Recombinant yeast engineering bacterium for secretory expression of recombinant bovine lactoferrin and construction method and application thereof

Abstract

The invention discloses a recombinant yeast engineering bacterium for secretory expression of recombinant bovine lactoferrin as well as a construction method and application of the recombinant yeast engineering bacterium, and belongs to the technical field of genetic engineering. According to the invention, a CRISPR / CAS9 gene editing technology is utilized to construct sgRNA expression vectors and bovine lactoferrin homologous recombination gene expression cassettes targeting multiple sites of yeast genomes AOX1, AOX2, FLD1, DAS1 and DAS2, and the sgRNA expression vectors and the bovine lactoferrin homologous recombination gene expression cassettes are transformed into yeast host bacteria to obtain recombinant yeast engineering bacteria with bovine lactoferrin genes inserted at multiple sites. The yield of the bovine lactoferrin of the recombinant yeast engineering bacterium is remarkably increased, heterologous secretion and efficient expression of the bovine lactoferrin in pichia pastoris are achieved, industrial production and construction of the bovine lactoferrin are promoted, and the recombinant yeast engineering bacterium has wide application value.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, and particularly relates to a recombinant yeast engineering bacterium for secreting and expressing recombinant bovine lactoferrin as well as a construction method and application thereof. BACKGROUND

[0002] Lactoferrin (LF) is a glycoprotein of about 80 kDa, belonging to the transferrin family, and is a natural non-heme iron-binding protein. It is expressed and secreted by the mucosal epithelial cells and neutrophils of mammals, and widely exists in the milk and tear, semen, sweat and other secretions of mammals. LF has multiple physiological functions, showing antibacterial, antiviral, antitumor, antioxidant and immunomodulatory activities. As a potent antibacterial agent, LF can effectively inhibit the growth of various pathogens such as gram-positive bacteria, gram-negative bacteria, fungi, HIV and parasites. In addition, LF also has anticancer and anti-inflammatory effects. The synergistic effect of LF with antibiotics and antifungal agents has been applied in clinical treatment, such as hepatitis C, cytomegalovirus infection and HIV diseases. The multiple biological functions of LF promote its wide application in cosmetics, food additives, animal production and biological medicine industries.

[0003] As early as 1939, Sorensen first discovered LF in milk and named it "hemoglobin in milk". Bovine lactoferrin (BLF) is an important active molecule in the non-immune defense system of cattle, which is composed of 703 amino acid residues and forms two basic symmetrical lobes: N-terminal lobe (N-lobe) and C-terminal lobe (C-lobe). The N-terminal lobe has antibacterial activity, and the C-terminal lobe plays a role in treating gastric diseases, diabetes and corneal damage. Commercially available BLF is mainly derived from milk, but its concentration in colostrum is only about 0.8 g / L. The LF obtained by relying on separation and purification from milk cannot meet the market demand, and the production cost is high. Therefore, it is urgent to develop an efficient LF preparation technology.

[0004] At present, the construction of recombinant microorganisms by using genetic engineering technology and the optimization of fermentation conditions have become an important way for BLF production. The Escherichia coli expression system lacks glycosylation modification mechanism, which leads to the inability to produce lactoferrin with biological activity. Pichia pastoris GS115 (Komagataella phaffii GS115) has many advantages in BLF expression: first, the commonly used methanol metabolic promoter AOX1 has high strength, and high-level protein expression can be achieved under appropriate methanol induction conditions. In addition, as a eukaryotic cell, GS115 has the ability of post-translational folding, modification and glycosylation of proteins, which is beneficial to the expression of functional proteins.

