P53 fusion protein based on targeted colorectal cancer marker CEA and application of p53 fusion protein in preparation of medicine for inhibiting colorectal cancer
By fusing tumor suppressor proteins with transmembrane peptides and targeting CEA proteins, the problems of difficult delivery and stability of tumor suppressor proteins in existing technologies are solved, achieving highly efficient targeted anti-cancer effects, especially significant inhibition of colorectal cancer.
Patent Information
- Application Number
- CN202511421753.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-30
- Publication Date
- 2026-01-09
AI Technical Summary
Existing anticancer drugs have difficulty effectively crossing the cell membrane to deliver intracellular tumor suppressor proteins such as p53, and the intracellular instability and low thermal stability of tumor suppressor proteins limit their anticancer effects. Currently, there is a lack of targeted delivery technology, resulting in limited therapeutic effects on microsatellite stable colorectal cancer.
Design a fusion protein by fusing a tumor suppressor protein (such as p53 or p14ARF) with a transmembrane peptide and adding CEABP1 or CEABP2 protein that targets the colorectal cancer cell marker CEA to enhance its targeted delivery to cancer cells.
It achieved efficient delivery and stable expression of tumor suppressor proteins in cancer cells, significantly inhibiting the proliferation of colorectal cancer cells. Its anti-cancer effect was verified through cell experiments and mouse experiments.
Smart Images

Figure CN121293370A_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of biomedicine, and in particular to a p53 fusion protein based on the colorectal cancer biomarker CEA and its application in the preparation of drugs that inhibit colorectal cancer. Background Technology
[0002] Colorectal carcinoma (CRC), commonly known as colon cancer, is the third most common cancer worldwide. CRC is generally classified into nonhypermutated and hypermutated types. Nonhypermutated CRC is typically microsatellite stable (MSS) but chromosomally instable (CIN), accounting for approximately 84% of all CRC cases. Hypermutated CRC is typically microsatellite instable (MSI), involving mutations in DNA mismatch repair (dMMR) related proteins, accounting for approximately 16% of all CRC cases. Currently, anti-PD-1 / anti-PD-L1 antibody drugs are only effective against microsatellite instable CRC, with limited efficacy against microsatellite stable CRC.
[0003] Tumor suppressor proteins are a class of proteins encoded by tumor suppressor genes. They typically function in biological processes that regulate cell growth and proliferation, such as the cell cycle, cell signaling pathways, and apoptosis, thereby inhibiting cell proliferation. Unlike antibodies, which exist outside the cell, most tumor suppressor proteins are intracellular proteins. Currently known tumor suppressor proteins include p53, Rb, and p16. INK4A p14 ARF The following are listed: *Adenomatous polyposis coli* (APC), BRCA1, BRCA2, PTEN, Smad4 / DPC4, TSC1, TSC2, VHL, and suppressor of fused (Sufu). Among these, p53, Rb, and p16 are also mentioned. INK4A p14 ARF Tumor suppressor proteins function in the cell cycle pathway. However, mutations in tumor suppressor genes can cause these encoded tumor suppressor proteins to lose their negative regulatory function on cell proliferation, leading to uncontrolled cell growth and proliferation, which in turn can trigger cancer.
[0004] Mutations in the tumor suppressor protein p53 are frequently observed in colorectal cancer. The p53 protein is encoded by the TP53 gene, and mutations typically occur in advanced stages of colorectal cancer, i.e., the carcinoma stage. p53 protein mutations are present in 59% of patients with non-highly variant colorectal cancer. p53 primarily functions as a transcription factor, promoting the expression of the cdkn1a gene p21. CIP1 This protein inhibits various cyclin-CDK complexes, thus arresting the cell cycle; on the other hand, it promotes the expression of genes such as bax, noxa, and puma, thus promoting apoptosis in cancer cells; in addition, p53 also has functions independent of transcription factors.
