Beta-1, 3-glucosidase and method for improving enzyme activity of beta-1, 3-glucosidase

Abstract

The invention relates to the technical field of thermostable enzymes, in particular to beta-1, 3-glucosidase and a method for improving the enzyme activity of the beta-1, 3-glucosidase. The beta-glucosidase encoding gene YALI1B03564g is identified in a yarrowia lipolytica genome for the first time and is named as beta-1, 3-glucosidase, and the beta-glucosidase encoding gene YALI1B03564g is confirmed to have unique beta-1, 3-glucosidic bond substrate specificity through heterologous expression and enzymatic characterization; the thermal stability of the enzyme is further remarkably improved through rational design, and the enzyme is applied to in-vitro polysaccharide degradation; the technical scheme provided by the invention further lays a foundation for large-scale production of the functional yeast beta-glucan oligosaccharide.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of thermostable enzyme, in particular to a kind of β-1,3-glucosidase and the method for improving β-1,3-glucosidase enzyme activity. BACKGROUND

[0002] Yarrowia lipolytica is a Crabtree-negative yeast (does not exhibit Crabtree effect), belongs to Saccharomycetes (SHEN X-X, STEENWYK J L, LABELLA AL, et al. Genome-scale phylogeny and contrasting modes of genome evolution in the fungal phylum Ascomycota [J]. 2020, 6(45): eabd0079) in the fungal phylum Ascomycota, and is one of the most in-depth developed non-traditional yeasts in current industrial application research. Yarrowia lipolytica has become a chassis cell for synthetic biology and green manufacturing due to its broad substrate utilization ability, high metabolic product diversity and mature gene editing system (PARK Y-K, LEDESMA-AMAROR. What makes Yarrowia lipolytica well suited for industry [J]. Trends in Biotechnology, 2023, 41(2): 242-54). The β-glucan in the cell wall of Yarrowia lipolytica accounts for 30% to 35% of the dry weight (BASTOS R, OLIVEIRAP G, GASPAR V M, et al. Brewer's yeast polysaccharides—A review of their exquisite structural features and biomedical applications [J]. Carbohydrate Polymers, 2022, 277: 118826), making it a cell factory for natural β-glucan production.

[0003] β-glucosidase (BGL, E.C. 3.2.1.21), also known as β-D-glucoside hydrolase or β-D-glucoside hydrolase, catalyzes the hydrolysis of part of the glycosidic bond in β-glucan, releasing non-reducing terminal sugar residue, glycoside and oligosaccharide (MOL PC G, JUNIOR JC Q, VERISSIMO L AA, et al. β-glucosidase: An overview on immobilization and some aspects of structure, function, applications and cost [J]. Process Biochemistry, 2023, 130: 26-39). Since industrial reactions are usually carried out at a temperature of 40-50℃ or even higher, BGL with good thermal stability is needed (PATEL A K, SINGHANIA R R, SIM S J, et al. RETRACTED: Thermostable cellulases: Current status and perspectives [J]. Bioresource Technology, 2019, 279: 385-92). However, the thermal stability of naturally occurring yeast BGL is usually 20-40℃, so protein engineering methods are often used to obtain BGL mutants with better thermal stability (SINHA S K, GOSWAMIS, DAS S, et al. Exploiting non-conserved residues to improve activity and stability of Halothermothrix orenii β-glucosidase [J]. Applied Microbiology and Biotechnology, 2017, 101(4): 1455-63). Although the value of Yarrowia lipolytica as a synthetic biology chassis cell has been fully developed, and its cell wall is rich in β-glucan (30-35% of dry weight), there is a lack of research on β-glucosidase, a key modification enzyme specific to β-1, 3-glycosidic bond of β-glucan. In addition, this enzyme is generally deficient in thermal stability, which hinders the industrial efficient degradation of β-glucan resources.

[0004] Therefore, it is still crucial to provide a technical solution that can solve the above technical problems. SUMMARY

[0005] In order to solve the above problems, the purpose of the present application is to provide a beta-1, 3-glucosidase and a method for improving the enzyme activity of the beta-1, 3-glucosidase.

