De novo sequencing method for rapidly and simultaneously identifying amino acid sequences of mixed antibodies

Abstract

The invention relates to a de novo sequencing method for rapidly and simultaneously identifying amino acid sequences of mixed antibodies, in the method, most abundant peptide fragment information can be provided for identification or analysis of the amino acid sequences of the antibodies through a gradient enzymolysis strategy, and further, the amino acid sequences of the antibodies can be identified and analyzed. A more efficient, higher-throughput, economical and practical de novo sequencing method is provided for accurate and complete de novo sequencing of the mixed antibody, and the method is particularly suitable for rapid research and development of the antibody and has a very wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of bioanalytical technology, and more specifically to a de novo sequencing method for rapid and simultaneous identification of amino acid sequences of mixed antibodies. Background Technology

[0002] The human immune system is a complex and sophisticated biological defense mechanism that protects us from external pathogens such as bacteria, viruses, fungi, and parasites, and eliminates abnormal cells such as cancer cells. Antibodies are among the most important molecules in the human immune system, playing a crucial role in treating infectious diseases and cancer. Therefore, antibody-based vaccine development has become one of the most economical and effective methods for controlling infectious diseases and inhibiting cancer progression. Accurately obtaining the primary amino acid sequence of antibody proteins is the first step in antibody drug discovery, helping us understand the structural basis of antigen-antibody binding, recognition, and interaction. Furthermore, sequence recombination expression or engineering modification can replace constant regions of antibodies from different species, thereby altering antibody species specificity and providing opportunities for designing diverse antibodies.

[0003] Traditional antibody discovery platforms first require multiple rounds of screening using hybridoma technology to obtain monoclonal antibodies with high target affinity. Then, DNA or RNA from the corresponding hybridoma cells is extracted for PCR sequencing. This process often takes 3 to 6 months to determine the antibody sequence. Currently, some researchers are directly isolating B cells from blood or bone marrow and extracting RNA, then constructing sequencing libraries using next-generation sequencing technology. This approach, independent of hybridoma or combinatorial display technologies, can shorten the antibody discovery cycle to as little as 4 weeks. Besides the drawback of long detection times, the above antibody sequencing methods require cooperation at both the gene and protein levels. If hybridoma cells become contaminated or lose viability during antibody screening, DNA or RNA sequence information cannot be obtained through PCR, severely limiting the flexibility of antibody screening. Therefore, direct antibody sequencing at the protein level could help "recover" antibodies and obtain more accurate antibody information.

[0004] In recent years, given the increasing challenges posed to human health by emerging infectious diseases and viral variants, there is an urgent need to develop faster and more efficient antibody sequence discovery methods. Thanks to advancements in sample preparation, mass spectrometry sensitivity, and data analysis, mass spectrometry-based de novo antibody sequencing has received widespread attention. Its antibody discovery cycle can be shortened to approximately two weeks. The basic analytical workflow is as follows: ① Protein products are simply separated and hydrolyzed into peptides by proteases; ② The peptide mixture is detected by mass spectrometry; ③ De novo peptide sequencing: peptide sequences are obtained directly from the spectra without relying on pre-existing protein databases; ④ The peptide sequences are assembled into a complete protein amino acid sequence using specific methods.

[0005] Antibodies represent a very special and challenging class of proteins, and the sequence of their complementarity-determining regions (CDRs) is a crucial factor influencing antibody activity. Traditional antibody sequencing technologies struggle to achieve full sequence coverage, almost always requiring partial database information—partial sequencing and partial prediction. Sequencing chemically or biologically conjugated antibodies requires even larger sample volumes. In contrast, mass spectrometry can obtain complete antibody amino acid sequences, especially precise CDR sequences, from micrograms to milligrams of sample, meeting the sequencing needs of clinical trials. Companies like Bioinformatics Solutions Inc., Protein Metrics Inc., and Rapid Novor Inc. offer relatively accurate sequences for single antibody samples through their antibody discovery platforms using monoclonal antibody de novo sequencing methods. However, de novo sequencing faces significant challenges when samples are mixed or polyclonal antibodies; currently, there is a lack of de novo sequencing methods that can directly identify mixed monoclonal antibody sequences. Summary of the Invention

[0006] The purpose of this invention is to address the problems of traditional mass spectrometry-based de novo sequencing techniques, such as high cost, long processing time, low throughput, and inability to identify mixed antibody sequences. It provides a novel, low-cost, high-efficiency de novo antibody sequencing method capable of identifying mixed antibody sequences. This method utilizes a gradient enzymatic digestion strategy to provide the richest peptide information for the identification or analysis of antibody amino acid sequences. Therefore, it offers a more efficient, higher-throughput, and cost-effective de novo sequencing method for accurate and complete sequencing of mixed antibodies, particularly suitable for rapid antibody development, with broad application prospects.

[0007] Therefore, in a first aspect, the present invention provides a sample pretreatment method for detecting mixed antibody amino acid sequences, comprising:

[0008] (1) Provide a mixed antibody sample to be tested, wherein the mixed antibody sample contains two or more monoclonal antibody samples or polyclonal antibody samples;

[0009] (2) The mixed antibody sample was subjected to denaturation, reduction and alkylation reactions in sequence to obtain an alkylation reaction mixture;

[0010] (3) The alkylation reaction mixture is subjected to enzymatic hydrolysis and sampling to obtain the polypeptide sample to be tested.

[0011] in:

[0012] In step (3), the enzymatic hydrolysis time is 6 hours;

[0013] In step (3), the sampling is gradient sampling, that is, at least one sampling is performed during the enzymatic hydrolysis time (i.e., before 6 hours of enzymatic hydrolysis) and another sampling is performed at the end of the enzymatic hydrolysis time (i.e., at 6 hours of enzymatic hydrolysis). After that, the samples obtained from multiple samplings are mixed to obtain the peptide sample to be tested.

[0014] In some implementations, in step (3), at least two samples are taken during the enzymatic hydrolysis time and one sample is taken at the end of the enzymatic hydrolysis time. Then, the samples obtained from the multiple samplings are mixed to obtain the peptide sample to be tested.

[0015] In some implementations, in step (3), two samples are taken during the enzymatic hydrolysis time and one sample is taken at the end of the enzymatic hydrolysis time. Then, the samples obtained from the three samplings are mixed to obtain the peptide sample to be tested.

[0016] In some implementations, in step (3), samples are taken at three time points: 2 hours, 4 hours and 6 hours after enzymatic hydrolysis. Then, the samples obtained from the three samplings are mixed to obtain the peptide sample to be tested.

[0017] In some implementations, in step (3), the enzymatic hydrolysis is performed using trypsin, chymotrypsin, pepsin, elastase, Asp-N enzyme, or any combination thereof.