[0005] Currently, anti-PD-1 / anti-PD-L1 antibodies are extracellular proteins and generally act outside the cell. Intracellular tumor suppressor proteins, however, are water-soluble and cannot cross the cell membrane to enter the cell. Only by delivering water-soluble intracellular tumor suppressor proteins to cancer cells via endocytosis or macropinocytosis using carriers such as cell penetrating peptides (CPPs) can the cell membrane barrier be effectively overcome, allowing the intracellular tumor suppressor proteins to enter the cancer cells and exert their function of inhibiting cancer cell proliferation. Polyarginine was used as a membrane-penetrating peptide to deliver p53 protein into cancer cells (Takenobu T, Tomizawa K, Matsushita M, LiST, Moriwaki A, Lu YF, Matsui H. Development of p53 protein transduction therapy using membrane-permeable peptides and the application to oral cancer cells. Molecular Cancer Therapeutics 1(12):1043-1049.(2002); Michiue H, Tomizawa K, Wei FY, Matsushita M, Lu YF, Ichikawa T, Tamiya T, Date I, Matsui H. The NH2terminus of influenza virus hemagglutinin-2subunit peptides enhances the antitumor potency of polyarginine-mediated p53 protein transduction. Journal of Biological Chemistry 280(9):8285-8289.(2005); Hitsuda T, Michiue H,Kitamatsu M,Fujimura A,Wang F,Yamamoto T,Han XJ,Tazawa H,Uneda A,Ohmori I,Nishiki T,Tomizawa K,Matsui H.A protein transduction method using oligo-arginine(3R)forthe delivery of transcription factors into cellnuclei.Biomaterials 33(18):4665-4672.(2012);Lu TC,Zhao GH,Chen YY,Chien CY,Huang CH,Lin KH,ChenSL.Transduction of recombinant M3-p53-R12 protein enhances human leukemiacell apoptosis. Journal of Cancer 7(10):1360-1373.(2016)). Choi et al. from Hallym University in South Korea used HIV-1 TAT transmembrane peptide to deliver p53 protein into cancer cells (Ryu J, Lee HJ, Kim KA, Lee JY, Lee KS, Park J, Choi SY. Intracellular delivery of p53 fused to the basic domain of HIV-1 Tat. Molecules and Cells 17(2):353-359. (2004)). Weisbart et al. from UCLA Medical Center in the United States attempted to use antibodies to deliver p53 protein into cancer cells (Hansen JE, Fischer LK, Chan G, Chang SS, Baldwin SW, Aragon RJ, Carter JJ, Lilly M, Nishimura RN, Weisbart RH, Reeves ME. Antibody-mediated p53 protein therapy prevents liver metastasis in vivo. Cancer Research 67(4):1769-1774. (2007)). Chan et al. from the Chinese University of Hong Kong used modified Bacillus thuringiensis Cry3Aa protein crystals to deliver p53 protein into cancer cells and found that it could enhance the inhibition of anti-PD-1 antibodies against triple-negative breast cancer (Yang Z, Lee MMM, Chan MK).Efficient intracellular delivery of p53protein by engineered protein crystals restores tumor suppressing function invivo. Biomaterials 271:120759. (2021); Yang Z, Sun JK, Lee MM, Chan MK. Restoration of p53 activity via intracellular protein delivery sensitizes triple negative breast cancer to anti-PD-1immunotherapy. Journal for Immunotherapy of Cancer10(9):e005068.(2022)). Tang Yi of UCLA used polyethylene glycol nanocapsules to deliver p53 protein into cancer cells (Zhao M, Liu Y, Hsieh RS, Wang N, Tai W, Joo KI, Wang P, Gu Z, Tang Y. Clickable protein nanocapsules for targeted delivery of recombinant p53 protein. Journal of the American Chemical Society 136(43):15319-15325.(2014)). However, these studies have some drawbacks, including low efficiency due to p53 protein escaping from lysosomes after delivery into cells, lack of targeted delivery to cancer cells, and a focus on cell experiments without in-depth mouse experiments.