[0005] Currently, the method of expressing bovine lactoferrin in yeast relies on the classic plasmid electroporation method. In order to achieve efficient expression and enhance genetic stability, two strategies are mainly adopted: one is to construct an expression system driven by a strong promoter. The GAP promoter is a constitutive promoter, and the AOX1 promoter is a methanol-inducible promoter. The second is to select the preferred codon of GS115 through synonymous codon optimization. Therefore, promoter optimization and codon optimization can help improve the expression level of BLF in GS115; in addition, screening of recombinant strains with high copy number is also an important strategy to enhance protein expression. Gene dosage affects the expression of recombinant proteins, so screening of recombinant strains with high copy number is an effective method to improve the expression amount of BLF. The traditional method of screening high-copy recombinant bacteria relies on screening markers (such as resistance), and different copy number of recombinant strains is selected by antibiotic gradient. However, such integration sites are single. CRISPR / CAS9 gene editing technology has been used for gene editing in a variety of host cells. Compared with the classic method, CRISPR / CAS9 gene editing technology can efficiently achieve precise genome modification without introducing selection markers. Using CRISPR / Cas9-mediated homologous recombination can carry out marker-free integration of genes, and the copy number and insertion site of the bovine lactoferrin gene can be accurately controlled, thereby showing multi-site and multi-copy gene insertion.

[0006] The present application intends to develop a recombinant engineering bacteria based on CRISPR / Cas9 gene editing technology to realize the heterologous secretion and efficient expression of bovine lactoferrin in Pichia pastoris. SUMMARY

[0007] The purpose of the present application is to provide a recombinant yeast engineering bacteria for secreting and expressing recombinant bovine lactoferrin and a construction method and application thereof, so as to solve the problems existing in the prior art. The present application uses CRISPR / CAS9 gene editing technology to construct sgRNA expression vectors targeting multiple sites of yeast genome AOX1, AOX2, FLD1, DAS1 and DAS2, and bovine lactoferrin homologous recombination gene expression cassette, and transform into yeast host bacteria, to obtain a recombinant yeast engineering bacteria with multiple site insertion of bovine lactoferrin gene. The yield of bovine lactoferrin of the recombinant yeast engineering bacteria is significantly increased, realizing the heterologous secretion and efficient expression of bovine lactoferrin in Pichia pastoris, which helps to promote the industrialized production of bovine lactoferrin and has wide application value.

[0008] In order to achieve the above purpose, the present application provides the following scheme:

[0009] The application provides a method for constructing a recombinant yeast engineering bacterium for secreting and expressing recombinant bovine lactoferrin, comprising the following steps: using a CRISPR / CAS9 gene editing technology, constructing sgRNA expression vectors and bovine lactoferrin homologous recombination gene expression cassettes targeting multiple sites in a yeast genome, and transforming the sgRNA expression vectors and the bovine lactoferrin homologous recombination gene expression cassettes into a yeast host bacterium to obtain a recombinant yeast engineering bacterium with bovine lactoferrin genes inserted at multiple sites.

[0010] The multiple sites include AOX1, AOX2, FLD1, DAS1 and DAS2.

[0011] Further, the method comprises the following steps:

[0012] sgRNAs are designed for insertion sites AOX1, AOX2, FLD1, DAS1 and DAS2 in the yeast genome, and sgRNA expression vectors targeting the respective sites are constructed;

[0013] A BLF gene with a 5' end fusion OST-pro-alpha factor hybrid signal peptide coding gene is used as a template, and codon optimization is performed according to the codon bias of the yeast to obtain an OST-pro-alpha factor-BLF gene, and the nucleotide sequence of the OST-pro-alpha factor-BLF gene is shown in SEQ ID NO. 6;

[0014] Upstream and downstream homologous arm sequences of the insertion sites AOX1, AOX2, FLD1, DAS1 and DAS2 are added to the upstream and downstream of the OST-pro-alpha factor-BLF gene to obtain homologous recombination gene expression cassettes inserted at the respective sites;

[0015] The sgRNA expression vectors and the homologous recombination gene expression cassettes are transformed into a yeast host bacterium to obtain the recombinant yeast engineering bacterium.

[0016] Optionally, the yeast host bacterium comprises Pichia pastoris GS115.

[0017] Further, the sequence of the sgRNA targeting the AOX1 site is shown in SEQ ID NO. 1;

[0018] The sequence of the gRNA targeting the AOX2 site is shown in SEQ ID NO. 2;

[0019] The sequence of the gRNA targeting the FLD1 site is shown in SEQ ID NO. 3;

[0020] The sequence of the gRNA targeting the DAS1 site is shown in SEQ ID NO. 4;

[0021] The sequence of the gRNA targeting the DAS2 site is shown in SEQ ID NO. 5.

[0022] Further, the nucleotide sequence of the homologous recombination gene expression cassette inserted into the AOX1 site is shown as SEQ ID NO. 7.