[0018] In some embodiments, in step (3), the enzymatic hydrolysis is performed using trypsin, chymotrypsin, pepsin, elastase, and Asp-N enzyme; preferably, each enzyme is of equal mass.

[0019] In some implementations, step (3) is performed by the following steps:

[0020] The alkylation reaction mixture was divided into five equal portions. Trypsin, chymotrypsin, pepsin, elastase and Asp-N enzyme were added to the five portions of the reaction mixture, and enzymatic hydrolysis and sampling were performed to obtain the polypeptide samples to be tested.

[0021] Selecting five enzymes to enzymatically digest the mixed antibody separately can fully break it down into small fragments with high coverage, which is beneficial for subsequent detection. Furthermore, adding each enzyme separately avoids interference between enzymes and prevents self-digestion between different enzymes, thus avoiding reduced digestion efficiency. Accordingly, those skilled in the art will understand that the aforementioned "mixing samples obtained from multiple samplings to obtain the polypeptide sample to be tested" refers to the following: each of the five enzymes is used for enzymatic digestion, and multiple samplings are performed for each enzyme. The samples obtained from multiple samplings of each enzyme (i.e., gradient sampling) are then mixed. However, the final samples obtained from the five enzymes are not mixed again; instead, five polypeptide samples are obtained, which constitute the polypeptide sample to be tested.

[0022] In some embodiments, in the enzymatic digestion of step (3), the ratio of the total mass of the enzyme to the mass of the mixed antibody sample in step (1) is 1:5 to 1:50 (e.g., 1:5, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45 or 1:50, or e.g., 1:5 to 1:10, 1:10 to 1:15, 1:15 to 1:20, 1:20 to 1:25, 1:25 to 1:30 or 1:30 to 1:50), preferably 1:20.

[0023] In some embodiments, in the enzymatic hydrolysis of step (3), when an enzyme is used for enzymatic hydrolysis, the mass ratio of the enzyme to the mass of the mixed antibody sample in step (1) is 1:5 to 1:50 (e.g., 1:5, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45 or 1:50, or e.g., 1:5 to 1:10, 1:10 to 1:15, 1:15 to 1:20, 1:20 to 1:25, 1:25 to 1:30 or 1:30 to 1:50), preferably 1:20.

[0024] In some implementations, when enzymatic hydrolysis in step (3) is performed using multiple (e.g., five) enzymes, the ratio of the total mass of the multiple (e.g., five) enzymes to the mass of the mixed antibody sample in step (1) is 1:5 to 1:50 (e.g., 1:5, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45 or 1:50, or e.g., 1:5 to 1:10, 1:10 to 1:15, 1:15 to 1:20, 1:20 to 1:25, 1:25 to 1:30 or 1:30 to 1:50), preferably 1:20; preferably, the mass of each of the multiple enzymes (e.g., five) is the same.

[0025] In some embodiments, in step (2), the denaturation reduction is achieved using a combination of reagents selected from any one of (a)-(c) (preferably (c)):

[0026] (a) Sodium deoxycholate (DOC), tricarboxyethylphosphine (TCEP), and Tris-HCl;

[0027] Preferably, the concentration of sodium deoxycholate (DOC) is 2%, the concentration of tricarboxyethylphosphine (TCEP) is 20 mM, the concentration of Tris-HCl is 200 mM, and the pH is 8.0.

[0028] (b) Urea, TCEP and Tris-HCl;

[0029] Preferably, the concentration of urea is 8M, the concentration of TCEP is 20mM, the concentration of Tris-HCl is 100mM, and the pH is 8.0;

[0030] (c) Guanidine hydrochloride (Gu.HCl) and dithiothreitol (DTT);

[0031] Preferably, the concentration of guanidine hydrochloride (Gu.HCl) is 1-10M (e.g., 1M, 2M, 3M, 4M, 5M, 6M, 7M, 8M, 9M or 10M, or such as 1-2M, 2-3M, 3-4M, 4-5M, 5-6M, 6-7M, 7-8M, 8-9M or 9-10M), preferably 5-7M, more preferably 6M;

[0032] Preferably, the final concentration of the dithiothreitol (DTT) is 5mM-40mM (e.g., 5mM, 10mM, 15mM, 20mM, 25mM, 30mM, 35mM or 40mM), more preferably 10-40mM, more preferably 10-30mM, and most preferably 20mM.

[0033] In each reagent combination, the concentration of each substance is the final concentration of each substance in the mixed antibody sample.

[0034] In some embodiments, the mass of the mixed antibody sample is not less than 50 μg, preferably 50-200 μg (e.g., 50 μg, 100 μg, 150 μg or 200 μg, or 50-100 μg, 100-150 μg or 150-200 μg).

[0035] In some implementations, in step (1), the mixed antibody sample contains two or more monoclonal antibody samples.

[0036] In some implementations, the mixed antibody sample contains two or three monoclonal antibody samples.

[0037] In some implementations, in step (1), the mixed antibody sample contains two or more monoclonal antibody samples or polyclonal antibody samples mixed in equal mass.

[0038] In some implementations, in step (2), the denaturation reduction is carried out at a temperature of 40-80°C, preferably 60°C.

[0039] In some implementations, the denaturation and reduction process in step (2) takes 20-50 minutes, preferably 30 minutes.

[0040] In some embodiments, the alkylation reaction in step (2) is carried out using iodoacetamide.

[0041] In some embodiments, the concentration of iodoacetamide is 10-50 mM, preferably 30-50 mM, and more preferably 40 mM. The concentration of iodoacetamide is the final concentration of iodoacetamide in the denaturing-reduction reaction mixture.

[0042] In some embodiments, the alkylation reaction in step (2) is carried out at room temperature. As is known to those skilled in the art, "room temperature" refers to 15-25°C, such as 20°C.

[0043] In some embodiments, the alkylation reaction in step (2) is carried out for 20 min to 50 min, preferably 30 min.

[0044] In some embodiments, in step (3), the enzymatic hydrolysis is carried out at a temperature of 30-40°C, preferably 37°C.

[0045] In some implementations, step (3) further includes a step of terminating enzymatic hydrolysis after sampling.

[0046] In some implementations, the termination of enzymatic hydrolysis is achieved using trifluoroacetic acid.

[0047] In some embodiments, the step of terminating enzymatic hydrolysis is as follows: adding 10% trifluoroacetic acid to the hydrolyzed sample until the final concentration is 1% to terminate the hydrolysis. Those skilled in the art will understand that, unless otherwise specified, "10% trifluoroacetic acid" refers to "a 10% aqueous solution of trifluoroacetic acid," and other similar terms are interpreted in the same way.

