Primer probe combination for detecting wheat and peanut allergens based on dual Proofman-LMTIA technology and application of primer probe combination

Abstract

The invention discloses a primer probe combination for detecting wheat and peanut allergens based on a dual Proofman-LMTIA technology and application of the primer probe combination, and belongs to the technical field of molecular detection. The primer probe combination comprises an XM-F1, an XM-B1, an XM-LB1, an HS-F2, an HS-B2, an HS-LB2, an XM-Probe1 and an HS-Probe2 which are as shown in SEQ ID NO. 1 to 8. The invention further discloses a kit for detecting the content of the XM-B1 in the kit. On the basis of a Proofman-LMTIA technology, specific primers and probes for wheat and peanut allergens are designed, a rapid detection method for wheat allergen gamma-gliadin and peanut allergen Arah 2.01 protein is established, and the method is used for detecting whether the wheat and peanut allergens are mixed in the links of production, processing and circulation of processed food. And technical support is provided for improving effective supervision of food supervision departments on allergen-containing products.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular detection technology, and particularly relates to a primer probe combination for detecting wheat and peanut allergens based on double Proofman-LMTIA technology and application thereof. BACKGROUND

[0002] Wheat (Triticum aestivum L.) and peanut (Arachis hypogaea L.) are widely used crops around the world, which can provide high-quality protein and carbohydrates and are widely used in various processed foods. The Food and Agriculture Organization (FAO) and the World Health Organization (WHO) have listed peanut and wheat as one of the eight major food allergen categories. It is reported that the lifetime prevalence of wheat allergy is about 1.6%, and the prevalence of preschool children aged 2-5 years is the highest. About 1-2% of the world's population is allergic to peanuts, and has increased several times in the past decade. Food allergy can cause clinical symptoms such as respiratory difficulty, diarrhea, asthma, dermatitis, anaphylactic shock, and even life-threatening in extreme cases.

[0003] Peanut has 32 different proteins, of which 17 are identified as potential allergenic proteins. Arah2 is identified as the main allergen of peanut allergy, which has two subtypes of Arah2.01 and Arah 2.02, of which Arah 2.01 is more common, and more than 90% of allergic patients can detect this type of allergen in the body. Wheat contains 28 allergens, which can be divided into 9 food-derived allergens and 19 inhaled allergens, of which γ-zein is one of the main allergenic proteins. For allergic people, the most effective prevention method is to strictly avoid eating foods containing allergens. Therefore, it is of great significance to develop an allergen detection technology with high specificity and high sensitivity.

[0004] Current allergen detection methods can be mainly divided into two categories: one is to directly detect allergenic proteins, and the other focuses on detecting specific DNA fragments of genes or species that encode allergenic proteins.

[0005] Immunological methods rely on the specific binding of antigens and antibodies to directly detect allergenic proteins, and common methods include enzyme-linked immunosorbent assay (ELISA), lateral flow immunoassay (LFIA), and Western blotting. Mass spectrometry (MS) technology can effectively detect allergens by accurately identifying characteristic peptide sequences, also with high sensitivity and high specificity. However, heat treatment and high-pressure treatment during food processing can cause protein denaturation, thereby reducing the detection sensitivity; in addition, mass spectrometry technology also relies on expensive instruments and equipment, complex operation procedures, and professional data analysis.

[0006] Compared to proteins, DNA exhibits stronger heat resistance and high-pressure stability. DNA-based detection methods include polymerase chain reaction (PCR), quantitative real-time PCR (qPCR), loop-mediated isothermal amplification (LAMP), and high-resolution melting curve analysis (HRM). Furthermore, the LAMP method has become a standardized allergen detection method for import and export inspection and quarantine. However, traditional DNA detection techniques rely on electrophoresis to interpret results, failing to meet the needs of rapid on-site testing; and the LAMP method is prone to false positives, severely impacting the validity of results. Moreover, current methods for detecting the wheat allergen γ-gliadin have low sensitivity, and methods for detecting the peanut allergen Arah 2.01 protein are relatively rare. Therefore, there is still a need to develop rapid, economical, easy-to-use, and efficient allergen detection methods. Summary of the Invention

[0007] The purpose of this invention is to provide a primer-probe combination for detecting wheat and peanut allergens based on dual Proofman-LMTIA technology and its application, thereby addressing the problems existing in the prior art. Based on Proofman-LMTIA technology, this invention designs specific primers and probes for wheat and peanut allergens, and establishes a rapid detection method for wheat allergen γ-gliadin and peanut allergen Arah 2.01 protein. This provides technical support for detecting whether processed foods are contaminated with wheat and peanut allergens during production, processing, and distribution, improving the effective supervision of allergen-containing products by food regulatory authorities, preventing consumers from consuming allergenic foods, and protecting the physical and mental health of allergy sufferers.