[0006] The purpose of the present application can be achieved by the following technical solutions.

[0007] The first purpose of the present application is to provide a beta-1, 3-glucosidase, the nucleotide sequence of which is shown as SEQ ID NO. 1.

[0008] The second purpose of the present application is to provide a method for improving the enzyme activity of the beta-1, 3-glucosidase, comprising the following steps.

[0009] The beta-1, 3-glucosidase with the nucleotide sequence shown as SEQ ID NO. 1 is subjected to site-directed mutation, and then is transferred into a vector to obtain a mutant recombinant vector;

[0010] The mutant recombinant vector is transformed into a competent cell to construct the mutant recombinant vector, and the mutant beta-1, 3-glucosidase is induced to express and purified, so as to improve the enzyme activity of the beta-1, 3-glucosidase.

[0011] In an embodiment of the present application, the site-directed mutation comprises one or more site-directed mutations to the following sites shown as SEQ ID NO. 1, specifically as follows:

[0012] D25A, D25N, K43A, K43E, D54A, D54T, T55A, G71A, V73A.

[0013] Preferably, the site-directed mutation is a single site-directed mutation to the following sites shown as SEQ ID NO. 1, specifically as follows:

[0014] D25A, D25N, K43A, K43E, D54A, D54T, T55A, G71A, V73A.

[0015] Further preferably, the site-directed mutation is a single site-directed mutation to the following sites shown as SEQ ID NO. 1, specifically as follows:

[0016] D25A, K43A, D54A, D54T.

[0017] The third purpose of the present application is to provide a use of a beta-1, 3-glucosidase in the degradation of polysaccharides in vitro, the nucleotide sequence of the beta-1, 3-glucosidase being shown as SEQ ID NO. 1.

[0018] In one embodiment of the present application, the beta-1,3-glucosidase is used for in vitro degradation of polysaccharides after site-directed mutation;

[0019] The site-directed mutation comprises one or more site-directed mutations to the following sites as shown in SEQ ID NO. 1, specifically as follows:

[0020] D25A, D25N, K43A, K43E, D54A, D54T, T55A, G71A, V73A.

[0021] Preferably, the site-directed mutation is a single site-directed mutation to the following sites as shown in SEQ ID NO. 1, specifically as follows:

[0022] D25A, D25N, K43A, K43E, D54A, D54T, T55A, G71A, V73A.

[0023] Further preferably, the site-directed mutation is a single site-directed mutation to the following sites as shown in SEQ ID NO. 1, specifically as follows:

[0024] D25A, K43A, D54A, D54T.

[0025] In one embodiment of the present application, the polysaccharide is a polysaccharide containing beta-1,3 glycosidic bonds.

[0026] Compared with the prior art, the present application has the following beneficial effects:

[0027] The present application first identifies the beta-glucosidase encoding gene YALI1_B03564g in the genome of Yarrowia lipolytica, and names it as beta-1,3-glucosidase. Through heterologous expression and enzymatic characterization, it is confirmed that it has unique beta-1,3-glycosidic bond substrate specificity. The present application further significantly improves the thermal stability of the enzyme through rational design, and applies it to in vitro degradation of polysaccharides. The technical solution provided by the present application further lays a foundation for large-scale production of functional yeast beta-glucan oligosaccharides. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 A homology alignment map of beta-glucosidase.

[0029] Figure 2 A diagram of expression, purification and enzymatic property research results of beta-1,3-glucosidase; A is a plasmid map of E. coli heterologous expression; B is SDS-PAGE analysis of protein purification; C is the effect of temperature on enzyme activity; D is the effect of pH on enzyme activity; E is enzyme thermal stability analysis; F is enzyme kinetics analysis.

[0030] Figure 3 HPSEC profiles of different polysaccharides degraded by β-1, 3-glucosidase YLB64g; A is before degradation of Yarrowia lipolytica glucan; B is after degradation of Yarrowia lipolytica glucan; C is before degradation of Ganoderma lucidum glucan; D is after degradation of Ganoderma lucidum glucan; E is before degradation of tamarind polysaccharide; F is after degradation of tamarind polysaccharide.