[0048] In some implementations, the denaturation-reduction, alkylation, and enzymatic digestion are performed in the same container (e.g., a sample tube). This integrated processing method minimizes sample loss and provides the richest peptide information for subsequent de novo antibody sequencing.

[0049] In some embodiments, the process of terminating enzymatic hydrolysis further includes a desalting step.

[0050] In some implementations, the desalination is performed using a Sep-Pak desalination column.

[0051] In some implementations, the process after desalination also includes a freeze-drying step.

[0052] In some embodiments, the freeze-drying is carried out using a freeze dryer.

[0053] In some implementations, the freeze-drying process further includes a reconstitution step.

[0054] In some embodiments, the resolution is performed using formic acid, preferably 0.1% formic acid.

[0055] In a second aspect, the present invention provides a de novo sequencing method for detecting the amino acid sequence of a mixed antibody, comprising:

[0056] (I) Providing a polypeptide sample to be tested, wherein the polypeptide sample is obtained by the method described in any of the technical solutions of the first aspect;

[0057] (II) The peptide sample is separated into peptides using liquid chromatography, and then the peptide sample is detected using mass spectrometry to obtain mass spectrometry data of the peptide sample.

[0058] (III) The obtained mass spectrometry data were analyzed using de novo sequencing software, and the peptide sequences were reassembled to obtain the amino acid sequences of each monoclonal antibody or each polyclonal antibody in the mixed antibody.

[0059] In some implementations, when the peptide sample to be tested contains multiple (e.g., five) peptide samples, step (II) is performed by: separating the peptides of the multiple peptide samples separately using liquid chromatography, and then detecting the multiple peptide samples separately using mass spectrometry to obtain mass spectrometry data of the peptide samples.

[0060] In some implementations, in step (II), the fragmentation method employed by the mass spectrometer includes, but is not limited to, HCD, ETD, EThCD, UVPD, and / or PTCR fragmentation modes based on a three-in-one mass spectrometer (Orbitrap Eclipse), or based on Sciex ZenoTOF. TM The 7600 features EAD fragmentation mode and CID fragmentation mode based on Bruker timsTOF.

[0061] In some implementations, in step (II), data acquisition is performed using a triple mass spectrometry based on dual fragmentation mode (HCD & EThCD).

[0062] In some implementations, in step (II), the conditions for the mass spectrometry are:

[0063] Data-dependent acquisition (DDA) mode was used, with a primary scan quality range of 350-2000 m / z and a resolution of 60 k. The FAMIS voltage was -45 V. In each cycle, the top speed mode was used to select the precursor ion for secondary fragmentation, with a cycle time of 1.5 s and a dynamic exclusion time of 30 s. The secondary fragmentation modes were high-energy collisional dissociation (HCD) mode and electron-transfer / higher-energy collisional dissociation (EThcD) mode. The secondary scan range was selected as First Mass mode (100 m / z) with a resolution of 30 k. HCD used stepped normalized collision energy (NCE) for fragmentation at 27%-35%-40% of the energy. EThcD used electron-transfer dissociation (ETD) and 30% of the supplementary collision energy for fragmentation.

[0064] In some implementations, in step (II), the conditions for the liquid chromatography are:

[0065] The liquid chromatography system was a Vanquish Neo UPLC system, the column was a 50cm C18 column (75μm×50cm, 2μm id), the mobile phase A was 0.1% formic acid aqueous solution, the mobile phase B was 80% acetonitrile aqueous solution-0.1% formic acid aqueous solution, and the flow rate was 0.3mL / min.

[0066] In some embodiments, the liquid chromatography employs gradient elution; preferably, the gradient elution procedure is as follows:

[0067]

[0068] Preferably, the column temperature is 50°C, the sample chamber temperature is 7°C, and the sample loading volume is 1 μL.

[0069] Beneficial effects

[0070] Compared with existing technologies, the advantages of the de novo sequencing method of the present invention are at least as follows: 1) The "gradient enzymatic digestion" strategy can ensure the maximum cleavage rate and provide "first and last" confirmation information for the splicing of peptide fragments; 2) The integrated pretreatment method can minimize sample loss and provide the richest peptide information for subsequent antibody de novo sequencing.

[0071] In addition, this invention verifies sequence accuracy based on light and heavy chain molecular weight experiments, eliminating the need to synthesize antibody standards, which greatly increases throughput and reduces economic costs, making it suitable for large-scale antibody research and development and possessing broad application prospects. Attached Figure Description

[0072] Figure 1 A schematic diagram of a de novo sequencing method for rapid and simultaneous identification of mixed antibodies is shown.

[0073] Figure 2 The diagram shows the accurate coverage of two mixed monoclonal antibody sequences. (A) Coverage of the heavy and light chains of S2P6LH; (B) Coverage of the heavy and light chains of BD5514LH.

[0074] Figure 3 The diagram shows the accurate coverage of three mixed monoclonal antibody sequences. (A) Coverage of S2P6LH heavy and light chains; (B) Coverage of BD5514LH heavy and light chains; (C) Coverage of BD5840LH heavy and light chains.

[0075] Figure 4 The measured molecular weights of the light and heavy chains of S2P6LH are shown. (A) Measured value of the light chain of S2P6LH; (B) Measured value of the heavy chain of S2P6LH.

[0076] Figure 5 The measured molecular weights of the light and heavy chains of BD5514LH are shown. (A) Measured value of the light chain of BD5514LH; (B) Measured value of the heavy chain of BD5514LH.

[0077] Figure 6 The measured molecular weights of the light and heavy chains of BD5840LH are shown. (A) Measured value of the light chain of BD5840LH; (B) Measured value of the heavy chain of BD5840LH.

[0078] Figure 7 The diagram shows the applicable sample range and the effects of different antibody S2P6LH. The amino acid sequence coverage of the light and heavy chains of the antibody was used as the evaluation index.

[0079] Figure 8 The assembly results for different applicable sample ranges are shown. The assembly and splicing effect of the antibody S2P6LH light and heavy chains is used as the evaluation index.

[0080] Figure 9The results show the protein and peptide identification values ​​of the QC samples, which are HeLa cell quality control samples, i.e., QC samples. (A) Protein identification value of the QC sample; (B) Peptide identification value of the QC sample.

[0081] Figure 10 The results of optimized enzymatic digestion time are shown, including sequence coverage of S2P6LH and BD5514LH antibodies at different digestion times: 2 h, 4 h, 6 h, 8 h, and overnight. After three biological replicates, the results indicated that 6 h of digestion yielded the best results, with the highest amino acid sequence coverage for both the light and heavy chains.

