel shows the EGFP titer (TU / ml) produced by each vector design, and the right panel shows each titer relative to the CCL comparator (n=3 replicates per group).

[0053] Figure 3 These are some schematic diagrams, graphs, and tables illustrating the improved 3'LTR constructs to enhance vector RNA stability. (a) is a schematic diagram showing how novel vector designs can be generated through mutations in the 3'LTR polyA and TAR domains. (b) is a graph where the left panel shows the original titers obtained from each vector, and the right panel shows the titers relative to those obtained using the original CCL (n=4 replicates per group). (c) is a table showing the different transfection rates studied (relative amounts of each plasmid are shown in nanomolar amounts). (d) is a graph showing the percentage of EGFP-positive cells transduced with 250 μL of vector supernatant and quantified by flow cytometry (n=2 replicates per treatment) (all transfection rates are compared to CCL vectors prepared using a common 4:2:1:1 ratio).

[0054] Figure 4 These are some graphs showing the test results of packaging therapeutic transgenes using the LTR2.1.1 vector. ABCB11 or GLDC cDNA was cloned into the relevant plasmid and used to generate viral vectors. The left graph shows the titers (TU / ml) of CCL-ABCB11 and LTR2.1.1-ABCB11. The right graph shows the titers (TU / ml) of CCL-GLDC and CCL-EGFP.

[0055] Figure 5 This is a graph showing the titers (TU / ml) of CCL-GLDC, LTR2.1.1 GLDC, and LTR2.2.1 GLDC.

[0056] Figure 6 These are some charts showing the effects of 5-6 week old GLDC knockout mice receiving a dose of 5 × 10⁻⁶. 10 CCL at TU / kg or a dose of 1 x 10 10 Plasma glycine levels in newborns after gene therapy with LTRx (promoter LP1) at a dose of TU / kg.

[0057] Figure 7 These are some graphs showing the efficacy of LTRx-Dbt treatment in the MSUD mouse model. (a) is a graph showing the survival rates of WT mice, MSUD KO mice, and MSUD KO mice treated with LTRx-HD or LTRx-LD. (b) is a graph showing the changes in body weight of WT, MSUD KO mice, and MSUD KO mice treated with LTRx-HD or LTRx-LD. (WT: n=15; KO: n=10; LTRx-HD: n=8; LTRx-LD: n=5.) WT: wild-type control; MSUD KO: MSUD mouse model; HD: high dose; LD: low dose.

[0058] Figure 8 These are some graphs further illustrating the efficacy of LTRx-Dbt treatment in the MSUD mouse model. (a) is a graph showing the BCAA / alanine ratio in WT and MSUD KO mice at day 20 (P20), and the BCAA / alanine ratio in WT, LTRx-HD, LTRx-LD, and CCL-Dbt-treated mice at day 100 (P100). (d) is a graph comparing the vector copy number in the livers of mice treated with LTRx-HD and LTRx-LD. One-way ANOVA with post-hoc Bonferroni correction was performed; error bars are presented as ±SEM. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. WT: wild-type; MSUD: MSUD mouse model; HD: high dose; LD: low dose.

[0059] Figure 9 These are graphs showing the quantification of tremor analysis at different frequencies in two-week-old (P15) and four-month-old (P120) MSUD KO mice. (a) is a graph showing the tremor analysis of P15 (juvenile) mice between 0 and 65 Hz. (b) is a graph showing the quantification of tremor analysis in WT and MSUD KO mice at high frequencies (35–65 Hz). (c) is a graph showing the tremor analysis of P120 (adult) WT mice and mice treated with LTRx-HD or LTRx-LD. (d) is a graph showing the quantification of tremor analysis in WT mice and mice treated with LTRx-HD or LTRx-LD at high frequencies (35–65 Hz). One-way ANOVA with post-hoc Bonferroni correction is included. Error bars are presented as ±SEM. All significance shown is relative to the wild-type control group, ** p < 0.01.

[0060] Figure 10These are some graphs showing gait analysis of MSUD mice treated with LTRx-HD or LTRx-LD. (a) is a graph showing the quantification of mean stride length (cm) for WT mice and MSUD mice treated with LTRx-HD or LTRx-LD. (b) is a graph showing the hind limb swing velocity (cm / s) for WT mice and MSUD mice treated with LTRx-HD or LTRx-LD. (c) is a graph showing the gait regularity index (%) for WT mice and MSUD mice treated with LTRx-HD or LTRx-LD. (d) is a graphical representation of paw prints captured during the mean run in a CatWalk XT semi-automatic gait analysis of 12-week-old mice treated at P1 (yellow: left forepaw, cyan: right forepaw, pink: right hindaw, and green: left hindaw). One-way ANOVA with post-hoc Bonferroni correction. Error bars represent ±SEM. All statistical significance was relative to the WT control group, **p < 0.01, ***p < 0.001, ****p < 0.0001. WT: wild-type control, HD: high dose, LD: low dose. Detailed Implementation

[0061] Example

[0062] A series of experiments were conducted to prepare lentiviral vectors with improved titers for subsequent use in gene therapy.

[0063] Example 1 – Preparation and evaluation of LTRx vectors in an NKH mouse model

[0064] Materials and methods

[0065] Generation of plasmid constructs

[0066] All plasmid constructs were prepared using standard molecular cloning procedures and PCR-mediated plasmid sequence deletion techniques (29). In cases involving the incorporation of novel elements or junctions, synthetic DNA fragments were designed and sequenced as gBlocks (Integrated DNA Technologies).