[0006] Furthermore, cells contain various E3 ubiquitin ligases that use p53 as a specific substrate, such as Mdm2 (human Mdm2, also known as Hdm2), Pirh2, COP1, and ARF-BP1 / Mule. These ligases modify p53 protein through polyubiquitination, followed by degradation via the 26S proteasome. This results in p53 protein instability and a short half-life, limiting the ability of intracellularly delivered p53 protein to inhibit cancer cell proliferation. Currently, p53-based anticancer drugs have not been widely developed. In addition, the applicant's research found that, besides p53, other tumor suppressor proteins also generally exhibit low folding free energy barriers and poor thermal stability. Based on these findings, there are currently no reports of developing p53 and other tumor suppressor proteins into anticancer drugs. Summary of the Invention
[0007] To address the aforementioned issues, this application provides a novel protein-based anticancer drug that does not belong to existing anticancer drug types such as chemotherapy, small molecule targeted inhibitors, antibodies, CAR-T, ADC, and gene therapy. Instead, it is composed of a fusion of a tumor suppressor protein—a natural intracellular protein—with a delivery carrier—a transmembrane peptide. Furthermore, CEABP1 and CEABP2 proteins, which target the colorectal cancer cell tumor marker protein CEA, are added to this fusion protein to enhance the targeting of the complex.
[0008] To achieve the above-mentioned objectives, this application provides the following technical solution:
[0009] First, this application provides a fusion protein obtained based on the expression of a tumor suppressor protein and a transmembrane peptide p28 with the amino acid sequence shown in SEQ ID NO: 2. The tumor suppressor protein includes p53 protein or p14. ARF A type of protein.
[0010] Specifically, the aforementioned fusion protein includes any one of the following proteins:
[0011] 1) p28-p53 protein (441aa), whose amino acid sequence is shown in SEQ ID NO: 11;
[0012] 2) MMBP-TEV-p14 ARF (1-63)-linker-p28 protein (315aa): Its amino acid sequence is shown in SEQ ID NO.12.
[0013] Furthermore, the amino acid sequence of the fusion protein also includes an artificially designed protein sequence that targets and binds to the A3 domain of the colorectal cancer marker CEA. This artificially designed protein includes either CEABP1, as shown in SEQ ID NO: 6, or CEABP2, as shown in SEQ ID NO: 7.
[0014] Specifically, the aforementioned fusion protein includes any one of the following;
[0015] 3) p28-p53-CEABP1 protein (519aa); the amino acid sequence of the protein from position 1 to 441 is shown in SEQ ID NO: 11, and the amino acid sequence from position 442 to 519 is shown in SEQ ID NO: 6.
[0016] 4) CEABP1-p28-p53 protein (519aa); the amino acid sequence of the protein from position 1 to 78 is shown in SEQ ID NO: 6, and the amino acid sequence from position 79 to 519 is shown in SEQ ID NO: 11.
[0017] 5) CEABP2-p28-p53(533aa): The amino acid sequence of positions 1-92 of this protein is shown in SEQ ID NO: 7, and the amino acid sequence of positions 93-519 is shown in SEQ ID NO: 11.
[0018] Secondly, this application provides the use of at least one of the above-mentioned fusion proteins in the preparation of drugs for the prevention and treatment of colorectal cancer. Preferably, this use further includes p28-p53 protein and MBP-TEV-p14. ARF The use of a composition of (1-63)-linker-p28 protein in the preparation of a drug for the prevention and treatment of colorectal cancer; more preferably, the molar ratio of the two proteins in the composition is 1:1.
[0019] Third, this application also provides a drug for inhibiting colorectal cancer, the drug comprising at least one of the above-mentioned fusion proteins and a solvent, the solvent comprising one or more pharmaceutically acceptable carriers, diluents or excipients, such as phosphate-buffered saline (PBS), physiological saline, etc.