[0082] Figure 11 The results show the missing cleavage rates for single-time-point enzymatic hydrolysis and gradient enzymatic hydrolysis, providing a comparison of the missing cleavage rates for single-time-point enzymatic hydrolysis and gradient enzymatic hydrolysis. (A) Comparison of missing cleavage rates for single-time-point and gradient enzymatic hydrolysis (samples taken at 2-4-6h respectively); (B) Comparison of missing cleavage rates for gradient enzymatic hydrolysis (samples taken at 2-4-6h respectively) and overnight enzymatic hydrolysis (samples taken at 16h).

[0083] Figure 12 The diagram shows a comparison of the optimization effects of three buffer solutions. (A) Sequence coverage of the S2P6LH light chain under three lysis buffers and five enzymes; (B) Sequence coverage of the S2P6LH heavy chain under three lysis buffers and five enzymes; (C) Sequence coverage of the BD5514LH light chain under three lysis buffers and five enzymes; (D) Sequence coverage of the BD5514LH heavy chain under three lysis buffers and five enzymes.

[0084] Figure 13 The results of optimized enzymatic digestion ratios are shown, including peak area and sequence coverage plots of the S2P6LH antibody under different digestion ratios of 1:5, 1:10, 1:20, and 1:50. After three biological replicates, the results showed that a Trypsin:sample ratio of 1:20 yielded the best results, achieving 100% amino acid sequence coverage and a peak area of ​​73.63%, both higher than other digestion ratios.

[0085] Figure 14 The integrated pretreatment method versus a commercial kit is shown, comparing the data of the method of this invention with the commercial product EasyPept-Micro using three buffers and five enzymes. Figures A and B show the pretreatment effects of the kit method and the three buffer methods using S2P6LH or BD5514LH as samples and trypsin as a gradient digestion. Figures C and D show the pretreatment effects of the commercial kit method combined with five enzymes using S2P6LH or BD5514LH as samples.

[0086] Sequence information

[0087] Information on some of the sequences involved in this invention is provided in Table 1 below.

[0088] Table 1: Antibody Sequences

[0089]

[0090]

[0091]

[0092] Detailed Implementation

[0093] Those skilled in the art can refer to the content of this document and appropriately improve the process parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments, and those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0094] In the following embodiments, the de novo sequencing software can be commercial software (e.g., the commercial de novo sequencing software Peaks AB is used for analysis in this invention), or it can be built and developed in-house. Parameter settings are as follows: the enzymatic digestion method is selected as Specified by each sample; the fixed modification is selected as Carbamidomethylation (+57.021464 Da); the variable modifications are Deamidation N / Q (+0.984016 Da), Oxidation M (+15.994915 Da), and Pyro-Glufrom Q (-17.026549 Da), and the maximum number of variable modifications allowed for each peptide is 3.

[0095] The present invention will be further explained below with reference to specific embodiments. Unless otherwise specified, the instruments and reagents are all conventional instruments and reagents used in the art and are commercially available.

[0096] Example 1: Confirmation of the amino acid sequences of two mixed antibodies

[0097] In this example, guanidine hydrochloride buffer solution (Gu.HCl) and iodoacetamide (IAA) were purchased from Sigma-Aldrich; dithiothreitol solution (DTT) was purchased from Inalco; trypsin, chymotrypsin, elastase, pepsin, and (Asp-N) were purchased from Promega; Sep-Pak desalting column was purchased from Waters; and acetonitrile (ACN), formic acid (FA), and trifluoroacetic acid (TFA) were purchased from Thermo Fisher.

[0098] The mixed antibodies used in this example were two humanized monoclonal antibodies, S2P6LH and BD5514LH, both purified in our laboratory using the ExpiCHO suspension expression system (EhermoFisherCat#A29133). On day 7 post-transfection, the collected cell culture supernatant was purified using a Protein A column (Cytiva), eluted with a mixture of 70 mM citrate monohydrate and 20 mM disodium hydrogen phosphate dodecahydrate to obtain Fc-tag protein, which was then dialyzed in 1*PBS. Finally, the concentration was determined using a protein quantification kit (Thermo Fisher Cat#23225).

[0099] The specific experimental steps are as follows: Figure 1 The method shown is a de novo sequencing method for rapid and simultaneous identification of mixed antibody amino acid sequences:

[0100] (1) Sample: Equal amounts of two humanized monoclonal antibodies, S2P6LH and BD5514LH, were mixed;

[0101] (2) Integrated pretreatment: Take 200 μg of mixed antibody and add 6M guanidine hydrochloride buffer solution (Gu.HCl) and 1M dithiothreitol solution (DTT) to a final concentration of 20 mM. React at 60℃ for 30 min for denaturation and reduction reaction; add 1M iodoacetamide (IAA) to the above mixture to a final concentration of 40 mM for alkylation reaction. React at room temperature in the dark for 30 min.

[0102] (3) Gradient enzymatic hydrolysis: Divide the above mixture into 5 equal parts and add five different enzymes (Trypsin, Chymotrypsin, Pepsin, Elastase, Asp-N) to each part. The enzymatic hydrolysis ratio is 1:20 (enzyme: 1 / 5 of the above mixed antibody). Hydrolyze at 37°C for 6 hours, and take samples every 2 hours for a total of three times. Add 10% trifluoroacetic acid to the hydrolyzed samples to a final concentration of 1% to terminate the enzymatic hydrolysis. Desalt the samples using the Sep-Pak desalting column according to the supplier's operation manual, and then freeze dry them using a freeze dryer.

[0103] (4) Mass spectrometry detection: The peptide samples obtained from the five enzymes in the previous step were reconstituted with 0.1% FA, and then separated into peptides by reversed-phase chromatography. Mass spectrometry detection was then performed. The chromatographic conditions were as follows: the liquid chromatography system was a Vanquish Neo UPLC system, the chromatographic column was a 50cm C18 column (75μm×50cm, 2μm id), the mobile phase A was 0.1% FA aqueous solution, and the mobile phase B was 80% acetonitrile solution-0.1% FA aqueous solution. The flow rate and total separation time are shown in Table 2.

[0104] Table 2: Liquid Phase Gradient

[0105]

[0106] The column temperature was 50℃, the sample chamber temperature was 7℃, and the sample loading volume was 1μL.

[0107] The mass spectrometry conditions were as follows: Data-dependent acquisition (DDA) mode was used, with a primary scan mass range of 350-2000 m / z and a resolution of 60 k. The FAMIS voltage was -45 V. In each cycle, the top speed mode was used to select the precursor ion for secondary fragmentation, with a cycle time of 1.5 s and a dynamic exclusion time of 30 s. The secondary fragmentation modes were high-energy collisional dissociation (HCD) mode and electron-transfer / higher-energy collisional dissociation (EThcD) mode. The secondary scan range was selected as First Mass mode (100 m / z) with a resolution of 30 k. HCD used stepped normalized collision energy (NCE) with fragmentation at 27%-35%-40% of the energy. EThcD used electron-transfer dissociation (ETD) and 30% of the supplementary collision energy for fragmentation.