[0067] Production of lentiviral vectors

[0068] The lentiviral vector was generated as described above (4). In short, 1.8 × 10⁻⁶ ppm was used per 15 cm sterile culture dish. 7HEK293T cells were plated and transfected with the following components: 40 μg of related transfer plasmid, 20 μg of pMDLg.RRE, 10 μg of pRSV-Rev, and 10 μg of pMDG.2 (all plasmids were generated by PlasmidFactory). Additionally, 10 μg of HIV-1 Tat expression vector was added for LTR vector generation. The plasmid mixture was added to 5 mL of Opti-MEM and filtered through a 220 nm sterile filter. The filtered DNA was combined with 5 mL of Opti-MEM (Life Tech / GE) containing 2 μM polyethyleneamine (PEI, Sigma). The resulting 10 mL mixture was incubated at room temperature for 10 minutes and then added to HEK293T cells. After 4 hours, the transfection mixture was replaced with fresh medium. Viral supernatant was collected 48 hours post-transfection. After each harvest, the collected medium was filtered through a cellulose acetate membrane (0.45 mm pores). With the vector concentrated, the viral supernatant was placed in a homogeneous polymer centrifuge tube (Beckman Coulter) and centrifuged at 90,000 × g at 4 °C for 2 hours in a Sorvall Discovery 90SE centrifuge. After centrifugation, the supernatant was removed, and the precipitate was recovered in 200 μL phosphate-buffered saline (PBS).

[0069] Titration of lentiviral vectors

[0070] Carrier titration by flow cytometry: 1×10 5 HEK293T cells were seeded into each well of a 6-well plate and transduced with dose-escalating vector supernatant. EGFP titers were measured by flow cytometry 72 hours post-transduction. Titers were calculated based on cell populations ranging from 5% to 30% EGFP+, as described above (4).

[0071] Detection of eGFP expression in transduced cells

[0072] Unless otherwise specified, EGFP expression in 100,000 cells was analyzed in the BD FACSArray Bioanalyzer. During analysis, viable cells were identified by gated forward and side scattering and separation of relevant populations. EGFP-positive cells were identified by plotting EGFP fluorescence (detected using a 530 / 30 nm bandpass filter) and emission from the yellow channel (detected using a 575 / 26 bandpass filter) to compensate for autofluorescence. Non-transduction controls were used to gate background expression in each channel. All flow cytometry data were analyzed using FlowJo software version 9.3.1 (Tree Star).

[0073] In vivo gene therapy in NKH mouse model

[0074] homozygous NKH mice (Gldc) GT / GT ) and Gldc GT / + Heterozygous hybrids were crossed to produce knockout offspring, and the genotype was confirmed on day 1 (P1). At P1, offspring were induced to migrate via the superficial temporal vein at a rate of 1 x 10⁻⁶. 10 The vector was delivered to mice at a transduction unit / kg (TU / kg) dose. Six weeks after vector administration, metabolic analysis of sampled blood was performed by mass spectrometry to quantify systemic glycine levels. Liver and various tissue samples were taken, and vector copy number (VCN) and transgenic mRNA were quantified by qPCR.

[0075] Statistical analysis

[0076] All statistical analyses were performed using Matlab 2015a. The Stein t-test was used to compare titers and EGFP values. Unless otherwise stated, titration comparisons were performed in triplicate.

[0077] Restore 5'LTR to enhance transcription initiation

[0078] In previous experiments, the LTR1 vector was developed based on the previous generation lentiviral plasmids pCCL-GADPH-EGFP and pRRL-PGK-EGRP, such as Figure 1 As shown. In these constructs, the RNA packaging sequence was transferred downstream of the 3' self-inactivating LTR. The 5' LTR was restored in one construct, named LTR1.11.1, and compared with a similar construct lacking the 5' LTR (LTR1.13.0). However, no significant difference in titer was found between LTR1.11.1 and LTR1.13.0. The highest yield construct relative to the third-generation vector was LTR1.27, which lacked the 5' LTR but contained an elongation factor 1α intron at the 5' end of the vector.

[0079] Further optimization was performed using the LTR1.27 vector, where the 5' LTR is now restored to the position adjacent to the heterointron. This new LTR1 prototype is called LTR2.1. Three versions of LTR2.1 were generated, differing in the intron immediately downstream of the 5' LTR, such as... Figure 2 As shown in Figure a. These new configurations were packaged into vectors containing enhanced green fluorescent protein (EGFP) transgenes and titrated. The LTR2 vectors were compared with the CCL vector and the existing LTR1.27 version to benchmark any improvements. Flow cytometry titrations showed that LTR2.1.1 and LTR2.1.3 versions were the best prototypes, with titers for each design increasing by 2-fold compared to LTR1.27 (P = 0.04 and 0.01, respectively). Figure 2As shown in b, LTR2.1.1, which contains the elongation factor 1α intron, and LTR2.1.3, which contains the β-globin intron, were both incorporated into further iterative optimization steps.

[0080] Mutate the 3'LTR motif to facilitate transcriptional readthrough

[0081] like Figure 3 As shown in Figure a, six novel vector designs were generated from LTR2.1 and LTR2.3. The novel structures contain mutations in two key regions of the 3'LTR. The HIV-1 polyA site, located in the 'R' domain of the 3'LTR, loses its activity upon mutation (10). Polyadenylation at this site may pose a problem for LTR1 because the packaging sequence required for capsidation is located downstream of this region, such as... Figure 1 As shown.

[0082] Furthermore, HIV-1 trans-action response (TAR) hairpin mutations occur to block Tat binding to the 3'LTR (11). Theoretically, this would reduce Tat-mediated transcription initiated from the 3'LTR, thereby adversely excluding the transgene expression cassette.

[0083] like Figure 3 As shown in b, flow cytometry titrations indicated that the versions containing the polyA mutation had average titers of 52% and 43% relative to CCL, respectively. The titers of the vectors containing the TAR mutation ranged from 42% to 48% relative to CCL. However, the combination of Tat and TAR mutations produced relatively low titers, averaging 1% and 4% relative to CCL. Given that the titers obtained from LTR2.2.1 provide the highest vector titers to date, this iteration will continue for further downstream optimization.

[0084] The generation of lentiviral vectors involves co-transfection of the transgenic plasmid with three additional plasmids encoding HIV-1 gagpol, envelope protein (VSVg), and HIV-1 Rev (13). The LTR1 vector requires additional transfection with the HIV-1 Tat plasmid (4). However, in the context of LTR2, the relative amounts of each component have never been optimized.