[0008] To achieve the above objectives, the present invention provides the following solution:

[0009] This invention provides a primer-probe combination for detecting wheat and peanut allergens based on dual Proofman-LMTIA technology, comprising XM-F1 as shown in SEQ ID NO.1, XM-B1 as shown in SEQ ID NO.2, XM-LB1 as shown in SEQ ID NO.3, HS-F2 as shown in SEQ ID NO.4, HS-B2 as shown in SEQ ID NO.5, HS-LB2 as shown in SEQ ID NO.6, XM-Probe1 as shown in SEQ ID NO.7, and HS-Probe2 as shown in SEQ ID NO.8;

[0010] The XM-Probe1 and HS-Probe2 are connected to different fluorescent groups.

[0011] The present invention also provides the application of the above primer-probe combination in the preparation of reagents or kits for detecting wheat allergens and peanut allergens.

[0012] The present invention also provides a kit for detecting wheat allergens and peanut allergens based on dual Proofman-LMTIA technology, wherein the kit contains the above-mentioned primer-probe combination.

[0013] This invention also provides a method for detecting wheat allergens and peanut allergens, comprising the following steps:

[0014] Genomic DNA was extracted from the sample to be tested; using the genomic DNA as a template, an amplification reaction was performed using the above-mentioned kit, and the fluorescence signal and amplification curve were observed;

[0015] If there is a fluorescence signal and amplification curve with the same color as the fluorescent group connected to XM-Probe1, it indicates that the sample to be tested contains wheat allergen; if there is a fluorescence signal and amplification curve with the same color as the fluorescent group connected to HS-Probe2, it indicates that the sample to be tested contains peanut allergen.

[0016] The wheat allergen is γ-gliadin; the peanut allergen is Arah 2.01 protein.

[0017] Further, the amplification reaction system consists of: 5 μL of 2×Mix premix, 0.4 μL of DNA polymerase, 0.16 μL of XM-F1, 0.16 μL of XM-B1, 0.16 μL of HS-F2, 0.16 μL of HS-B2, 0.04 μL of XM-LB1, 0.04 μL of HS-LB2, 0.4 μL of XM-Probe1, 0.4 μL of XM-Probe2, 2 μL of genomic DNA, and DEPC-treated water to a final volume of 10 μL.

[0018] Furthermore, the concentrations of XM-F1, XM-B1, XM-LB1, HS-F2, HS-B2 and HS-LB2 are all 100 μM, and the concentrations of XM-Probe1 and HS-Probe2 are both 10 μM.

[0019] Furthermore, the composition of the 2×Mix premix is: 40 mM Tris-HCl, 20 mM KCl, 20 mM (NH4)2SO4, 12 mM MgSO4, 0.2% Triton X-100, and 2.4 mM dNTP.

[0020] Furthermore, the amplification reaction was carried out at a temperature of 61°C for 40 minutes.

[0021] The present invention also provides the application of the above primer-probe combination or the above kit in the detection of wheat allergens and / or peanut allergens in food.

[0022] The present invention discloses the following technical effects:

[0023] This invention establishes a primer-probe combination for detecting wheat and peanut allergens based on Proofman-LMTIA technology and its application. Based on the sequence characteristics of the wheat GAG56D gene and the peanut Arah 2.01 gene, this invention targets the wheat allergen γ-gliadin and the peanut allergen Arah 2.01 protein. Through carefully designed LMTIA primers and Proofman probes, combined with dual Proofman-LMTIA technology, rapid amplification reactions are achieved under isothermal conditions. This method eliminates the reliance on thermal cyclers, reduces the likelihood of false positives, and balances high sensitivity and specificity, showing broad application prospects. This invention not only effectively detects whether wheat and peanut allergens are mixed into processed foods during production, processing, and distribution, but also greatly simplifies the detection process, reduces costs, and shortens detection time. It helps improve the effective supervision of allergen-containing products by food regulatory authorities, prevents consumers from consuming allergenic foods, and protects the physical and mental health of allergy sufferers. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0025] Figure 1 This is a melting temperature curve of the wheat allergen LMTIA detection target sequence in Example 1 of the present invention;