[0108] (5) Use de novo sequencing software to analyze and reassemble the mixed peptide sequences into complete monoclonal antibody sequences.

[0109] Experimental results are as follows Figure 2 As shown, the amino acid sequences, accurate coverage, and molecular weight of the light and heavy chains of the mixed antibodies S2P6LH and BD5514LHR were obtained. The light chain achieved 100% correct coverage, the heavy chain achieved 99.78% correct coverage, and the CDR region sequence achieved 100% amino acid accuracy.

[0110] After obtaining the amino acid sequences of the light and heavy chains of the mixed monoclonal antibodies, the inventors verified the molecular weight of the light and heavy chains of each monoclonal antibody. The specific verification method is as follows:

[0111] Antibody reduction: Take 100 μg of antibody and add water for injection to bring the volume to 95 μl. If the sample volume exceeds 95 μl, it needs to be concentrated appropriately. Add 1 M DTT (final concentration 50 mM), incubate at 57℃ for 45 min with shaking at 950 rpm. Ultrafilter 500 μl of water for injection and 14000 μg of antibody for 10 min. After adding DTT to reduce the antibody, ultrafilter for 10 min, then add 200 μl of 15 mM Tris-HCl and ultrafilter for 10 min, finally bringing the volume to 100 μl. Add 2 μl of PNGase F and react at 37℃ for at least 16 h. Continue ultrafiltering the sample, then add 200 μl of water for injection and ultrafilter, finally bringing the volume to 200 μl. Transfer to a sample vial, with a sample concentration of approximately 0.5 μg / μl.

[0112] Liquid chromatography separation and mass spectrometry detection: Liquid chromatography system: Vanquish Flex UHPLC system; Mass spectrometry system: OrbitrapEclipse Tribrid mass spectrometer; Column type: MAbPac™ RP, 4μm, 2.1 x 50mm; Column temperature: 80℃; Mobile phase: A: 0.1% FA-H2O; B: 0.1% FA-ACN; Flow rate: 0.25mL / min; Total separation time: 20min; Liquid chromatography gradient is shown in Table 3.

[0113] Table 3 Gradient of Liquid Phase Methods

[0114]

[0115] Database search and analysis: The obtained raw spectra were processed and deconvolved using BioPharma Finder 5.2 software to obtain the molecular weight information of the light and heavy chains.

[0116] The experimentally measured molecular weights of the light and heavy chains were found to be consistent with the theoretical calculations, further validating the accuracy of the mass spectrometry-based de novo sequencing method for mixed antibodies in this invention.

[0117] Example 2: Confirmation of the amino acid sequences of three mixed antibodies

[0118] In this example, guanidine hydrochloride buffer solution (Gu.HCl) and iodoacetamide (IAA) were purchased from Sigma-Aldrich; dithiothreitol solution (DTT) was purchased from Inalco; trypsin, chymotrypsin, elastase, pepsin, and Asp-N were purchased from Promega; Sep-Pak desalting column was purchased from Waters; and acetonitrile (ACN), formic acid (FA), and trifluoroacetic acid (TFA) were purchased from Thermo Fisher.

[0119] The three mixed humanized antibodies used in this example were S2P6LH, BD5514LH, and BD5840LH, all purified in our laboratory using the ExpiCHO suspension expression system (EhermoFisherCat#A29133). On day 7 post-transfection, the collected cell culture supernatant was purified using a Protein A column (Cytiva), eluted with a mixture of 70 mM citrate monohydrate and 20 mM disodium hydrogen phosphate dodecahydrate to obtain Fc-tag protein, which was then dialyzed in 1*PBS. Finally, the concentration was determined using a protein quantification kit (Thermo Fisher Cat#23225).

[0120] (1) Samples: Equal amounts of three humanized monoclonal antibodies, namely S2P6LH, BD5514LH and BD5840LH, were mixed together.

[0121] (2) Integrated pretreatment: Take 200 μg of mixed antibody and add 6M guanidine hydrochloride buffer solution (Gu.HCl) and 1M dithiothreitol solution (DTT) to a final concentration of 20 mM. React at 60℃ for 30 min for denaturation and reduction reaction; add 1M iodoacetamide (IAA) to the above mixture to a final concentration of 40 mM for alkylation reaction. React at room temperature in the dark for 30 min.

[0122] (3) Gradient enzymatic hydrolysis: Divide the above mixture into 5 equal parts and add five different enzymes (Trypsin, Chymotrypsin, Pepsin, Elastase, Asp-N) to each part. The enzymatic hydrolysis ratio is 1:20 (enzyme: 1 / 5 of the above mixed antibody). Enzymatic hydrolysis is carried out at 37°C for 6 hours. Samples are taken every 2 hours for a total of three times. 10% trifluoroacetic acid is added to the enzymatically hydrolyzed sample to a final concentration of 1% to terminate the enzymatic hydrolysis. Desalting is performed using a Sep-Pak desalting column according to the supplier's operation manual. Then, the sample is freeze-dried.

[0123] (4) Mass spectrometry detection: 0.1% FA was added to the peptide samples obtained from the five enzymes in the previous step for reconstitution, and then the peptides were separated by reversed-phase chromatography. Mass spectrometry detection was then performed. The chromatographic conditions were as follows: the liquid chromatography system was a Vanquish Neo UPLC system, the column was a 50cm C18 column (75μm×50cm, 2μm id), mobile phase A was 0.1% FA aqueous solution, and mobile phase B was 80% acetonitrile solution-0.1% FA aqueous solution. The flow rate and total separation time are shown in Table 4.

[0124] Table 4 Liquid Phase Gradient

[0125]

[0126] The column temperature was 50℃, the sample chamber temperature was 7℃, and the sample loading volume was 1μL.

[0127] The mass spectrometry conditions were as follows: Data-dependent acquisition (DDA) mode was used, with a primary scan mass range of 350-2000 m / z and a resolution of 60 k. The FAMIS voltage was -45 V. In each cycle, the top speed mode was used to select the precursor ion for secondary fragmentation, with a cycle time of 1.5 s and a dynamic exclusion time of 30 s. The secondary fragmentation modes were high-energy collisional dissociation (HCD) mode and electron-transfer / higher-energy collisional dissociation (EThcD) mode. The secondary scan range was selected as First Mass mode (100 m / z) with a resolution of 30 k. HCD used stepped normalized collision energy (NCE) with fragmentation at 27%-35%-40% of the energy. EThcD used electron-transfer dissociation (ETD) and 30% of the supplementary collision energy for fragmentation.

[0128] (5) Use de novo sequencing software to analyze and reassemble the mixed peptide sequences into complete monoclonal antibody sequences.