[0085] like Figure 3 As shown in Figure c, 14 different transfection ratios were investigated to identify the optimal formulation for generating the LTR2.2.1 vector. The relative amount of each plasmid was calculated using dsDNA volume molar concentration, rather than through conventional mass quantification methods. This volume molar concentration-driven approach can account for differences in plasmid size. Figure 3 As shown in d, flow cytometry titration indicated that the optimal ratio of transgene:gagpol:enveloped:rev:tat was 4:2:1:1:1.

[0086] Packaging of candidate transgenes reveals the importance of metabolic pathways for lentiviral vector proliferation.

[0087] HIV-1-based LV vector gene therapy has demonstrated clinical proof-of-concept in in vitro hematopoietic stem cell (HSC) therapy (11-13) and in vivo brain gene therapy for Parkinson's disease (17). In addition to these clinical applications, LV gene therapy is being developed for in vivo liver gene therapy targeting hemophilia B, and its preclinical safety has been demonstrated in dogs and non-human primates (NHPs) (18,19).

[0088] Because the integrated vector genome will survive hepatocyte proliferation during childhood, which depletes adeno-associated virus (AAV) vectors, LV holds particular promise for treating pediatric liver diseases. Therefore, experiments were conducted to produce a transgenic LTR2 vector that could be used for gene therapy in pediatric liver diseases. For proof-of-principle studies, gene therapy for nonketotic hyperglycinemia (NKH) (a congenital glycine metabolism disorder) and bile salt export pump deficiency (BSEP) (a hereditary cholestasis) were targeted.

[0089] In each case, the relevant transgene was packaged into LTR2.1.1, LTR2.2.1, or CCL vectors. This included glycine decarboxylase (GLDC) for NKH and ATP-binding cassette subfamily B member 11 (ABCB11) for BSEP deficiency. Surprisingly, despite containing similar transgene sizes (approximately 3 kb each), the packaging efficiency of each transgene differed in each vector backbone.

[0090] like Figure 4 As shown, when packaging the ABCB11 transgenic vector, the vector titer produced by LTR2.2.1 was more than 3 times higher than that of CCL (P < 0.001), although... Figure 3 As shown, when packaging EGFP transgenes, the titers produced by LTR2.2.1 are typically 2-fold lower than those produced by CCL. This is likely due to the role of bile acid metabolism in cholesterol homeostasis, which is important for maintaining lipid rafts in the viral envelope (17). ABCB transporters have previously been shown to affect lentiviral vector titers in the ABCB4 background, as overexpression of this gene in LV vector-producing cells disrupts cholesterol incorporation into the vector envelope and reduces its infectivity (21).

[0091] Conversely, such as Figure 5 As shown, when attempting to package GLDC, the titer produced by backbone LTR2.1.1 was higher than that produced by LTR2.2.1 (P < 0.001), indicating that efficient translation of GLDC favors higher titers, although LTR2.2.1 generally produces higher levels of carrier titers. See [link to relevant documentation]. Figure 2 and 3 It is believed that LTR2.1.1 can provide a higher titer when packaging GLDC transgenes due to the functionality of the GLDC enzyme product in production cells. The main difference between LTR2.1.1 and LTR2.2.1 is that the latter contains a polyA mutation in its 3' LTR, meaning that transgene expression is suppressed in production cells. Therefore, using LTR2.2.1-GLDC is likely to result in much lower expression levels during vector proliferation. Thus, the higher titer of LTR2.1.1-GLDC may be due to the GLDC enzyme activity itself creating a permissible environment from which LTR2.2.1 does not benefit. Furthermore, as... Figure 4 As shown, the CCL-GLDC titer appears to show a higher level when GLDC is packaged compared to the CCL-EGFP titer.

[0092] Comparison of in vivo data of LTR2.1.1-GLDC and CCL-GLDC vectors

[0093] The LTR2.1.1-GLDC construct was tested in vivo in the NKH mouse model and compared with... Figure 6 The CCL-GLDC constructs shown were compared. Surprisingly, the LTR2.1.1 construct, even delivered at a 5-fold lower dose, at least matched the efficacy of CCL. Statistical comparisons showed no significant difference in vector copy number (P = 0.3), but the LTR2.1.1-GLDC vector reduced plasma glycine to a greater extent (P = 0.05).

[0094] in conclusion

[0095] HIV-1-based lentiviral vectors have been developed for various gene therapy applications. Generally, LV is preferred over other gene delivery platforms when the treated cells are expected to undergo several consecutive rounds of cell division because it permanently integrates its genetic material into the cell genome. However, LV integration has the drawback of potentially causing insertional mutagenesis. LTR1, a novel lentiviral vector, has been developed as a potential solution to this problem, but previous versions of LTR1 were limited by low yield titers. The main objective of this study was to design LTR1 technology to improve vector titers.

[0096] Iterative optimization successfully increased the vector titer by 5-fold compared to LTR 1.27. This was achieved by designing the vector backbone to enhance transcription initiation and minimize premature termination during vector production. Unexpectedly, this included restoring the HIV-1 5'LTR adjacent to the heterologous intron and the mutated HIV-1 3'LTR polyA site.

[0097] LV-mediated liver gene therapy has the potential to address unmet needs in the management of patients with severe early-onset metabolic diseases. Proof-of-concept studies of LV gene therapy for innate metabolic errors (IEMs) have been demonstrated in models of hereditary tyrosinemia, glycogen storage disease, and methylmalonic acidemia (23–25). Given the long-term gene expression profile of LV in dividing hepatocytes, it may be more advantageous than AAV in this area. Another advantage of the LV vector compared to AAV is that it encapsulates a glycoprotein derived from vesicular stomatitis virus (VSVg), which primarily infects livestock and therefore has a very low seropositivity rate in the human population (26). The lower particle dose required for LV to achieve efficacy (LV: 1 × 10⁻⁶) is also a significant advantage. 10 vg / kg, while AAV is 1× 10 14 vg / kg (27), which may reduce adverse events associated with capsid-induced hepatotoxicity in AAV clinical trials (27).