[0023] The nucleotide sequence of the homologous recombination gene expression cassette inserted into the AOX2 site is shown as SEQ ID NO. 8.

[0024] The nucleotide sequence of the homologous recombination gene expression cassette inserted into the FLD1 site is shown as SEQ ID NO. 9.

[0025] The nucleotide sequence of the homologous recombination gene expression cassette inserted into the DAS1 site is shown as SEQ ID NO. 10.

[0026] The nucleotide sequence of the homologous recombination gene expression cassette inserted into the DAS2 site is shown as SEQ ID NO. 11.

[0027] The present application also provides a recombinant yeast engineering bacterium constructed by the above construction method, wherein the recombinant yeast engineering bacterium is Komagataella phaffii BS6, which is preserved in the China General Microbiological Culture Collection Center on November 7, 2024, at No. 3, Xili, Beichen West Road, Chaoyang District, Beijing, and has a preservation number of CGMCC No. 32534.

[0028] The present application also provides an application of the above recombinant yeast engineering bacterium in the production of bovine lactoferrin.

[0029] The present application also provides a method for producing recombinant bovine lactoferrin, which comprises the steps of fermenting and culturing the above recombinant yeast engineering bacterium, collecting fermentation supernatant, and purifying to obtain the recombinant bovine lactoferrin.

[0030] Further, in the process of fermentation and culture, methanol is added to induce the recombinant yeast engineering bacterium to produce recombinant bovine lactoferrin.

[0031] The present application also provides the recombinant bovine lactoferrin produced by the above method.

[0032] The present application discloses the following technical effects:

[0033] The application takes BLF gene of 5' end fusion OST-pro-alpha factor hybrid signal peptide coding gene as a template, and codes is optimized according to the codon preference of Pichia pastoris. Based on the CRISPR / CAS9 gene editing technology, the sgRNA expression vector and the homologous recombination gene expression cassette targeting multiple sites are constructed, and the recombinant yeast engineering bacteria of BLF multi-site insertion are obtained by electric shock transformation into Pichia pastoris GS115. The BLF protein secretion expression is analyzed by chromatographic column purification combined with SDS-PAGE, and the results show that the BLF realizes high-efficiency secretion expression in the recombinant yeast engineering bacteria, the shake flask fermentation yield can reach 800 mg / L, and the molecular weight is about 80 kDa, which is consistent with the theoretical molecular weight. The yield of bovine lactoferrin of the recombinant yeast engineering bacteria constructed by the application is significantly increased, the heterologous secretion high-efficiency expression of bovine lactoferrin in Pichia pastoris is realized, which helps to promote the industrialized production construction of bovine lactoferrin, and has wide application value. BRIEF DESCRIPTION OF DRAWINGS

[0034] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor.

[0035] Figure 1 A result graph of SDS-PAGE for detecting BLF secretion expression in the supernatant of fermentation liquid fermented for 96h;

[0036] Figure 2 A result graph of WB for detecting BLF secretion expression in the supernatant of fermentation liquid fermented for 96h;

[0037] Figure 3 A result graph of SDS-PAGE for detecting purified protein. DETAILED DESCRIPTION

[0038] The various exemplary embodiments of the present application will now be described in detail, which should not be considered as limiting the present application, but should be understood as a more detailed description of some aspects, characteristics and embodiments of the present application.

[0039] It should be understood that the terms described in the present application are only for describing the specific embodiments, and are not used to limit the present application. In addition, for the numerical range in the present application, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Each smaller range between any stated value or intermediate value in the stated range, and any other stated value or intermediate value in the stated range, is also included in the present application. The upper limit and the lower limit of these smaller ranges can be independently included or excluded from the range.

[0040] Unless otherwise indicated herein, all technical and scientific terms have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All publications mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. In case of conflict between the content of the specification and that of any document incorporated herein by reference, the content of the specification prevails.

[0041] Various modifications and variations of the described methods and materials of the application will be apparent to those skilled in the art from the foregoing disclosure. Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples given are exemplary only. It is to be understood that the application is not limited in scope by the specific embodiments described herein. It is expressly intended that all such modifications, alterations, and variations that fall within the scope of the claims are to be included.