[0129] Experimental results are as follows Figure 3As shown in the figure, the S2P6LH monoclonal antibody achieved 100% coverage of both the light and heavy chains, and 100% amino acid accuracy in the CDR region sequence. BD5514LH achieved 100% light chain coverage (100% CDR region sequence accuracy), but its heavy chain coverage was only 99.12% (94.12% CDR region sequence accuracy), possibly due to the increased difficulty in distinguishing I and L amino acids after mixing the three antibodies. The third antibody, BD5840LH, achieved coverage of over 99% for both the light and heavy chains, with 96.67% CDR region accuracy for the heavy chain and 95% CDR region sequence accuracy for the light chain. The CDR2 region of the BD5840LH heavy chain exhibited an issue with amino acid identification (the original sequence was I, and all denominated sequences were V). This was suspected to be due to a base mutation in the plasmid. Therefore, the inventors sequenced the CDR region of the BD5840LH heavy chain for verification. By designing a reverse primer BD5840R1 (primer sequence GAGGAGGGTGCCAGGGGGAAGA) at the front end of the heavy chain constant region, the sequencing results showed that the first 3' to 5' base pair in the CDR2 region of the BD5840LH heavy chain was GAC, corresponding to the amino acid (Val / V) valine, i.e., the CDR2 region sequence was VNTDTGTPT. The originally provided theoretical base sequence was GAT, corresponding to the amino acid isoleucine (Ile / I), i.e., the CDR2 region sequence was INTDTGTPT. Thus, the de novo sequencing method of this invention can assemble more accurate and realistic sequences, demonstrating accuracy and effectiveness. It can also promptly correct amino acid mutations in antibody sequences, showing significant future application potential.

[0130] The inventors then verified the molecular weight based on the amino acid sequences of the light and heavy chains of the three mixed monoclonal antibodies. The specific verification method is as follows:

[0131] Antibody reduction: Take 100 μg of antibody and add water for injection to bring the volume to 95 μl. If the sample volume exceeds 95 μl, it needs to be concentrated appropriately. Add 1 M DTT (final concentration 50 mM), incubate at 57℃ for 45 min with shaking at 950 rpm. Ultrafilter 500 μl of water for injection and 14000 μg of antibody for 10 min. After adding DTT to reduce the antibody, ultrafilter for 10 min, then add 200 μl of 15 mM Tris-HCl and ultrafilter for 10 min, finally bringing the volume to 100 μl. Add 2 μl of PNGase F and react at 37℃ for at least 16 h. Continue ultrafiltering the sample, then add 200 μl of water for injection and ultrafilter, finally bringing the volume to 200 μl. Transfer to a sample vial, with a sample concentration of approximately 0.5 μg / μl.

[0132] Liquid chromatography separation and mass spectrometry detection: Liquid chromatography system: Vanquish Flex UHPLC system; Mass spectrometry system: OrbitrapEclipse Tribrid mass spectrometer; Column type: MAbPac™ RP, 4μm, 2.1 x 50mm; Column temperature: 80℃; Mobile phase: A: 0.1% FA-H2O; B: 0.1% FA-ACN; Flow rate: 0.25mL / min; Total separation time: 20min; Liquid chromatography gradient is shown in Table 5.

[0133] Table 5 Gradient of Liquid Phase Methods

[0134]

[0135] Database search and analysis: The obtained raw spectra were processed and deconvolved using BioPharma Finder 5.2 software to obtain the molecular weight information of the light and heavy chains.

[0136] The experimentally measured molecular weights of the light and heavy chains were found to be consistent with the theoretical calculations, and the difference between the theoretical and actual values ​​was within a reasonable error range (see [link to relevant documentation]). Figure 4 &5&6&Table 6).

[0137] Table 6: Theoretical and Measured Values ​​of Mixed Antibody Molecules by Mass Spectrometry

[0138]

[0139] Example 3: Exploration of Applicable Sample Range

[0140] Since some antibody drugs used in clinical practice may be derived from immune hosts, commercially available antibodies, or hybridoma cell products, many of these antibodies may only be available in microgram quantities. Therefore, in order to further explore the applicability of the method of this invention, S2P6LH humanized monoclonal antibody was used as a sample, and experiments were conducted on antibody samples of 50 μg, 100 μg, and 200 μg to compare the sequence coverage of the antibody light and heavy chains.

[0141] Compared to Example 1, the de novo sequencing method in this embodiment only replaces the mixed antibody with the corresponding amount of S2P6LH humanized monoclonal antibody, and replaces the double fragmentation mode of mass spectrometry with the single fragmentation mode (EThcD or HCD), while other steps and conditions remain unchanged.

[0142] The results showed that gradient digestion with five enzymes using a sample amount of 200 μg produced the richest fragments and the highest sequence coverage. Figure 7 However, considering the peptide information produced by the five enzymes, a sample amount of 50 μg is sufficient to assemble a complete antibody sequence. Figure 8Therefore, the inventors of this application believe that the pretreatment method, gradient enzymatic digestion strategy, and de novo sequencing method developed in this invention are applicable to antibody samples with starting amounts as low as 50 μg and have great application potential.

[0143] In addition, the inventors provided the following comparative examples. All comparative examples were conducted under strict quality control. Specifically, based on strict quality control, i.e., running one HeLa sample daily as a QC sample, the coefficients of variation (~0.14%; ~0.34%) of the protein and peptide identification amounts indicate that the mass spectrometer was in a stable state. Figure 9 ).

[0144] Comparative Example I: Exploration of Gradient Enzymatic Digestion Strategy

[0145] Conventional proteomics sample preparation often requires overnight enzymatic digestion, such as the FASP method. However, prolonged digestion times can lead to protein adsorption onto the tube walls, which is detrimental to the preparation of microgram-level antibody samples. Therefore, the digestion time for microgram-level antibody samples was optimized. To further shorten the reaction time, the inventors tested antibody sequence identification results at different digestion times. Digestion times included 2 hours, 4 hours, 6 hours, 8 hours, and overnight.

[0146] Compared to Example 1, the de novo sequencing methods of Comparative Examples I-1 to I-5 only replaced the enzymatic digestion strategy, while other steps and conditions remained unchanged. The specific changes are as follows.

[0147] Comparative Example Enzymatic hydrolysis strategy I-1 Enzymatic hydrolysis was performed at 37℃ for 2 hours, with a sample taken at the end of the hydrolysis period. I-2 Enzymatic hydrolysis was performed at 37℃ for 4 hours, with a sample taken at the end of the hydrolysis period. I-3 Enzymatic hydrolysis was performed at 37℃ for 6 hours, with a sample taken at the end of the hydrolysis period. I-4 Enzymatic hydrolysis was performed at 37℃ for 8 hours, with a sample taken at the end of the hydrolysis period. I-5 Enzymatic hydrolysis was performed overnight (16 hours) at 37°C, with a sample taken at the end of the hydrolysis period.