[0098] The LTR2.2.1 construct differs from LTR2.1.1 in that it contains a polyA mutation in the 3' LTR. The initial purpose of inserting this mutation was to allow transcriptional readthrough into the downstream packaging sequence, thereby maximizing the amount of packageable genome. However, as a side effect, this mutation also reduces transgene expression in producing cells, likely due to the lack of polyadenylation in the subgenomic transgene mRNA. Nevertheless, this difference was not observed in treated cells, possibly because the intact 5' LTR (containing the functional polyA motif) is copied to the 3' LTR during reverse transcription.

[0099] When attempting to package candidate therapeutic transgenes into LTR2.1.1 and LTR2.2.1 for validation of principle in gene therapy research, this aspect of the vector yielded a surprising benefit in terms of titer. Previous studies have shown that overexpression of transgenes involved in cholesterol homeostasis (e.g., ABCB4) during LV vector production disrupts viral envelope stability due to dysregulation of cholesterol transmembrane transport, resulting in a significant decrease in viral titer (21). It has been proposed that ABCB11 expression also affects cholesterol homeostasis, as its overexpression in mice leads to hypercholesterolemia due to enhanced cholesterol uptake in treated cells (28). When the ABCB11 transgene was packaged into the LTR2.2.1 vector, a higher vector titer was observed compared to that achieved using conventional CCL vectors, likely due to the repression of ABCB11 translation caused by the polyA mutation. This method of blocking ABCB11 expression during vector production normalizes cholesterol homeostasis and thus maintains vector titer efficiency.

[0100] Conversely, the opposite trend was observed when attempting to package the GLDC transgene, as the titer of LTR2.2.1 was lower than that of LTR2.1.1. This was concluded to be due to the positive effect of GLDC on vector proliferation, which disappeared when the LTR2.2.1 backbone was used due to the lack of transgene polyadenylation. The exact mechanism may be related to the role of this enzyme in nucleotide metabolism, where high GLDC expression is thought to promote viral replication (22).

[0101] In vivo studies have revealed additional benefits of the LTR2.1.1 vector construct. In the NKH mouse model, a lower particle dose of LTR2.1.1-GLDC was required to achieve the same efficacy as CCL-GLDC. This translates to greater clinical benefit, as the lower particle dose is thought to reduce the number of integration events and the activation of a strong immune response in patients.

[0102] Example 2 - Validation of LTRx vector in MSUD mouse model

[0103] Materials and methods

[0104] Production of LTRx-Dbt vectors

[0105] The LV vector was generated as described above (4). In short, each T175 culture flask was inoculated with 2 × 10⁶ cells / mL. 7 HEK293T cells were cultured in flasks containing the following components: 40 μg transgenic plasmid (Ltr2.1.1-LPS-Dbt), 20 μg pMDLg.RRE, and 10 μg pMDG.2 (all plasmids were produced by Plasmid Factory), and 10 μg pRSV-Rev-pCMV-Tat. The plasmid mixture was added to 5 mL of Opti-MEM and filtered through a 220 nm sterile filter. The filtered DNA was mixed with 5 mL of Opti-MEM (Life Tech / GE) containing PEIpro® transfection reagent (Polyplus) µl to DNA µg at a 1:1 ratio. The resulting 10 mL mixture was incubated at room temperature for 10 minutes and then added to HEK293T cells. The viral supernatant was collected 48 hours post-transfection. After harvesting, the collected culture medium was filtered through a cellulose acetate membrane (0.45 mm pores). In short, the virus was placed in a 50 ml Falcon tube and centrifuged overnight at 14,000 rpm × g in an Eppendorf 5810R centrifuge at 4°C. After centrifugation, the supernatant was removed, and the precipitate was recovered in 200 μL PBS.

[0106] Titration of LTRx-Dbt carrier

[0107] 1×10 5 HEK293T cells were seeded into each well of a 6-well plate and transduced with escalating doses of concentrated LV. After one week, cells were passaged at a 1:3 ratio and maintained in culture medium for 5 days. Cells were then harvested and DNA was extracted using the Qiagen DNeasy Blood & Tissue Kit according to the manufacturer's protocol. LV titers were identified using TaqMan (Applied Biosystems™ TaqMan™ Universal Master Mix) qPCR assays. qPCR was performed in replicates for each sample, and analysis was based on the mean of the replicate Cq values. Primers and TaqMan probes were designed to target the β-actin and LTRx backbone. The probes were labeled with FAM reporter fluorophores and quenchers at the 5' and 3' ends. Primers and probes were manufactured by Sigma-Aldrich (St. Louis, USA). The thermal cycling conditions were as follows: 50°C for 2 minutes in a qPCR instrument (4376357, Thermo Fisher, Dartford, UK), followed by initial denaturation at 95°C for 2 minutes, 15 seconds at 95°C (denaturation), and 60 seconds at 56°C (annealing and extension), for 45 cycles. A known concentration (10...) was used. 7 10 6 10 5 10 4 10 3 Standard curves were obtained by using template standard plasmids containing partial β-actin and Ltrx backbone sequences (number of molecules / μL) and calculating vector copy number and titer based on Cq values.

[0108] Vector copy number analysis

[0109] Liver DNA was extracted using the Qiagen DNeasy Blood & Tissue Kit according to the manufacturer's instructions. The extracted DNA was quantified using qPCR Power SYBR™ Green PCR Master Mix (Applied Biosystems 4368577). qPCR was performed repeatedly for each sample, and analysis was based on the average Cq values ​​of the replicates. The vector content and housekeeping gene (mouse titin gene) content of each sample were analyzed using Dbt primers. Standards for LTRx and housekeeping gene content were composed of internally cloned plasmids containing the titin sequence-related portion. Known concentrations (10⁻⁶) were used. 7 10 6 10 5 10 4 10 3The number of vector copies in the liver was calculated using a standard plasmid (number of molecules / μL). The thermal cycling conditions were as follows: 40 cycles were performed in a qPCR instrument (4376357, Thermo Fisher, Dartford, UK) at 50°C for 2 minutes, followed by initial denaturation at 95°C for 10 minutes, denaturation at 95°C for 15 seconds, and annealing and extension at 60°C for 60 seconds.