[0026] Figure 2 This is a melting temperature curve of the target sequence for peanut allergen LMTIA detection in Example 1 of the present invention;

[0027] Figure 3 The temperature optimization results are shown in Example 2 of this invention for the dual Proofman-LMTIA detection method for wheat and peanut allergens.

[0028] Figure 4 This is the specificity test result of the dual Proofman-LMTIA detection method for wheat and peanut allergens in Example 3 of the present invention;

[0029] Figure 5 The results are the repeatability test results of the dual Proofman-LMTIA detection method for wheat and peanut allergens in Example 4 of this invention.

[0030] Figure 6The sensitivity test results of the dual Proofman-LMTIA detection method for wheat and peanut allergens in Example 5 of this invention are shown.

[0031] Figure 7 The detection limit test results are for the dual Proofman-LMTIA detection method for wheat and peanut allergens in Example 6 of this invention.

[0032] Figure 8 The results of the dual Proofman-LMTIA detection method for wheat and peanut allergens in Example 7 of this invention are shown on actual samples. Detailed Implementation

[0033] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0034] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0035] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0036] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0037] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0038] The technical concept of this invention is as follows:

[0039] To address the shortcomings of existing technologies regarding the low sensitivity of wheat allergen γ-gliadin and the limited availability of detection techniques for peanut allergen Arah 2.01 subtype protein, this invention proposes a rapid detection method for wheat allergen γ-gliadin and peanut allergen Arah 2.01 protein based on dual Proofman-LMTIA technology. This invention utilizes the sequence characteristics of the wheat GAG56D gene and the peanut Arah 2.01 gene to target wheat and peanut allergens. Through carefully designed LMTIA primers and Proofman probes, combined with dual Proofman-LMTIA technology, a rapid amplification reaction is performed under isothermal conditions. Compared with traditional gene detection methods, this method eliminates the reliance on thermal cyclers, reduces the likelihood of false positives, and balances high sensitivity and specificity, showing broad application prospects. Furthermore, it helps improve the effective supervision of allergen-containing products by food regulatory authorities, preventing consumers from consuming allergenic foods and protecting the physical and mental health of allergy sufferers.

[0040] Unless otherwise specified, other reagents or materials involved in the following embodiments of the present invention can be purchased through conventional channels; unless otherwise specified, the operation methods or detection methods involved are performed in accordance with conventional methods in the art; all primers were synthesized by Shanghai Jierui Biotechnology Co., Ltd.

[0041] Example 1: Design of primers and probes for detecting wheat and peanut allergens

[0042] The peanut Arah 2.01 gene and wheat GAG56D gene sequences were obtained from the GenBank database of the National Center for Biotechnology Information (NCBI). Subsequently, Oligo 7 software was used to locate regions with trapezoidal or semi-trapezoidal melting temperatures (Tm) for the wheat and peanut allergen genes (see...). Figure 1 and Figure 2 Following the principles of LMTIA primer design, LMTIA primers and Proofman probes were designed using the online PCR primer design software Primer 3 Plus (http: / / www.primer3plus.com). After multiple rounds of screening and optimization, the following primer set was obtained, with the specific sequences as follows:

[0043] XM-F1: 5'-CTTTGTGGCCAGATTTTTTTGGTGTCATCCCTCTGGTCA -3', SEQ ID NO.1;

[0044] XM-B1: 5'-TCTGGCCACAAAGCGTTTTCTGTGCTAGTTGTTGGCAGC -3', SEQ ID NO2;

[0045] XM-LB1: 5'-ATTGCCAAGTGATGC-3', SEQ ID NO.3;

[0046] HS-F2: 5'- CCGTTCATATGAATCTTTTCCCTGCGAGCAACATCTCAT -3', SEQ ID NO.4;

[0047] HS-B2: 5'-ATATGAACGGGACTTTTGATCCTGACTAGGGCTGTACGG -3', SEQ ID NO.5;

[0048] HS-LB2: 5'-CTCGTGACGAGGATTC-3', SEQ ID NO.6;

[0049] XM-Probe1: 5'-BHQ2-TGTAGTGAACCGTTA-JOE-3', SEQ ID NO.7;

[0050] HS-Probe2: 5'-BHQ2-GTGACGAGGATTT-CY5-3', SEQ ID NO. 8.