[0020] CEA is a polysaccharide-protein complex belonging to the glycoprotein family, called carcinoembryonic antigen-related cell adhesion molecule (CEACAM, also known as CEACAM5 or CD66). It contains an N-linked glycan chain, including an N-terminal signal peptide, an IgV / IgC domain, and a C-terminal adhesion domain. CEA is a commonly used tumor marker in clinical practice, widely used to predict the occurrence, development, and metastasis of CRC. Currently, standard chemotherapy used in clinical practice cannot distinguish between normal cells and cancer cells, leading to serious side effects such as hair loss, immune system failure, and infections. The CEACAM5 protein contains seven IgG domains, named N, A1, B1, A2, B2, A3, and B3 domains, facing the cell membrane from distal to proximal. Since the N, A1, and B1 domains are relatively far from the cell membrane, while the B3 domain is relatively close, the A3 and B2 domains of CEA were selected as the recognition targets for the artificially designed protein in this application.
[0021] This application will refer to pages 53 and 14. ARF This involves fusing p53-penetrating peptide-CEABP1 or CEABP2, designed proteins that can deliver proteins into cells and target and bind to CEA, a marker of colorectal cancer, with these proteins. Cell and mouse experiments are then conducted to screen for the fusion proteins that exhibit the best inhibitory effects on various tumors, and these proteins are then applied. Attached Figure Description
[0022] Figure 1 Four plasmids, pMALc2x-TEV-p28, penetratin, pep1, and TAT-EGFP-linker-p53, were used for expression at 16℃ for 18 h. MBP-TEV-CPP-EGFP-linker-p53 was then purified by MBP column affinity chromatography. Results showed low expression levels of the target protein and numerous impurity bands. In the figure, FT: effluent; P: precipitate / wash; E: elution; M: marker; lanes 2-5: MBP-TEV-p28-EGFP-linker-p53; lanes 7-10: MBP-TEV-penetratin-EGFP-linker-p53; lanes 12-16: MBP-TEV-pep1-EGFP-linker-p53; lanes 18-21: MBP-TEV-TAT-EGFP-linker-p53.
[0023] Figure 2 The results are for SDS-PAGE purified by Superdex 200 (10 / 300GL); in A, lanes 2-8 are penetratin-EGFP-p53, lanes 10-15 are p28-EGFP-p53, in B, lanes 1-6 are pep1-EGFP-p53, and lanes 8-14 are TAT-EGFP-p53 protein.
[0024] Figure 3 Four plasmids, pMALc2x-TEV-penetratin, p28, pep1, and TAT-linker-p53, were used to express the protein at 16℃ for 18h. The protein was then purified by MBP affinity chromatography and molecular sieve chromatography, resulting in four transmembrane peptide-p53 fusion proteins.
[0025] Figure 4 SDS-PAGE results of p28-p53 protein purified using a HiLoad 16 / 600 Superdex 200 column.
[0026] Figure 5 p14 ARF Sequence alignment results.
[0027] Figure 6 p14 ARF Based on the predicted structure of the MDM2 complex.
[0028] Figure 7 To use pMALc2x-EGFP-linker-TEV-linker-p14 ARF(1-63)-linker-p28 and pMALc2x-TEV-p14 ARF The (1-63)-linker-p28 plasmid was expressed at 16℃ for 18 h and then purified by MBP affinity chromatography.
[0029] MBP-EGFP-linker-TEV-linker-p14 ARF (1-63)-linker-p28 and
[0030] MBP-TEV-p14 ARF (1-63)-linker-p28; In the diagram, A and B are respectively...
[0031] MBP-EGFP-linker-TEV-linker-p14 ARF (1-63)-linker-p28, MBP-TEV-p14 ARF (1-63)-linker-p28 detection results; lane FT: effluent; P: precipitate; W: washing; EL: elution; M: marker.
[0032] Figure 8 Here are the SDS-PAGE results; A represents MBP-EGFP-linker-TEV-linker-p14. ARF (1-63)-linker-p28 protein superose 6 column purified SDS-PAGE results, B is MBP-TEV-p14. ARF (1-63)-linker-p28 protein purified by SDS-PAGE on HiLoad16 / 600 Superdex 200 column; each lane represents gel electrophoresis results of different numbers of tubes in molecular sieve chromatography for the two proteins.
[0033] Figure 9 A schematic diagram of the process for de novo design of binding proteins targeting the colorectal cancer tumor marker CEA.