[0110] MSUD mouse model

[0111] All animal research was approved by the UK Home Office and conducted under regulated procedures (Animal Scientific Procedures Act, 1986). This study used Dbt. tm1Geh Tg(Cebpb-tTA)5Bjd Tg(tetO-DBT)A1Geh / J line (JAX stock number 006999, (31)). Hybrid heterozygous mice produced mDbt-hDbt + mDbt + hDbt + Animals were used as MSUD KO and WT controls in this study. Due to the severity of the phenotype leading to early postnatal death, mDbt-hDbt was used as a control. - Animals were excluded from the study. They were placed under a 12-hour light / dark cycle and provided with normal food and free access to water. For survival, any mouse that showed a 15% weight loss or exhibited ataxia / dyskinesia after 24 hours was considered to have reached its humanitarian endpoint and was euthanized. Terminal bloodletting was performed on mice via transcardiac perfusion with phosphate-buffered saline. The liver and other organs were subsequently extracted, rapidly frozen on dry ice, and stored at -80°C for downstream analysis.

[0112] Neonatal administration of LV carrier:

[0113] Gene delivery was performed at time point P1. LTRx-Dbt vector (high dose, HD) or a 4-fold dilution (low dose, LD) was administered intravenously via the superficial temporal vein using a 33-gauge needle (Hamilton, Reno, Nevada, USA). Mice were allowed to recover and return to their cages with their mothers.

[0114] Behavioral Analysis

[0115] Tremor

[0116] Tremor analysis was performed on wild-type control mice, MSUD KO mice, and MSUD LTRX-Dbt-treated mice at 2 weeks of age (P15) or 4 months of age (P120) using a commercially available tremor monitor (San Diego Instruments, San Diego, California, USA), as described previously (33). Individual mice were placed on the vibration-damping platform within the device and monitored for 256 seconds after a 30-second acclimatization period. The output (amplitude / time) was analyzed using LabVIEW software to measure the power at each monitoring frequency (0-64 Hz).

[0117] gait

[0118] Gait monitoring was performed on 4-month-old control, untreated, wild-type control, and treated MSUD LTRX-Dbt mice using the automated gait analysis CatWalk system (Noldus, Wageningen, Netherlands). Mice were monitored by placing them individually at one end of the CatWalk and capturing images of them freely walking across a backlit stage.

[0119] At least three successful runs were recorded for each experiment, with a run across the stage considered successful if it met the standard running criteria. Paw prints during successful runs were examined, categorized, and analyzed using CatWalk XT software v10.6 (Noldus) to generate overall running measurements.

[0120] Measurement of BCAA serum concentration

[0121] To obtain serum, animals were anesthetized with isoflurane in 100% oxygen, and blood was obtained via cardiac puncture using a 1 ml insulin syringe. The blood was immediately transferred to a MiniCollect® tube (0.5 ml LH lithium heparin) and centrifuged at 4000×g for 20 minutes. The plasma was then removed and rapidly frozen on dry ice.

[0122] According to the manufacturer's instructions, BCAA levels in serum samples were obtained using Abcam's Branched-Chain Amino Acid Assay Kit (#ab83374). BCAA levels typically increase after feeding. To account for this, L-alanine concentrations were measured using the L-alanine Assay Kit (#ab83394). The normalized BCAA / alanine ratio was used as an indicator of BCAA increases in MSUD animals.

[0123] Statistical analysis

[0124] Customized statistical analyses were performed for each experiment using GraphPad Prism version 9. Two-tailed Stein t-tests were applied to assess statistical differences in two-way comparisons, while one-way or two-way ANOVA was performed using the Bonferroni post-correction test for multiple comparisons.

[0125] Efficacy evaluation of LTRx-Dbt treatment in MSUD mouse model

[0126] Maple syrup diabetes mellitus (MSUD) is a metabolic disorder caused by a deficiency of branched-chain ketoacid dehydrogenase (BCKDH), leading to elevated levels of branched-chain amino acids (BCAAs) in the blood. Patients may experience developmental delays, feeding difficulties, neurotransmitter imbalances, and encephalopathy syndrome. BCKDH is expressed in various tissues, but the liver is the primary organ responsible for BCAA metabolism. BCKDH is a complex enzyme composed of three basic subunits: α-ketoacid dehydrogenase, dihydrolipoyltransferase (DBT), and dihydrolipoic acid dehydrogenase. A deficiency in any of these subunits can lead to the disease manifestations of MSUD. Specifically, mutations in the DBT gene can manifest different symptoms depending on the residual enzyme activity (30).

[0127] To further validate the LTRx platform, the efficacy of an LTRx-based lentiviral vector expressing the Dbt gene and containing a liver-specific promoter (LPS) was investigated in an MSUD mouse model. In this mouse model, the mouse Dbt gene was knocked out and replaced by the human Dbt gene, resulting in a partial restoration of BCKDH enzyme activity. Consequently, these animals exhibited typical symptoms of the MSUD intermediate (31). Treated mice were injected with high-dose (HD) or low-dose (LD) LTRx-Dbt vectors, and their survival, body weight, and BCAA were assessed over 4 months.

[0128] like Figure 7 As shown in A and 7B, neonatal injection of the LTRx-Dbt vector significantly prolonged the lifespan of MSUD KO mice compared to untreated mice. Weight gain was further improved in LTRx-Dbt-treated mice compared to untreated mice. Plasma BCAA / alanine levels were also significantly improved, decreasing from a 23-fold increase relative to age-matched wild-type controls in MSUD KO mice to only a 3-fold increase after high-dose LTRx-Dbt treatment. Figure 8 As shown in Figure A, despite receiving a 2.5-fold higher dose of the vector, BCAA levels were significantly lower in LTRx-HD animals compared to the experimental group treated with CCL-Dbt (a third-generation lentiviral vector).