[0031] Figure 4 Thermal stability profiles of β-1, 3-glucosidase and its mutants; A is the effect of temperature on the activity of β-1, 3-glucosidase and its mutants; B is the comparison of thermal stability of β-1, 3-glucosidase and its mutants. DETAILED DESCRIPTION

[0032] The present application will be described in detail below with reference to the accompanying drawings and specific examples.

[0033] In the following examples, the raw materials used are as follows:

[0034] LB medium: tryptone 10 g / L, yeast extract powder 5 g / L, NaCl 10 g / L, used for culturing Escherichia coli. Solid medium adds agar powder 20 g / L.

[0035] PBS buffer solution (10x): Na2HPO4 80 mM, NaCl 1.36 M, KH2PO4 20 mM, KCl 26 mM, pH 7.4.

[0036] NPI-5: Tris-HCl 20 mM, NaCl 500 mM, imidazole 5 mM, pH 7.5.

[0037] NPI-20: Tris-HCl 20 mM, NaCl 500 mM, imidazole 20 mM, pH 7.5.

[0038] NPI-100: Tris-HCl 20 mM, NaCl 500 mM, imidazole 100 mM, pH 7.5.

[0039] NPI-500: Tris-HCl 20 mM, NaCl 500 mM, imidazole 500 mM, pH 7.5.

[0040] Urea5, Urea20, Urea100, Urea500 are respectively NPI-5, NPI-20, NPI-100, NPI-500 added with 8M urea.

[0041] The instruments used are as follows:

[0042] Spectra Max i3x multifunctional microplate reader, ultramicro nucleic acid protein quantifier Nanodrop 2000, S1000 type PCR instrument, Power basic type electrophoresis instrument, ChemiDoc XRS+ gel imaging instrument, HPSEC-MALS multi-angle laser scattering instrument.

[0043] The preparation of the competent cells is as follows:

[0044] A single colony of E. coli DH 5α or E. coli BL21(DE3) was picked and inoculated in 4 mL of LB medium, and cultured for 12 h (37°C, 200 rpm) on a shaker. The culture was inoculated in 50 mL of LB medium at a 1% inoculation amount, and cultured on a shaker until the OD 600 was 0.4. The bacterial cells were collected by centrifugation (4°C, 4500 rpm, 10 min). The bacterial cells were washed with 0.1 mol / L CaCl2solution, and then resuspended in 1 mL of 0.1 mol / L CaCl2solution containing 15 wt% glycerol. The bacterial cells were aliquoted at 100 μL per tube and stored at -80°C for later use.

[0045] The transformation of the vector is as follows:

[0046] The competent cells were mixed with 10 μL of the ligation product and incubated on ice for 30 min. After heat shock at 42°C for 90 s, 900 μL of LB medium was added, and the mixture was cultured on a shaker for 60 min (37°C, 200 rpm). The bacterial cells were collected by centrifugation (4500 rpm, 5 min) and plated on a resistant plate, and cultured at 37°C to obtain clones. The product size was verified by PCR amplification.

[0047] The PCR amplification reaction system (25 μL) is as follows:

[0048] 12.5 μL of 2x Phanta Max Master Mix, 1 μL of primer-F, 1 μL of primer-R, 1 μL of DNA template, and ddH2O. PCR amplification procedure: 95°C for 3 min; 98°C for 10 s; Tm (primer annealing temperature) for 30 s; 72°C for 30 s / kb, for 30 cycles; 72°C for 10 min. The amplification product was verified by agarose gel electrophoresis. The target fragment with a single band was recovered according to the Axygen clean recovery kit, and the DNA concentration after recovery was determined.