[0148] First, the antibody sequence coverage results indicate that 6 hours of enzymatic digestion achieves sufficient digestion, even better than overnight digestion. Figure 10 ).

[0149] Secondly, since antibody de novo requires as much fragment information as possible to support peptide splicing, the inventors also compared the missed cleavage rates under different enzymatic digestion strategies. A higher missed cleavage rate is more beneficial for the final peptide splicing. The missed cleavage rate results showed that, at a single time point, when sampling by enzymatic digestion, the missed cleavage rate gradually decreased with increasing digestion time. After digestion times exceeding 6 hours (e.g., 8 hours or overnight), the missed cleavage rate decreased significantly. Figure 11 ).

[0150] Taking both of the above into consideration, the inventors discovered that, compared to enzymatic digestion sampling at a single time point, the "gradient digestion" strategy established in this invention, which involves sampling at 2h, 4h, and 6h, can maximize the missed digestion rate while ensuring the highest antibody sequence coverage. Figure 10 , Figure 11This provides "first and last" confirmation information for the splicing of peptide fragments, which has significant advantages over conventional overnight enzymatic hydrolysis.

[0151] Comparative Example II: Selection of Lysis Buffer

[0152] Compared to Example 1, the de novo sequencing methods of Comparative Examples II-1 to II-3 only replaced the lysis buffer during denaturation and reduction in equal amounts, and replaced the double fragmentation mode of mass spectrometry with the single fragmentation mode (EThcD). Other steps and conditions remained unchanged, and the specific changes are as follows.

[0153] Comparative Example Lysis buffer II-1 2%DOC+20mM TCEP+200mM Tris-HCl, PH8.0 II-2 8M Urea+20mM TCEP+100mM Tris-HCl, PH8.0 II-3 6M Gu.HCL + 20mM DTT

[0154] Experimental results show that using guanidine hydrochloride buffer to lyse antibody samples yielded the best light and heavy chain coverage. Figure 12 Taking the heavy chain of S2P6LH as an example, Figure 12 Figure B shows the lysis effect of three lysis buffers combined with five enzymes. The sequence coverage of guanidine hydrochloride combined with Trypsin, Chymotrypsin, Pepsin, Elastase, and Asp-N reached 92.60%, 97.30%, 99.80%, 99.30%, and 96.20%, respectively, all superior to the lysis effects of other lysis buffers. Therefore, the inventors of this application used guanidine hydrochloride buffer for lysing mixed antibody samples.

[0155] Comparative Example III: Selection of Enzymatic Hydrolysis Ratio

[0156] Due to the complex structure of antibodies, de novo sequencing of CDR region information presents significant challenges. To ensure sufficient contact and reaction between the enzyme and the sample, the enzyme ratio was increased compared to the traditional Trypsin sample (1:50), and the enzymatic digestion efficiency at different ratios was tested.

[0157] Compared to Example 1, the de novo sequencing methods of Comparative Examples III-1 to III-4 only replaced the five enzymes with one enzyme (Trypsin) in equal amounts and changed the enzyme digestion ratio. Other steps and conditions remained unchanged. The specific changes are as follows.

[0158] Comparative Example Enzyme types Enzymatic hydrolysis ratio (enzyme: mixed antibody) III-1 Trypsin 1：5 III-2 Trypsin 1：10 III-3 Trypsin 1：20 III-4 Trypsin 1：50

[0159] The results of the peak area of ​​S2P6LH antibody are as follows: Figure 13 As shown, the results indicate that a Trypsin:antibody sample ratio of 1:20 yields the best results and the highest peak area, suggesting that the enzyme and sample can fully contact and react at this ratio, and that the amount of enzyme is not so high as to suppress the sample signal during mass spectrometry detection. Therefore, the inventors of this application use an enzyme:sample ratio of 1:20 for enzymatic digestion.

[0160] Comparative Example IV: Antibody sequence resolution performance compared to commercial kits

[0161] In addition, the inventors of this application compared the method of the present invention with the commercially available EasyPept-Micro micro-pretreatment kit. Using two humanized monoclonal antibodies, S2P6LH and BD5514LH, as samples, the pretreatment effects of three lysis buffers and five enzymes were compared. Specific steps are detailed in Example 1.

[0162] The sequence coverage results showed that the combination of guanidine hydrochloride and Trypsin was significantly more effective than that of commercially available kits. Figure 14 This method is superior to the other two lysis solutions, further demonstrating the reliability and superiority of the method of the present invention.

Claims

1. A sample pretreatment method for detecting amino acid sequences of mixed antibodies, comprising: (1) providing a mixed antibody sample to be detected, wherein the mixed antibody sample comprises two or more monoclonal antibody samples or polyclonal antibody samples; (2) sequentially performing denaturation reduction and alkylation on the mixed antibody sample to obtain an alkylation reaction mixture; (3) performing enzymolysis and sampling on the alkylation reaction mixture to obtain a polypeptide sample to be detected, wherein: in step (3), the enzymolysis time is 6 hours; in step (3), at least one sampling is performed during the enzymolysis time (i.e., before 6 hours of enzymolysis), one sampling is performed at the end of the enzymolysis time (i.e., at 6 hours of enzymolysis), and then the samples obtained by multiple samplings are mixed to obtain the polypeptide sample to be detected.

2. The method of claim 1, wherein, The method further has any one of the technical features selected from (i) to (iii): (i) in step (3), at least two samplings are performed during the enzymolysis time, one sampling is performed at the end of the enzymolysis time, and then the samples obtained by multiple samplings are mixed to obtain the polypeptide sample to be detected; (ii) in step (3), two samplings are performed during the enzymolysis time, one sampling is performed at the end of the enzymolysis time, and then the samples obtained by three samplings are mixed to obtain the polypeptide sample to be detected; (iii) in step (3), one sampling is performed at each of the three time points of 2 hours, 4 hours and 6 hours of enzymolysis, and then the samples obtained by three samplings are mixed to obtain the polypeptide sample to be detected.

3. The method according to any one of claims 1-2, wherein, In step (3), the enzymolysis is achieved by using trypsin, chymotrypsin, pepsin, elastase, Asp-N enzyme or any combination thereof. Preferably, in step (3), the enzymolysis is achieved by using trypsin, chymotrypsin, pepsin, elastase and Asp-N enzyme; preferably, the mass of each enzyme is the same. Preferably, step (3) is performed by the following steps: The alkylation reaction mixture is evenly divided into five parts, trypsin, chymotrypsin, pepsin, elastase and Asp-N enzyme are added to the five reaction mixtures respectively, and enzymolysis and sampling are performed respectively to obtain the polypeptide sample to be detected.