[0129] To further evaluate the efficacy of the injection, the vector copy number (VCN) in each liver cell was measured. Figure 8 As shown in B, the LTRx-HD group exhibits approximately 4 times higher VCN compared to the LTRx-LD queue.

[0130] Evaluate the effects of LTRx-Dbt administration on ataxia and motor function in a MSUD mouse model.

[0131] Patients with MSUD may experience ataxia due to catabolism disorders (32). Ataxia and motor function in the experimental cohort were assessed using an automated tremor sensor and Catwalk-XT gait analysis. The gait parameters studied were mean stride length (the distance between consecutive paw placements in cm), hind limb swing speed (cm / s, the speed at which the hind paw moves between consecutive placements), and gait regularity index (the percentage of normal gait sequence patterns during uninterrupted running), which measured the degree of coordination between limbs.

[0132] Tremor analysis showed that untreated MSUD KO mice exhibited characteristic tremors at a higher frequency compared to wild-type controls, such as... Figure 9 As shown in A and B; this condition was improved in animals treated with LTRX-Dbt, as... Figure 9 As shown in C and D.

[0133] Gait trace examination revealed a significant deterioration in gait in MSUD animals treated with low-dose LTRx-Dbt vector. Quantitative analysis of stride length, gait regularity index, and hind limb swing speed indicated a marked improvement in MSUD mice treated with high-dose vectors, suggesting a potential reduction in the therapeutic threshold for BCAAs. Figure 10 As shown.

[0134] The experiments conducted revealed two novel lentiviral vector structures for mediating gene therapy. Each design can be selected for a specific transgene, depending on the behavior of the transgene in cells producing HIV-1 components. Furthermore, two metabolic pathways that could potentially influence lentiviral vector titers have been identified.

[0135] The foregoing embodiments are not intended to limit the scope of the claims, but rather to describe examples of how to implement the invention.

[0136] sequence list

[0137] SEQ ID No. 1 Cytomegalovirus (CMV) promoter

[0138] gacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaacc

[0139] SEQ ID No. 2 5' Long Terminal Repeat (LTR)

[0140] gggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagca

[0141] SEQ ID No. 3 Primer binding site (PBS)

[0142] tggcgcccgaacagggac

[0143] Primer overextension sequence

[0144] [c / t]tgaaa

[0145] SEQ ID No. 4 Elongation factor 1α intron (EF1A)

[0146] gtaagtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttccacctggctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaaggagccccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgccgcgtgcgaatctggtggcaccttcgcgcctgtctcgctgctttcgataagtctctagccatttaaaatttttgatgacctgctgcgacgctttttttctggcaagatagtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaagctggccggcctgctctggtgcctggcctcgcgccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttcccggccctgctgcagggagctcaaaatggaggacgcggcgctcgggagagcgggcgggtgagtcacccacacaaaggaaaagggcctttccgtcctcagccgtcgcttcatgtgactccacggagtaccgggcgccgtccaggcacctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggggttttatgcgatggagtttccccacactgagtgggtggagactgaagttaggccagcttggcacttgatgtaattctccttggaatttgccctttttgagtttggatcttggttcattctcaagcctcagacagtggttcaaagtttttttcttccatttcag

[0147] SEQ ID No. 5 β-globin intron

[0148] gtgagtctatgggacccttgatgttttctttccccttcttttctatggttaagttcatgtcataggaaggggagaagtaacagggtacacatattgaccaaatcagggtaattttgcatttgtaattttaaaaaatgctttcttcttttaatatacttttttgtttatcttatttctaatactttccctaatctctttctttcagggcaataatgatacaatgtatcatgcctctttg caccattctaaaagaataacagtgataatttctgggttaaggcaatagcaatatttctgcatataaatatttctgcatataaattgtaactgatgtaagaggtttcatattgctaatagcagctacaatccagctaccattctgcttttattttatggttgggataaggctggattattctgagtccaagctaggcccttttgctaatcatgttcatacctcttatcttcctcccacag

[0149] SEQ ID No. 6: Central polypurine region (cPPT) and central termination site (CTS)

[0150] ttttaaaagaaaaggggggattggggggtacagtgcaggggaaaaatagtagacataaagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaatttt

[0151] SEQ ID No. 7 Marmot Hepatitis Virus (WPRE)

[0152] aatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaagctgacgtcctttccatggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgc

[0153] SEQ ID No. 8 3' Self-inactivated long terminal repeat (SIN-LTR)

[0154] tggaagggctaattcactcccaacgaagacaagatctgctttttgcttgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagca

[0155] SEQ ID No. 9 is a 3' long terminal repeat (LTR) sequence with a polyadenylation (polyA) site mutation.

[0156] tggaagggctaattcactcccaacgaagacaagatctgctttttgcttgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaaCaaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagca

[0157] SEQ ID No. 10 3' long terminal repeat sequence with HIV-1 trans-action response (TAR) hairpin site mutation LTR (Longest Rendezvous)

[0158] tggaagggctaattcactcccaacgaagacaagatctgctttttgcttgtactgggtctctctggttagaccagatctgagcctgggagTtctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagca

[0159] SEQ ID No. 11 has a polyadenylation (polyA) site mutation and HIV-1 trans-action response (TAR) mutation. 3' Long Terminal Repeat (LTR) at the clamp site

[0160] tggaagggctaattcactcccaacgaagacaagatctgctttttgcttgtactgggtctctctggttagaccagatctgagcctgggagTtctctggctaactagggaacccactgcttaagcctcaacaaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagca

[0161] SEQ ID No. 12 HIV-1 psi packaging sequence

[0162] ctctctcgacgcaggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgagagcgtc

[0163] SEQ ID No. 13 Rev Reactive Element (RRE)

[0164] aggagctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcct

[0165] SEQ ID No. 14 ΔGag-RRE

[0166]

[0167] References

[0168] 1. Cunningham SC, Dane AP, Spinoulas A, Alexander IE. Gene Deliveryto the Juvenile Mouse Liver Using AAV2 / 8 Vectors. Mol Ther 2008; 16: 1081–1088.