[0049] The nucleotide sequence of the β-1,3-glucosidase is shown in SEQ ID NO. 1 (5'-3'), and is as follows:

[0050] ATGAAGTTCACATTTGCTGCCGTTACCGCCGCGCTGGCCTCGTCCGCCATGGCCCTCGGAGGCCTCGGAGTCGACCTCGGAGTCAAGCGAGAGTCCGACGGAGAGTGCAAGAACGCCGGCGACTACAAGGCCGATCTTGAGGCTCTCAAGGGTCTCACCGACACCATCCGAATCTACGCCGCCGGCGATTGCGACGCCCTGCGAGAGCTCGGCCCTGTTGCTGAGGCCGCTAACTTCAAGCTCATGATTGGTGTGTGGCCCAACGACGACAACCACTTTGCCTCCGAGCAGTTTGCTCTCAAGAGCTACCTGCCCTGGCTCTCCAAGTCCACCGTGCCCTACATCACCGTGGGCTCCGAGGCTCTGTACCGAAAGGACATGACTCCCCAGCAGCTGGCCGACAAGATCAACGACATCAAGAACCAGCTCAAGGGCATCAAGGACAAGAACGGCCAGACCTTTGACGTCCCCGTCGGTACCGTCGACTCCTGGAACGTGATTGTCGATGGCTACTCCAGCCCCGCCGTCAAGGCCGCCGACGTTGTCTTCGCCAACGCCTTCTCCTACTGGCAGGGACAGACCATGGCTAACGCCTCTTACTCCTTCTTCGATGACATCATGCAGGCTCTCCAGACCATCCAGACCACCAAGGGTACCACCGACATTGACTTCTGGGTTGGTGAGACCGGATGGCCCACCGATGGCGGTGCTTTCGGCGACTCTCAGCCTGGCGTGAAGCAGGCTGCTCAGTTCTGGCAGGAGGGTATCTGTGCCATCCGAGCCTGGGGTATCAACACTCTGGTTTTCGAGGCTTTCGACGAGACCTGGAAGCCCGACACTAAGGGTGACAACGGTGAGGAGGTCTCCGGCGTTGAGAAGTACTGGGGTGTTTACGACTCCAACCTCAAGCCCAAGTTCGACACCACTTGCAAGTTTGAC

[0051] In the present application, D25A represents that the 25th amino acid of the β-1, 3-glucosidase is mutated from aspartic acid to alanine, D25N represents that the 25th amino acid of the β-1, 3-glucosidase is mutated from aspartic acid to asparagine, K43A represents that the 43th amino acid of the β-1, 3-glucosidase is mutated from lysine to alanine, K43E represents that the 43th amino acid of the β-1, 3-glucosidase is mutated from lysine to glutamic acid, D54A represents that the 54th amino acid of the β-1, 3-glucosidase is mutated from aspartic acid to alanine, D54T represents that the 54th amino acid of the β-1, 3-glucosidase is mutated from aspartic acid to threonine, T55A represents that the 55th amino acid of the β-1, 3-glucosidase is mutated from threonine to alanine, G71A represents that the 71th amino acid of the β-1, 3-glucosidase is mutated from glycine to alanine, and V73A represents that the 73th amino acid of the β-1, 3-glucosidase is mutated from valine to alanine.

[0052] Unless otherwise specified, the reagents used are commercially available reagents, and the detection means and methods used are conventional detection means and methods in the art.

[0053] Example 1

[0054] The present embodiment provides a heat-resistant β-1, 3-glucosidase, which is specifically as follows:

[0055] (S1) Protein purification plasmid construction: The YALI2_B03564g gene was amplified from the Yarrowia lipolytica genome using primers 3564-F and 3564-R, and the correct band was verified by agarose gel electrophoresis and then purified and recovered. The target gene and pET-28a(+) plasmid were digested with restriction enzymes BamH I and EcoR I to obtain a linear vector. After the target gene and the linearized vector were connected by seamless cloning, the product was transformed into E. coli DH5α competent cells (The PCR-amplified target fragment and linearized vector were recovered by a gel recovery kit, and the DNA concentration after recovery was determined by a super-micro nucleic acid protein quantifier Nanodrop 2000. The connection was completed according to the steps of Clon Express II one-step cloning kit, the molar ratio of the vector and the target fragment was 1:2, and the 10 μL reaction system included 0.4 pmol of the target fragment, 0.2 pmol of the vector fragment, 2 μL of 5×CE II Buffer, 1 μL of Exnase, and ddH2O). The resistant screening plasmid pET28a-3564( Figure 2 A, also known as "pET-28a(+)-YALI2_B03564g"). It was introduced into E. coli BL21(DE3) competent cells, and a heterologous expression strain was obtained by resistant screening.