[0042] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean inclusion, but not limited to, the listed materials and methods.

[0043] The sequence information and medium formula involved in the present application are as follows:

[0044] SEQ ID NO. 1: GTACTTGATCTGTAACACGA (gRNA targeting AOX1);

[0045] SEQ ID NO. 2: TCTCATCGTAGAATGAACGA (gRNA targeting AOX2);

[0046] SEQ ID NO. 3: ACGTCCCTTGATACCTCCAA (gRNA targeting FLD1);

[0047] SEQ ID NO. 4: AGAAATCATAGACCTCCTGT (gRNA targeting DAS1);

[0048] SEQ ID NO. 5: GGAACTCTTGTCCCTCACGA (gRNA targeting DAS2);

[0049] SEQ ID NO. 6 (codon-optimized OST-pro-alpha factor-BLF nucleotide sequence):

[0050]

[0051] SEQ ID NO. 7 (nucleotide sequence of the homologous recombination gene expression cassette inserted into the AOX1 site):

[0052]

[0053] SEQ ID NO. 8 (nucleotide sequence of the homologous recombination gene expression cassette inserted into the AOX2 site):

[0054]

[0055] SEQ ID NO. 9 (nucleotide sequence of the homologous recombination gene expression cassette inserted into the FLD1 site):

[0056]

[0057] SEQ ID NO. 10 (nucleotide sequence of the homologous recombination gene expression cassette inserted into the DAS1 site):

[0058]

[0059] SEQ ID NO. 11 (nucleotide sequence of the homologous recombination gene expression cassette inserted into the DAS2 site):

[0060]

[0061] BMGY medium: 1% yeast extract, 2% tryptone, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB (amino acid-free yeast nitrogen base, Yeast Nitrogen Base), 0.004% biotin and 1% glycerol.

[0062] BMMY medium: 1% yeast extract, 2% tryptone, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB (amino acid-free yeast nitrogen base, Yeast Nitrogen Base), 0.004% biotin and 0.5% methanol.

[0063] YPD liquid medium: 1% yeast extract, 2% tryptone and 2% glucose.

[0064] YPD-G418 solid medium: 1% yeast extract, 2% tryptone, 2% glucose and 250 μg / mL geneticin (G418).

[0065] Method for determining protein concentration: A 280 The concentration of protein was determined.

[0066] Example 1 Construction of gRNA expression vector targeting multiple sites in the yeast genome

[0067] 1. CHOPCHOP was used to design sgRNA, PAM was located downstream of the start codon and close to the site. Be sure to check if the final sgRNA sequence contains an unwanted Bpil site. The sequences of the 5 sgRNAs are shown in SEQ ID NO. 1 to SEQ ID NO. 5.

[0068] 2. Golden Gate assembly: the reaction system was 20 μL, and endonuclease Bpil 1 μL (10 U), T4 DNA ligase 0.1 μL (40 U), CutSmart buffer 2 μL (10x), ATP 2 μL (10 mM), sgRNA fragments and pGAP-pTEF_Cas9 vector 1 μL (40 nM) were added respectively. The reaction was carried out on a PCR instrument, 37°C for 2 min / 16°C for 2.5 min for 20 cycles→37°C for 10 min→55°C for 30 min→80°C for 10 min. Escherichia coli DH5α was transformed, and the colonies were picked for sequencing verification.

[0069] Example 2 Construction of recombinant Pichia pastoris

[0070] 1. BLF gene with 5' end fused OST-pro-αfactor hybrid signal peptide coding gene as template, codon optimization according to Pichia pastoris codon bias, OST-pro-αfactor-BLF, its nucleotide sequence is shown in SEQ ID NO. 6. The 5' and 3' ends of the optimized OST-pro-αfactor-BLF sequence are fused with the nucleotide sequences of 800 bp upstream and downstream of the insertion site (AOX1, AOX2, FLD1, DAS1 and DAS2) as homologous arms, forming a 5'-HR-OST-pro-αfactor-BLF-HR-3' linear bovine lactoferrin homologous recombination gene expression cassette, the sequence is shown in SEQ ID NO. 7 to SEQ ID NO. 11. The expression cassette is synthesized by a third party company.