[0169] 2. Mingozzi F, High KA. Immune responses to AAV vectors: overcomingbarriers to successful gene therapy. Blood 2013; 122: 23–36.

[0170] 3. Cavazzana-Calvo M, Payen E, Negre O, Wang G, Hehir K, Fusil F etal. Transfusion independence and HMGA2 activation after gene therapy of humanβ-thalassaemia. Nature 2010; 467: 318–22.

[0171] 4. Vink CA, Counsell JR, Perocheau DP, Karda R, Buckley SMKK, BrugmanMH et al. Eliminating HIV-1 Packaging Sequences from Lentiviral VectorProviruses Enhances Safety and Expedites Gene Transfer for Gene Therapy. MolTher 2017; 9: 10–20.

[0172] 5. Counsell JR, Vink CA, Perocheau DPB, Karda R, Ng J, Buckley SMK etal. 529. Novel LTR-1 Lentiviral Vectors Are Fully Functional Following theRemoval of HIV-1 Gag-RRE Sequences. Mol Ther 2015; 23: S212.

[0173] 6. Counsell JR, Vink CA, Karda R, Perocheau DP, Brugman MH, BuckleySM et al. 78. LTR1 Vectors Enhance Safety in Gene Therapy and Can BeExploited for Rapid, Transient Gene Delivery. Mol Ther 2017; 25: 38.

[0174] 7. Huelsmann PM, Hofmann AD, Knoepfel SA, Popp J, Rauch P, DiGiallonardo F et al. A suicide gene approach using the human pro-apoptoticprotein tBid inhibits HIV-1 replication. BMC Biotechnol 2011; 11: 4.

[0175] 8. Gray SJ, Foti SB, Schwartz JW, Bachaboina L, Taylor-Blake B,Coleman J et al. Optimizing promoters for recombinant adeno-associated virus-mediated gene expression in the peripheral and central nervous system usingself-complementary vectors. Hum Gene Ther 2011; 22: 1143–1153.

[0176] 9. Beerli RR, Segal DJ, Dreier B, Barbas CF. Toward controlling geneexpression at will: Specific regulation of the erbB-2 / HER-2 promoter by usingpolydactyl zinc finger proteins constructed from modular building blocks.Proc Natl Acad Sci U S A 1998; 95: 14628–14633.

[0177] 10. Orkin SH, Cheng TC, Antonarakis SE, Kazazian HH. Thalassemia dueto a mutation in the cleavage-polyadenylation signal of the human beta-globingene. EMBO J 1985; 4: 453–456.

[0178] 11. Emiliani S, Van Lint C, Fischle W, Paras P, Ott M, Brady J et al.A point mutation in the HIV-1 Tat responsive element is associated withpostintegration latency. Proc Natl Acad Sci U S A 1996; 93: 6377–81.

[0179] 12. Chavez A, Scheiman J, Vora S, Pruitt BW, Tuttle M, P R Iyer E etal. Highly efficient Cas9-mediated transcriptional programming. Nat Methods2015; 12: 326–328.

[0180] 13. Dull T, Zufferey R, Kelly M, Mandel RJ, Nguyen M, Trono D et al.A third-generation lentivirus vector with a conditional packaging system. JVirol 1998; 72: 8463–8471.

[0181] 14. Biffi A, Montini E, Lorioli L, Cesani M, Fumagalli F, Plati T etal. Lentiviral Hematopoietic Stem Cell Gene Therapy Benefits MetachromaticLeukodystrophy. Science (80- ) 2013; 341: 1233158–1233158.

[0182] 15. Sessa M, Lorioli L, Fumagalli F, Acquati S, Redaelli D, Baldoli Cet al. Lentiviral haemopoietic stem-cell gene therapy in early-onsetmetachromatic leukodystrophy: an ad-hoc analysis of a non-randomised, open-label, phase 1 / 2 trial. Lancet 2016; 388: 476–487.

[0183] 16. Ribeil J-A, Hacein-Bey-Abina S, Payen E, Magnani A, Semeraro M,Magrin E et al. Gene Therapy in a Patient with Sickle Cell Disease. N Engl JMed 2017; 376: 848–855.

[0184] 17. Palfi S, Gurruchaga JM, Ralph GS, Lepetit H, Lavisse S, ButteryPC et al. Long-term safety and tolerability of ProSavin, a lentiviral vector-based gene therapy for Parkinson’s disease: a dose escalation, open-label,phase 1 / 2 trial. Lancet 2014; 383: 1138–1146.

[0185] 18. Cantore A, Ranzani M, Bartholomae CC, Volpin M, Valle P Della,Sanvito F et al. Liver-directed lentiviral gene therapy in a dog model ofhemophilia B. Sci Transl Med 2015; 7: 277ra28.

[0186] 19. Milani M, Annoni A, Moalli F, Liu T, Cesana D, Calabria A et al.Phagocytosis-shielded lentiviral vectors improve liver gene therapy innonhuman primates. Sci Transl Med 2019; 11: eaav7325.

[0187] 20. Lu K, Heng X, Summers MF. Structural determinants and mechanismof HIV-1 genome packaging. J Mol Biol 2011; 410: 609–33.

[0188] 21. van Til NP, Heutinck KM, van der Rijt R, Paulusma CC, van WijlandM, Markusic DM et al. Alteration of viral lipid composition by expression ofthe phospholipid floppase ABCB4 reduces HIV vector infectivity. Retrovirology2008; 5: 14.

[0189] 22. Zhou J, Wang D, Wong BH-Y, Li C, Poon VK-M, Wen L et al.Identification and characterization of GLDC as host susceptibility gene tosevere influenza. EMBO Mol Med 2019; 11: e9528.

[0190] 23. Kaiser RA, Nicolas CT, Allen KL, Chilton JA, Du Z, Hickey RD etal. Hepatotoxicity and Toxicology of In Vivo Lentiviral Vector Administrationin Healthy and Liver-Injury Mouse Models. Hum Gene Ther Clin Dev 2019; 30:57–66.