[0056] The sequence of primer 3564-F is shown in SEQ ID NO.2 (5'-3'):

[0057] TGGACAGCAAATGGGTCGCGGATCCATGAAGTTCACATTTGCTGCCG;

[0058] The sequence of primer 3564-R is shown in SEQ ID NO.3 (5'-3'):

[0059] CAAGCTTGTCGACGGAGCTCGAATTCGTCAAACTTGCAAGTGGTGTCG;

[0060] (S2) Protein Expression and Purification: The plasmid pET-28a(+)-3564 obtained in step (S1) was transformed into Escherichia coli BL21(DE3) competent cells. Correct single colonies were picked and activated in 4 mL of LB medium for 12 h. The colonies were then inoculated into LB liquid medium at a ratio of 3% and cultured at 37°C on a shaker until OD... 600 Approximately 0.6, add IPTG to a final concentration of 0.5 mmol / L, and induce at 20℃ for 8 h to obtain the original bacterial culture. Centrifuge the original bacterial culture (4℃, 8000 rpm, 10 min) to collect the bacterial cells, wash twice with PBS buffer and resuspend, then sonicate on ice (800W, 5 s operation, 5 s pause); centrifuge (4℃, 8000 rpm, 10 min) to separate the precipitate and supernatant. Take the original bacterial culture, the sonicated supernatant and the precipitate (PBS resuspended), respectively, treat with protein loading buffer (purchased from Beijing TransGen Biotech Co., Ltd.), and observe protein expression by 12.5% ​​SDS-PAGE.

[0061] Take Ni 2+ - Pack the affinity chromatography column with NTA agarose and equilibrate with 5 volumes of NPI-5 buffer. 2+ Column. The supernatant after disruption was filtered through a 0.45 μm needle filter and loaded onto the column at a flow rate of 10 column volumes / h. Impurities were eluted sequentially with 5 column volumes of NPI-20 and NPI-100, followed by 10 column volumes of NPI-500, and the target protein (named "β-1,3-glucosidase") was collected. The protein was concentrated by ultrafiltration and centrifugation (10 kDa, 4°C, 5000 g). The precipitate was resuspended in Urea5 and purified using the above method (with buffer replaced by Urea series). The purified precipitate was then renatured by dialysis (4°C, 8–14 kDa).

[0062] 1) Homology comparison identification of the β-1,3-glucosidase gene in Yersinia lipolytica.

[0063] No β-1,3-glucosidase involved in β-glucan modification has been reported in *Yarrowia lipolytica*. Using the protein sequence of β-1,3-glucosidase BGL2 (NCBI accession number: NC_001139.9) from *Saccharomyces cerevisiae* as a template, homology comparison of *Yarrowia lipolytica* genome data using BLAST revealed that YALI1_B03564g (NCBI accession number: NC_090771.1; abbreviated as YLB64g) in *Yarrowia lipolytica* is a possible β-1,3-glucosidase. Phylogenetic analysis showed that YLB64g shares only 57% homology with *Saccharomyces cerevisiae* BGL2. Figure 1 ).

[0064] 2) Biochemical characterization of β-1,3-glucosidase

[0065] Single colonies of the heterologous expression strains obtained above were picked and placed in LB medium. IPTG was used to induce protein expression and purify the β-1,3-glucosidase YLB64g protein. Figure 2 B), the protein concentration obtained after concentration is 0.55 g / L.

[0066] (S3) In vitro enzyme activity detection

[0067] Preparation of reaction system: Enzyme activity was determined using p-nitrophenyl-β-D-glucopyranoside (pNPG) as a substrate.