[0051] Example 2 Temperature Optimization of Dual Proofman-LMTIA Detection Method for Wheat and Peanut Allergens

[0052] Take 50 g of dried wheat and 50 g of peanuts respectively, and grind them into powder using a grinder. Weigh 100 mg of the sample and extract genomic DNA using a high-performance plant genomic DNA extraction kit (DP350, Tiangen Biotech Beijing Co., Ltd.). After extraction, determine the concentration and purity of the genomic DNA using a Nanodrop One (Thermo Fisher Scientific, USA) analyzer. 260 / A 280 Genomic DNA with a size of 1.6–2.0 can be used for further testing. The extracted genomic DNA should be stored at -20°C for later use.

[0053] DEPC-treated water was used as a negative control, and wheat and peanut genomic DNA were used as positive controls. In a clean bench, add the following reaction mixture to a 100 μL PCR tube: 5 μL of 2×Mix premix (40 mM Tris-HCl, 20 mM KCl, 20 mM (NH4)2SO4, 12 mM MgSO4, 0.2% Triton X-100, 2.4 mM dNTPs), 0.4 μL of DNA polymerase (2 U / μL, Anhui Global Gene Technology Co., Ltd.), 0.16 μL of primers XM-F1 and XM-B1 (100 μmol / L), 0.16 μL of primers HS-F2 and HS-B2 (100 μmol / L), 0.04 μL of loop primers XM-LB1 and HS-LB2 (100 μmol / L), 0.4 μL of Proofman probes XM-Probe1 and XM-Probe2 (10 μmol / L), 2 1.08 μL of positive control (wheat or peanut genomic DNA) or negative control (DEPC-treated water) and 1.08 μL of DEPC-treated water were used. Detection was performed using a Gentier 96E fully automated medical PCR analysis system. The reaction temperatures were set to 60℃, 61℃, 62℃, and 63℃, with 30 cycles. Fluorescence signals were collected every 1 min for a total of 30 collections. Each experiment was performed in duplicate. The results were statistically analyzed and observed using the Gentier 96E fully automated medical PCR analysis system software.

[0054] If fluorescence signals are detected in the green fluorescence channel (JOE) and the red fluorescence channel (CY5), and an exponential amplification curve appears in the amplification result graph, the sample can be determined to be a positive result. Green fluorescence represents wheat allergens, and red fluorescence represents peanut allergens. If no fluorescence signals are detected in the green fluorescence channel (JOE) and the red fluorescence channel (CY5), and no exponential amplification curve appears in the amplification result graph, the sample can be determined to be a negative result.

[0055] The results are as follows Figure 3 As shown, at reaction temperatures of 60℃-63℃, no amplification was observed in DEPC-treated water, while all samples of wheat and peanut genomic DNA were amplified. The amplification efficiency at reaction temperatures of 61℃ and 62℃ was higher than that at 60℃ and 63℃. At a reaction temperature of 62℃, no amplification was observed in DEPC-treated water, but amplification was observed in both wheat and peanut genomic DNA samples, indicating high amplification efficiency but poor stability. The reaction efficiency was highest at 61℃, and the amplification of wheat and peanut genomic DNA was very stable. Therefore, 61℃ was selected as the optimal reaction temperature for the dual Proofman-LMTIA reaction of wheat and peanut allergens.

[0056] Example 3: Specificity test of the dual Proofman-LMTIA detection method for wheat and peanut allergens.

[0057] Genomic DNA from wheat, peanut, soybean, walnut, sesame, cashew, and almond was prepared according to the method in Example 2. Genomic DNA from soybean, walnut, sesame, cashew, and almond, along with DEPC-treated water, served as negative controls, while genomic DNA from wheat and peanut served as positive controls. Experiments were conducted using the reaction system established in Example 2. Detection was performed using a Gentier 96E fully automated medical PCR analysis system. The reaction temperature was set to 61°C, and fluorescence signals were collected every 1 minute for a total of 30 collections. Each experiment was repeated twice, and the results were statistically analyzed and observed using the Gentier 96E fully automated medical PCR analysis system software.