4. The method according to any one of claims 1 to 3, wherein, In the enzymolysis of step (3), the ratio of the total mass of enzymes to the mass of the mixed antibody sample in step (1) is 1:5 to 1:50, preferably 1:

20. Preferably, in the enzymolysis of step (3), when one enzyme is used for enzymolysis, the ratio of the mass of the one enzyme to the mass of the mixed antibody sample in step (1) is 1:5 to 1:50, preferably 1:

20. Preferably, in the enzymolysis of step (3), when multiple (e.g., five) enzymes are used for enzymolysis, the total mass of the multiple (e.g., five) enzymes is 1:5 to 1:50, preferably 1:20, of the mass of the mixed antibody sample in step (1); preferably, the mass of each enzyme in the multiple (e.g., five) enzymes is the same.

5. The method according to any one of claims 1 to 4, wherein, In step (2), the denaturation reduction is achieved by using any one of the reagent combinations selected from (a) to (c) (preferably (c)): (a) sodium deoxycholate (DOC), tricarboxyethylphosphine (TCEP) and Tris-HCl; Preferably, the concentration of sodium deoxycholate (DOC) is 2%, the concentration of tricarboxyethylphosphine (TCEP) is 20 mM, the concentration of Tris-HCl is 200 mM, and the pH is 8.0; (b) urea, TCEP and Tris-HCl; Preferably, the concentration of urea is 8 M, the concentration of TCEP is 20 mM, the concentration of Tris-HCl is 100 mM, and the pH is 8.0; (c) guanidine hydrochloride (Gu.HCL) and dithiothreitol (DTT); Preferably, the concentration of guanidine hydrochloride (Gu.HCL) is 1-10 M, preferably 5-7 M, and more preferably 6 M; Preferably, the concentration of dithiothreitol (DTT) is 5 mM-40 mM, preferably 10-40 mM, more preferably 10-30 mM, and most preferably 20 mM.

6. The method according to any one of claims 1 to 5, wherein, The mass of the mixed antibody sample is not less than 50 μg, and is preferably 50-200 μg.

7. The method according to any one of claims 1-6, wherein, The method further has one or more technical features selected from (i)-(x) below: (i) In step (1), the mixed antibody sample comprises two or more monoclonal antibody samples; Preferably, the mixed antibody sample comprises two or three monoclonal antibody samples; (ii) In step (1), the two or more monoclonal antibody samples or polyclonal antibody samples in the mixed antibody sample are mixed in equal mass; (iii) In step (2), the denaturation and reduction is performed at a temperature of 40-80°C, and preferably 60°C; (iv) In step (2), the denaturation and reduction is performed for 20 min-50 min, and preferably 30 min; (v) In step (2), the alkylation reaction is performed using iodoacetamide; Preferably, the concentration of iodoacetamide is 10-50 mM, preferably 30-50 mM, and more preferably 40 mM; (vi) In step (2), the alkylation reaction is performed at room temperature; (vii) In step (2), the alkylation reaction is performed for 20 min-50 min, and preferably 30 min; (viii) In step (3), the enzymatic digestion is performed at a temperature of 30-40°C, and preferably 37°C; (ix) In step (3), after sampling, a step of terminating the enzymatic digestion is further included; Preferably, the termination of the enzymatic digestion is achieved using trifluoroacetic acid; Preferably, the step of terminating the enzymatic digestion is: adding 10% trifluoroacetic acid to the sample after enzymatic digestion to a final concentration of 1% to terminate the enzymatic digestion; (x) The denaturation and reduction, the alkylation reaction, and the enzymatic digestion are performed in the same container (such as a sample tube).

8. The method of claim 7, wherein, The method further has one or more technical features selected from (i)-(iii) below: (i) After the termination of the enzymatic digestion, a step of desalting is further included; Preferably, the desalting is performed using a Sep-Pak desalting column; (ii) After the desalting, a step of lyophilization is further included; Preferably, the lyophilization is performed by using a freeze dryer. (iii) after the lyophilization, further comprising a step of reconstitution; Preferably, the reconstitution is performed by using formic acid, preferably 0.1% formic acid.

9. A method for detecting the amino acid sequence of a mixed antibody by de novo sequencing, comprising: (I) providing a polypeptide sample to be detected, which is obtained by the method of any one of claims 1-8; (II) separating the polypeptide sample into peptide fragments using liquid chromatography, and then detecting the polypeptide sample using mass spectrometry to obtain mass spectrometry data of the polypeptide sample; (III) analyzing the obtained mass spectrometry data using de novo sequencing software to reassemble the peptide fragment sequences, and obtaining the amino acid sequence of each monoclonal antibody or each polyclonal antibody in the mixed antibody.

10. The method of claim 9, wherein, The method further has one or more technical features selected from (i)-(iv) below: ( i) in step (II), the fragmentation method employed by the mass spectrometer includes, but is not limited to, HCD, ETD, EThcD, UVPD, and / or PTCR fragmentation modes based on a tribrid mass spectrometer instrument (Orbitrap Eclipse), EAD fragmentation modes based on Sciex ZenoTOF 7600, and CID fragmentation modes based on Bruker timsTOF TM 7600; (ii) in step (II), a triple quadrupole mass spectrometer based on a double fragmentation mode (HCD&EThcD) is used for data acquisition; (iii) in step (II), the conditions of the mass spectrometer are as follows: using data-dependent acquisition mode (DDA), the primary scan mass range is 350-2000 m / z, the resolution is 60k, the FAMIS voltage is -45V, the top speed mode is used to select the parent ion for secondary fragmentation in each cycle, the cycle time is 1.5s, and the dynamic exclusion time is set to 30s; the secondary fragmentation mode is high energy collisional dissociation (HCD) mode and Electron-Transfer / Higher-Energy Collision Dissociation (EThcD) mode, the secondary scan range is selected as First Mass mode (100 m / z), the resolution is 30k, HCD uses stepped NCE, and the fragmentation is performed at an energy of 27%-35%-40%, EThcD uses Electron-Transfer Dissociation (ETD) and 30% supplemental collision energy for fragmentation; (iv) in step (II), the conditions of the liquid chromatography are as follows: the liquid chromatography system is Vanquish Neo UPLC system, the chromatographic column is a 50cm C18 chromatographic separation column (75μm×50cm, 2μm id), the mobile phase A is 0.1% formic acid aqueous solution, the mobile phase B is 80% acetonitrile aqueous solution-0.1% formic acid aqueous solution, and the flow rate is 0.3mL / min; Preferably, the liquid chromatography uses gradient elution; preferably, the program of the gradient elution is as follows: Preferably, the column temperature is 50℃, the sample chamber temperature is 7℃, and the sample volume is 1μL.

Images