[0068] The reaction system consisted of 100 μL of 50 mM citrate buffer, 50 μL of 5 mM pNPG, and 50 μL of enzyme solution, for a total volume of 200 μL. Before starting the reaction, the reaction mixture without enzyme solution was mixed thoroughly (adjusting the pH to 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, and 7.5, respectively), and preheated for 2 min at different reaction temperatures (20℃, 25℃, 30℃, 35℃, 40℃, 45℃, 50℃, 55℃, and 60℃, respectively). Timing was started from the addition of enzyme solution, and the reaction was accurately carried out for 20 min. At the end of the timing, 50 μL of 1 M Na2CO3 was added to terminate the enzyme reaction. Then, 200 μL of the reaction mixture was added to an ELISA plate, and the absorbance was read at a wavelength of 405 nm. A sample using the optimal buffer instead of the diluted enzyme solution was used as a blank control. The resulting absorbance values ​​were then compared with the pre-prepared p-nitrophenol (pNP) standard curve (y = 6.2371x + 0.0474, R0). 2 =0.9988) and calculate the amount of product generated.

[0069] This enzyme degrades colorless pNPG and produces yellow pNP. Definition of enzyme activity unit (U): In this study, one enzyme activity unit is defined as the amount of enzyme required to produce 1 μmol of pNP or glucose per minute under optimal reaction conditions.

[0070] In vitro enzyme activity assays using pNPG as a substrate showed that the optimal reaction conditions for YLB64g were 35℃. Figure 2 C) and pH 5.5 Figure 2 D), enzyme activity reached 0.22 U·mL⁻¹, enzyme kinetic characteristics K m and V m 5.96 mmol·L -1 and 3.86 μmol·min -1 ·mg -1 ( Figure 2 E). Experiments showed that after incubation at 35°C for 2 hours, the remaining enzyme activity was less than 25% of the initial activity. Figure 2 F) indicates that the thermal stability of YLB64g is generally poor.

[0071] (S4) In vitro degraded polysaccharides

[0072] At the optimal temperature (35℃) and pH (5.5), Yersinia lipolytica β-glucan (mainly β-1,3 glycosidic bonds), Ganoderma lucidum β-glucan (mainly β-1,3 glycosidic bonds), and Tamarind polysaccharide (β-1,4 glycosidic bonds) were used as substrates. After reacting at the optimal temperature for 12 h, the reaction products were analyzed using a multi-angle laser light scattering spectrometer (HPSEC-MALS) to investigate the enzyme's ability to degrade glycosides.

[0073] The results are shown in Table 1. YLB64g can efficiently hydrolyze Yersinia lipolytica glucan, with a molecular weight ranging from 1.6 × 10⁻⁶. 5 Da( Figure 3 A) Significantly reduced to 7.21 × 10 3 Da( Figure 3 B); Simultaneously, it also showed significant degradation of Ganoderma lucidum glucan, with its molecular weight decreasing from 2.51 × 10⁻⁶. 5 Da( Figure 3 C) Significantly decreased to 5.97 × 10 3 Da( Figure 3 D). Therefore, this enzyme can effectively degrade β-glucan with β-1,3 glycosidic bonds, but cannot degrade tamarind polysaccharides mainly composed of β-1,4 glycosidic bonds. Figure 3 E, F).

[0074] Table 1. Molecular weight changes of polysaccharides degraded by β-1,3-glucosidase.

[0075]

[0076] (S6) Site-directed mutagenesis

[0077] To enhance the thermostability of β-1,3-glucosidase YLB64g, three protein design platforms—FireProt (https: / / loschmidt.chemi.muni.cz / fireprotweb / ), PROSS (https: / / www.fleishmanlab.org / ), and B-FITTER software (REETZ MT, CARBALLEIRA JD. Iterative saturation mutagenesis (ISM) for rapid directed evolution of functional enzymes[J]. Nature Protocols, 2007, 2(4): 891-903)—were used to predict the thermostability of the YLB64g amino acid sequence, identifying a total of 116 potential beneficial mutation sites. Sites with high cross-validation rates were screened using set theory and Boolean algebra, ultimately selecting nine candidate sites for experimental validation: D25A, D25N, K43A, K43E, D54A, D54T, T55A, G71A, and V73A. The full-length plasmid was amplified at the target site using primers with the corresponding mutant codons by polymerase chain reaction (PCR), and then transformed into E. coli BL21(DE3) cells to construct all single-point mutants. The proteins were induced to express and purified, and the thermostability of the mutants was tested.