[0071] 2. Refer to the "Pichia pastoris expression manual" of Invitrogen Company to prepare competent cells of Pichia pastoris GS115. All sgRNA / Cas9 plasmids (0.5-1 μg) and ≥1500 nmol homologous recombination gene expression cassette are simultaneously transferred into the competent cells.

[0072] The electroporation procedure is as follows: 80 μL of competent cells mixed with sgRNA and homologous expression cassette are taken and transferred to a 0.2 cm electroporation cup which is ice-bathed at -20°C for 5 min. Adjust the parameters of the electroporation instrument to Pichia pastoris mode, voltage 1.5 kV, capacitance 25 μF, resistance 200 Ω, and time about 5 ms. After electroporation, 1 mL of 1M sorbitol solution pre-cooled on ice is quickly added to the transformation cup, mixed gently, and the mixture is transferred to a centrifuge tube. Incubate at 30°C for 1 h, centrifuge at 3000 rpm for 5 min. Discard 800 μL of supernatant, blow evenly, and spread on YPD-G418 plates, and incubate at 30°C for 2-4 days until larger colonies grow on the plate.

[0073] 3. Pick 20 single colonies from the plate and streak twice on the selection plate.

[0074] 4. Pick the colonies into 10 μL of 0.02M NaOH, lyse at 99°C for 10 min, and after centrifugation, take 2 μL of supernatant as template for PCR. Purify the PCR product on agarose gel and sequence to confirm correct gene insertion.

[0075] 5. The correct sequencing clone is purified on a YPD plate without resistance pressure for 3 times to promote the loss of sgRNA / Cas9 plasmid, and the final correct strain is named BS6.

[0076] The positive strain BS6 was named Komagataella phaffii BS6 and preserved in the China General Microbiological Culture Collection Center (CGMCC) on November 7, 2024, at No. 1, Beichen West Road, Haidian District, Beijing, with a preservation number of CGMCC No. 32534.

[0077] Example 3 Induced expression of recombinant bovine lactoferritin

[0078] 1. The positive strain BS6 identified correctly in Example 2 was inoculated into a 50 mL centrifuge tube containing 3 mL of YPD liquid medium and cultured overnight at 30°C and 220 rpm.

[0079] 2. The next day, 1 mL of the bacterial solution in step 1 was transferred into a 250 mL conical flask containing 25 mL of BMGY medium, and cultured at 30°C and 220 rpm until the OD 600 was 5.0. The bacterial cells were collected by centrifugation at 3000 rpm for 5 min, and washed with sterile water for 3 times to remove residual glycerol, which was the seed solution.

[0080] 3. The seed solution obtained in step 2 was resuspended with 25 mL of BMMY medium and transferred into a 250 mL conical flask, and cultured at 20°C and 220 rpm for 96 h, with the addition of 0.5% methanol every 24 h to maintain induction.

[0081] 4. The fermentation supernatant after the end of the culture was collected, and the expression of the intracellular protein in the fermentation supernatant after 96 h of fermentation was detected by SDS-PAGE, and the results are shown in Figures 1-2 . The target band of BLF is located at 80 kDa, with a clear band Figure 1 , and Western blotting experiment confirmed that the position is BLF Figure 2 . This indicates that BLF has achieved secretory expression in the recombinant Pichia pastoris.

[0082] Example 4 Purification of the target protein

[0083] Centrifugation and cation exchange were used to purify the target protein. The specific steps are as follows:

[0084] 1. The BS6 fermentation broth prepared in Example 3 was centrifuged at 8000 rpm for 10 min, and the bacterial cells were discarded.

[0085] 2. The pH of the fermentation supernatant was adjusted to 7.5, and the fermentation supernatant was filtered with a 0.45 μm filter membrane.

[0086] 3. Protein purification was performed using an FPLC protein chromatography system. The specific procedure was as follows: The SPFF cation exchange column was washed sequentially with 5CV ultrapure water, 5CV buffer B (25mM Tris pH 7.5, 1M NaCl), and buffer A (25mM Tris pH 7.5, 100mM NaCl) at a flow rate of 5 mL / min. The sample was loaded onto the equilibrated SPFF column using a peristaltic pump at a flow rate of 1.6 mL / min, and flow-through was collected. The SPFF column was connected to the FPLC system, and proteins were linearly eluted (0.1-1M NaCl in 25mM Tris pH 7.5). Protein analysis was performed using SDS-PAGE, and the elution peak was collected. Dialysis was then performed (25mM Tris pH 7.5, 100mM NaCl).