[0058] The results are as follows Figure 4 As shown, observations using the JOE and CY5 fluorescence channels revealed no amplification in soybean, walnut, sesame, cashew, almond, and DEPC-treated water, while the positive controls wheat and peanut showed good amplification of genomic DNA. No amplification was observed in peanuts using the JOE fluorescence channel, and no amplification was observed in wheat using the CY5 fluorescence channel, indicating that the dual Proofman-LMTIA detection method established in this invention has high specificity for wheat and peanut allergens.

[0059] Example 4: Repeatability test of the dual Proofman-LMTIA detection method for wheat and peanut allergens

[0060] DEPC-treated water was used as a negative control, and wheat and peanut genomic DNA were used as positive controls. Experiments were conducted according to the reaction system established in Example 2. A Gentier 96E fully automated medical PCR analysis system was used for detection. The reaction temperature was set to 61°C, and fluorescence signals were collected every 1 minute for a total of 30 collections. Each experiment was performed in eight replicates, and each group of experiments was repeated three times. The results were statistically analyzed and observed using the Gentier 96E fully automated medical PCR analysis system software.

[0061] The results are as follows Figure 5 As shown, the LMTIA reaction exhibited an amplification curve only when positive control wheat or peanut genomic DNA was added, and the amplification curve showed good repeatability and high stability. This demonstrates that the dual Proofman-LMTIA detection method established in this invention has good repeatability and high stability.

[0062] Example 5 Sensitivity Test of Dual Proofman-LMTIA Detection Method for Wheat and Peanut Allergens

[0063] Wheat and peanut genomic DNA were diluted to 1 ng / μL, 500 pg / μL, 100 pg / μL, 50 pg / μL, 10 pg / μL, and 5 pg / μL, respectively, as positive controls; DEPC-treated water was used as a negative control. Experiments were conducted according to the reaction system established in Example 2. Detection was performed using a Gentier 96E fully automated medical PCR analysis system. The reaction temperature was set to 61℃, and fluorescence signals were collected every 1 min for a total of 40 collections. Each experiment was performed in duplicate, and each group of experiments was repeated three times. The test results were statistically analyzed and observed using the Gentier 96E fully automated medical PCR analysis system software.

[0064] The results are as follows Figure 6 As shown, observations using the JOE and CY5 fluorescence channels revealed good amplification of wheat and peanut genomic DNA at concentrations of 1 ng / μL, 500 pg / μL, 100 pg / μL, 50 pg / μL, 10 pg / μL, and 5 pg / μL, respectively, while DEPC-treated water showed no amplification. Therefore, the sensitivity of this method is 5 pg / μL of wheat and peanut genomic DNA. This indicates that the dual Proofman-LMTIA detection method established in this invention can detect wheat and peanut genomic DNA extracted from samples at concentrations as low as 5 pg / μL, demonstrating high sensitivity.

[0065] Example 6: Detection Limit Test of Dual Proofman-LMTIA Detection Method for Wheat and Peanut Allergens

[0066] Wheat and peanut powders were mixed to obtain mixed powder XM with wheat powder mass fractions of 1%, 5%, 10%, 15%, 25%, 50%, 70%, 95%, and 99%, respectively. Genomic DNA was extracted from XM using the method described in Example 2. Similarly, wheat and peanut powders were mixed to obtain mixed powder HS with peanut powder mass fractions of 1%, 5%, 10%, 15%, 25%, 50%, 70%, 95%, and 99%, respectively. Genomic DNA was extracted from HS using the method described in Example 2. Genomic DNA from the two mixed powders was used as a positive control, and DEPC-treated water was used as a negative control. Experiments were conducted according to the reaction system established in Example 2. A Gentier 96E fully automated medical PCR analysis system was used for detection. The reaction temperature was set to 61°C, and fluorescence signals were collected every 1 minute for a total of 40 collections. Each experiment was performed in duplicate, and each experiment was repeated three times. The results were statistically analyzed and observed using the Gentier 96E fully automated medical PCR analysis system software.