[0191] 24. Clar J, Mutel E, Gri B, Creneguy A, Stefanutti A, Gaillard S etal. Hepatic lentiviral gene transfer prevents the long-term onset of hepatictumours of glycogen storage disease type 1a in mice. Hum Mol Genet 2015; 24:2287–2296.

[0192] 25. Wong ESY, McIntyre C, Peters HL, Ranieri E, Anson DS, FletcherJM. Correction of Methylmalonic Aciduria In Vivo Using a Codon-OptimizedLentiviral Vector. Hum Gene Ther 2014; 25: 529–538.

[0193] 26. Tesh RB, Peralta PH, Johnson KM. Ecologic studies of vesicularstomatitis virus. Am J Epidemiol 1969; 90: 255–261.

[0194] 27 Wilson JM, Flotte TR. Moving Forward After Two Deaths in a GeneTherapy Trial of Myotubular Myopathy. Hum Gene Ther 2020; 31: 695-696.

[0195] 28. Henkel AS, Kavesh MH, Kriss MS, Dewey AM, Rinella ME, Green RM.Hepatic Overexpression of Abcb11 Promotes Hypercholesterolemia and Obesity inMice. Gastroenterology 2011; 141: 1404-1411.e2.

[0196] 29. Hansson MD, Rzeznicka K, Rosenbäck M, Hansson M, Sirijovski N.PCR-mediated deletion of plasmid DNA. Anal Biochem 2008; 375: 373–375.

[0197] 30. Shin AC, Fasshauer M, Filatova N, et al. Brain insulin lowerscirculating BCAA levels by inducing hepatic BCAA catabolism. Cell Metab.2014;20(5):898-909. doi:10.1016 / j.cmet.2014.09.003.

[0198] 31. Homanics GE, Skvorak K, Ferguson C, Watkins S, Paul HS.Production and characterization of murine models of classic and intermediatemaple syrup urine disease. BMC Med Genet. 2006;7:33. Published 2006 Mar 31.doi:10.1186 / 1471-2350-7-33.

[0199] 32. Silver G, Mercimek-Andrews S. Inherited Metabolic DisordersPresenting with Ataxia. Int J Mol Sci. 2020;21(15):5519. Published 2020 Aug1. doi:10.3390 / ijms21155519

[0200] 33. Smith D, Wallom KL, Williams IM, Jeyakumar M, Platt FM.Beneficial effects of anti-inflammatory therapy in a mouse model of Niemann-Pick disease type C1. Neurobiol Dis. 2009;36(2):242-251. doi:10.1016 / j.nbd.2009.07.010.

Claims

1. A retroviral vector comprising a 5' long terminal repeat (LTR), a primer binding site, a heterologous intron, a transgene insertion site, and a 3' LTR, wherein the heterologous intron is located immediately downstream of the 5' LTR.

2. The retroviral vector of claim 1, wherein the primer binding site (PBS) is located between the 5' LTR and the intron.

3. The retroviral vector of claims 1 and 2, wherein the 5' LTR comprises an HIV-1 LTR or a derivative sequence thereof.

4. The retroviral vector of claim 3, wherein the 5' LTR has the sequence of SEQ ID No. 2 or a derivative sequence thereof having at least about 40% identity thereto.

5. The retroviral vector of any of the preceding claims, wherein the 3' LTR comprises a mutated HIV-1 LTR or a derivative sequence thereof.

6. The retroviral vector of claim 5, wherein the 3' LTR has the sequence of SEQ ID No. 8 or a derivative sequence thereof having at least about 40% identity thereto.

7. The retroviral vector of claim 5, wherein the 3' LTR comprises a polyadenylation (polyA) site and / or an HIV-1 trans-acting response (TAR) hairpin site in the R domain.

8. The retroviral vector of any of the preceding claims, wherein the heterologous intron comprises a sequence of 100 to 2,000 base pairs.

9. The retroviral vector of claim 8, wherein the heterologous intron comprises an intron from the human elongation factor 1 alpha gene or an intron from the human beta-globin gene.

10. The retroviral vector of any of the preceding claims, wherein the vector further comprises an HIV-1 psi packaging sequence and a Rev response element (RRE) downstream of the 3' LTR.

11. The retroviral vector of any of the preceding claims, further comprising an expressible transgene in the transgene insertion site.

12. The retroviral vector of any of the preceding claims, wherein the vector further comprises a post-transcriptional regulatory element (PRE).

13. The retroviral vector of any of the preceding claims, wherein the PRE is located between the transgene insertion site and the 3' LTR.

14. The retroviral vector of any of the preceding claims, wherein the vector further comprises a promoter driving transcription of the vector genome.

15. The retroviral vector of any of the preceding claims, wherein the vector is derived from a lentivirus.

16. A host cell containing the vector of any of claims 1 to 15.

17. A virion containing the vector of any of claims 1 to 15.

18. The retroviral vector of any of claims 1 to 15 or the virion of claim 17 for use as a medicament.

19. The retroviral vector of any of claims 1 to 15 or the virion of claim 17 for use in the treatment of a disease in need of gene therapy.

20. A pharmaceutical composition comprising the vector of any one of claims 1 to 15 or the virion of claim 17.

21. The pharmaceutical composition of claim 20, wherein the composition is formulated for intravenous infusion.

22. The pharmaceutical composition of claim 20 or 21, wherein the composition is co-administered with an immunosuppressant.

23. The retroviral vector of any one of claims 1 to 15 or the virion of claim 17 for use in delivering a transgene to a subject with gene therapy.

24. A method of delivering a gene to a target cell, the method comprising administering to the target cell an effective amount of the vector of any one of claims 1 to 15 or the virion of claim 17, wherein the vector comprises an expressible transgene.

25. The method of claim 24, wherein the vector is co-transduced with a modified Tat plasmid to increase expression efficiency.

26. A cell produced by the method of claim 24.

27. A transgenic animal produced by the method of claim 24.

Images