[0087] Purification results are as follows Figure 3 As shown, a target band corresponding to the theoretical molecular weight of BLF was observed at 80 kDa, and the purified target protein BLF was obtained. Based on the purification results, the fermentation yield of BS6 was calculated to be 800 mg / L.

[0088] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method for constructing a recombinant yeast engineered strain that secretes and expresses recombinant bovine lactoferrin, characterized in that, The process includes using CRISPR / CAS9 gene editing technology to construct sgRNA expression vectors targeting multiple sites in the yeast genome and bovine lactoferrin homologous recombinant gene expression cassettes, and transforming them into yeast host cells to obtain recombinant yeast engineered cells with bovine lactoferrin genes inserted at multiple sites. The multiple sites include AOX1, AOX2, FLD1, DAS1, and DAS2.

2. The construction method according to claim 1, characterized in that, Includes the following steps: sgRNAs were designed targeting the AOX1, AOX2, FLD1, DAS1 and DAS2 insertion sites in the yeast genome, and expression vectors for sgRNAs targeting each site were constructed. Using the BLF gene, which encodes a heterozygous signal peptide fused to the 5′ end of OST-pro-αfactor, as a template, codon optimization was performed according to the codon preference of yeast to obtain the OST-pro-αfactor-BLF gene, the nucleotide sequence of which is shown in SEQ ID NO. 6; Homologous arm sequences of insertion sites AOX1, AOX2, FLD1, DAS1 and DAS2 were added upstream and downstream of the OST-pro-αfactor-BLF gene, respectively, to obtain homologous recombination gene expression cassettes inserted at each site. The sgRNA expression vector and the homologous recombinant gene expression cassette were transferred into a yeast host cell to obtain the recombinant yeast engineered cell.

3. The construction method according to claim 2, characterized in that, The yeast host includes Pichia pastoris GS115.

4. The construction method according to claim 3, characterized in that, The sequence of the sgRNA targeting the AOX1 site is shown in SEQ ID NO.1; The sequence of the gRNA targeting the AOX2 site is shown in SEQ ID NO.2; The sequence of the gRNA targeting the FLD1 site is shown in SEQ ID NO.3; The sequence of the gRNA targeting the DAS1 site is shown in SEQ ID NO.4; The sequence of the gRNA targeting the DAS2 site is shown in SEQ ID NO.

5.

5. The construction method according to claim 2, characterized in that, The nucleotide sequence of the homologous recombination gene expression cassette inserted at the AOX1 site is shown in SEQ ID NO.7; The nucleotide sequence of the homologous recombination gene expression cassette inserted at the AOX2 site is shown in SEQ ID NO. 8; The nucleotide sequence of the homologous recombination gene expression cassette inserted at the FLD1 site is shown in SEQ ID NO.9; The nucleotide sequence of the homologous recombination gene expression cassette inserted at the DAS1 site is shown in SEQ ID NO.10; The nucleotide sequence of the homologous recombination gene expression cassette inserted at the DAS2 site is shown in SEQ ID NO.

11.

6. A recombinant yeast strain constructed by the construction method according to any one of claims 1-5, characterized in that, The recombinant yeast strain is Pichia pastoris (Komagataella phaffii) BS6, deposited at the China General Microbiological Culture Collection Center (CGMCC) on November 7, 2024, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 32534.

7. The use of the recombinant yeast strain according to claim 6 in the production of bovine lactoferrin.

8. A method for producing recombinant bovine lactoferrin, characterized in that, The method includes the steps of fermenting and culturing the recombinant yeast engineered strain as described in claim 6, collecting the fermentation supernatant, and purifying it to obtain the recombinant bovine lactoferrin.

9. The method according to claim 8, characterized in that, During the fermentation process, methanol is added to induce the recombinant yeast engineered bacteria to produce recombinant bovine lactoferrin.

10. Recombinant bovine lactoferrin produced by the method of claim 8 or 9.

Images