[0067] The results are as follows Figure 7As shown, observations using the JOE and CY5 fluorescence channels revealed good amplification of wheat or peanut genomic DNA at concentrations of 1%, 5%, 10%, 15%, 25%, 50%, 70%, 95%, and 99%, respectively, while DEPC-treated water showed no amplification. Therefore, the detection limit of this method is 1% wheat or peanut genomic DNA. This indicates that the dual Proofman-LMTIA detection method established in this invention can detect wheat or peanuts in a mixed sample at a concentration of 1%.

[0068] Example 7: Actual Sample Testing

[0069] Foods containing wheat or peanut allergens, including quinoa, instant oatmeal, nut bread, soda crackers, dried peanuts, peanut brittle, coated peanuts, and peanut butter, were purchased from the Xingmen Supermarket of Xuchang University. Genomic DNA was extracted according to the method in Example 2, and experiments were conducted using the reaction system established in Example 2. A Gentier 96E fully automated medical PCR analysis system was used for detection. The reaction temperature was set to 61℃, and fluorescence signals were collected every 1 minute for a total of 40 collections. Each reaction was performed in duplicate. The test results were statistically analyzed and visualized using the Gentier 96E fully automated medical PCR analysis system.

[0070] The results are as follows Figure 8 As shown, amplification was observed in all parallel samples containing wheat or peanut allergens, and both wheat and peanut allergens were detected simultaneously in the nut bread. The negative control, DEPC-treated water, did not produce amplification. This indicates that this method can be used for the rapid detection of wheat and peanut allergen components in real-world samples.

[0071] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A primer-probe combination for detecting wheat and peanut allergens based on dual Proofman-LMTIA technology, characterized in that, Including XM-F1 as shown in SEQ ID NO.1, XM-B1 as shown in SEQ ID NO.2, XM-LB1 as shown in SEQ ID NO.3, HS-F2 as shown in SEQ ID NO.4, HS-B2 as shown in SEQ ID NO.5, HS-LB2 as shown in SEQ ID NO.6, XM-Probe1 as shown in SEQ ID NO.7, and HS-Probe2 as shown in SEQ ID NO.8; The XM-Probe1 and HS-Probe2 are connected to different fluorescent groups.

2. The use of the primer-probe combination according to claim 1 in the preparation of reagents or kits for detecting wheat allergens and peanut allergens.

3. A kit for detecting wheat allergens and peanut allergens based on dual Proofman-LMTIA technology, characterized in that, The kit contains the primer-probe combination as described in claim 1.

4. A method for detecting wheat allergens and peanut allergens, characterized in that, Includes the following steps: Genomic DNA was extracted from the sample to be tested; using the genomic DNA as a template, an amplification reaction was performed using the kit described in claim 3, and the fluorescence signal and amplification curve were observed; If there is a fluorescence signal and amplification curve with the same color as the fluorescent group connected to XM-Probe1, it indicates that the sample to be tested contains wheat allergen; if there is a fluorescence signal and amplification curve with the same color as the fluorescent group connected to HS-Probe2, it indicates that the sample to be tested contains peanut allergen.

5. The detection method according to claim 4, characterized in that, The amplification reaction system consisted of: 5 μL of 2×Mix premix, 0.4 μL of DNA polymerase, 0.16 μL of XM-F1, 0.16 μL of XM-B1, 0.16 μL of HS-F2, 0.16 μL of HS-B2, 0.04 μL of XM-LB1, 0.04 μL of HS-LB2, 0.4 μL of XM-Probe1, 0.4 μL of XM-Probe2, 2 μL of genomic DNA, and DEPC-treated water to a final volume of 10 μL.

6. The detection method according to claim 5, characterized in that, The concentrations of XM-F1, XM-B1, XM-LB1, HS-F2, HS-B2 and HS-LB2 were all 100 μM, and the concentrations of XM-Probe1 and HS-Probe2 were all 10 μM.

7. The detection method according to claim 5, characterized in that, The composition of the 2 × Mix premix is: 40 mM Tris-HCl, 20 mM KCl, 20 mM (NH4)2SO4, 12 mM MgSO4, 0.2% Triton X-100, and 2.4 mM dNTP.

8. The detection method according to claim 4, characterized in that, The amplification reaction was carried out at a temperature of 61°C for 40 minutes.

9. The use of the primer-probe combination of claim 1 or the kit of claim 3 in the detection of wheat allergens and / or peanut allergens in food.

Images