[0078] Enzyme activity and thermostability were used as indicators for evaluation. At 45℃, the enzyme activity of the YLB64g-D54A mutant showed a significant difference compared to the wild type (YLB64g). Figure 4 A) The enzyme activities of the mutants were increased by 23% and 21%, respectively, while the enzyme activities of the other mutants were not significantly increased. Further evaluation of the thermostability of the mutants at 45℃ showed that the YLB64g-D54A and YLB64g-D25A mutants exhibited significantly improved thermostability, with stability increased by 50% and 43% respectively compared to the wild type. Figure 4 B).

[0079] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the interpretation of the present invention, without departing from the scope of the invention, should be within the protection scope of the present invention.

Claims

1. A β-1,3-glucosidase, characterized in that, The nucleotide sequence of the β-1,3-glucosidase is shown in SEQ ID NO.

1.

2. A method for increasing the activity of β-1,3-glucosidase, characterized in that, Includes the following steps: The β-1,3-glucosidase nucleotide sequence shown in SEQ ID NO.1 was subjected to site-directed mutagenesis and then transferred into a vector to obtain a mutant recombinant vector; The mutant recombinant vector was transformed into competent cells to construct the mutant recombinant vector. The mutant β-1,3-glucosidase was induced to express and purified, thereby increasing the enzyme activity of β-1,3-glucosidase.

3. The method for increasing β-1,3-glucosidase activity according to claim 2, characterized in that, The site-directed mutagenesis includes performing one or more site-directed mutagenesis at the following sites as shown in SEQ ID NO.1, specifically as follows: D25A, D25N, K43A, K43E, D54A, D54T, T55A, G71A, V73A.

4. The method for increasing β-1,3-glucosidase activity according to claim 3, characterized in that, The site-directed mutagenesis refers to a single-site site-directed mutagenesis at the following sites as shown in SEQ ID NO.1, specifically as follows: D25A, D25N, K43A, K43E, D54A, D54T, T55A, G71A, V73A.

5. The method for increasing β-1,3-glucosidase activity according to claim 4, characterized in that, The site-directed mutagenesis refers to a single-site site-directed mutagenesis at the following sites as shown in SEQ ID NO.1, specifically as follows: D25A, K43A, D54A, D54T.

6. The application of a β-1,3-glucosidase in the in vitro degradation of polysaccharides, characterized in that, The nucleotide sequence of the β-1,3-glucosidase is shown in SEQ ID NO.

1.

7. The application of the β-1,3-glucosidase according to claim 6 in the in vitro degradation of polysaccharides, characterized in that, β-1,3-glucosidase was site-directedly mutated and used for in vitro degradation of polysaccharides. The site-directed mutagenesis includes performing one or more site-directed mutagenesis at the following sites as shown in SEQ ID NO.1, specifically as follows: D25A, D25N, K43A, K43E, D54A, D54T, T55A, G71A, V73A.

8. The application of the β-1,3-glucosidase according to claim 7 in the in vitro degradation of polysaccharides, characterized in that, The site-directed mutagenesis refers to a single-site site-directed mutagenesis at the following sites as shown in SEQ ID NO.1, specifically as follows: D25A, D25N, K43A, K43E, D54A, D54T, T55A, G71A, V73A.

9. The application of the β-1,3-glucosidase according to claim 7 in the in vitro degradation of polysaccharides, characterized in that, The site-directed mutagenesis refers to a single-site site-directed mutagenesis at the following sites as shown in SEQ ID NO.1, specifically as follows: D25A, K43A, D54A, D54T.

10. The application of the β-1,3-glucosidase according to claim 6 in the in vitro degradation of polysaccharides, characterized in that, The polysaccharide is a polysaccharide containing β-1,3 glycosidic bonds.

Images