[0034] Figure 10 A schematic diagram showing the predicted structure of CEABP1, a protein that binds to the A3 domain of CEA, a tumor marker for colorectal cancer, and its binding site on CEA.
[0035] Figure 11 A schematic diagram showing the predicted structure of CEABP2, a protein that binds to the B2 domain of CEA, a tumor marker for colorectal cancer, and its binding site on CEA.
[0036] Figure 12The results are SDS-PAGE of purified protein using a Superdex 200 (10 / 300GL) column; where AC represents CEABP2-p28-p53 protein, p28-p53-CEABP1 protein, and CEABP1-p28-p53 protein, respectively.
[0037] Figure 13 The results of experiments using transmembrane peptides p28, penetratin, pep1, and TAT to deliver HeLa cervical cancer cells are presented.
[0038] Figure 14 The results of experiments using transmembrane peptides p28, penetratin, pep1, and TAT to deliver HCT116 colon cancer cells are presented. Figure 15 Cell delivery experiments were conducted to deliver the transmembrane peptide p28, which involved the purification of exogenous MBP-TEV-p14. ARF (1-63)-linker-p28) protein is delivered into HCT116 colorectal cancer cells.
[0039] Figure 16 The results of qRT-PCR detection of cdkn1a and bax gene mRNA after p28-p53 protein delivery to HCT116 and LS174T colon cancer cells are shown in the figure. In the figure, A represents the expression results of cdkn1a-related genes in HCT116, LS174T and HeLaB cells, and B represents the expression results of bax-related genes in HCT116 and LS174T cells.
[0040] Figure 17 To integrate p28-p53 protein, MBP-TEV-p14 ARF (1-63)-linker-p28 protein was delivered to HCT116 colorectal cancer cells, and then qRT-PCR detection of cdkn1a gene mRNA was performed. The results showed that purified exogenous p53 protein promoted the transcription of cdkn1a and bax genes after being delivered into colorectal cells.
[0041] Figure 18 The results of qRT-PCR detection of cdkn1a and bax gene mRNA after delivery of CEABP1-p28-p53, p28-p53-CEABP1, and CEABP2-p28-p53 proteins to LS174T colorectal cancer cells are shown. Among them, A represents the expression detection results of cdkn1a-related genes, and B represents the expression detection results of bax-related genes.
[0042] Figure 19The results of TUNEL assay after the purified exogenous p53 protein was delivered into HCT116 or HeLa cells by the transmembrane peptide p28; red in the figure represents cells that underwent apoptosis, and blue represents the cell nucleus. It can be seen that the exogenous p53 protein delivered into HCT116 or HeLa cells promoted the occurrence of apoptosis.
[0043] Figure 20 The results are shown by flow cytometry after different transmembrane peptides were used to deliver purified exogenous p53 protein into HCT116 cells. A and B are the results of p53 delivery using transmembrane peptides GFP and p28, respectively. It can be seen that HCT116 cells experienced cell cycle arrest and the proportion of cells in the G0 / G1 phase increased significantly.
[0044] Figure 21 Photographs of culture dishes used in colony formation experiments; it was found that four transmembrane peptides, p28, penetratin, pep1, and TAT, significantly slowed cell proliferation after delivering purified exogenous p53 protein into HCT116 cells.
[0045] Figure 22 The results represent the statistical results of cell proliferation; where AE represents the PBS control group, pep1-p53 group, penetratin-p53 group, TAT-p53 group, and p28-p53 group, respectively.
[0046] Figure 23 The results are from the colony formation experiment; in this experiment, AD represents the PBS control group, the p28-p53 protein group, the p28-p53+MDM2 group, and the p28-p53+MDM2+p14-p28 group, respectively, demonstrating the simultaneous delivery of exogenous p53 protein and p14 protein. ARF When p53 protein was delivered to HCT116 cells, the cell proliferation was slowed down significantly more than when p53 protein was delivered alone.
[0047] Figure 24 The results of the CCK8 assay after exogenous p53 protein was delivered into cells using the transmembrane peptide p28 are shown. Among them, A is the result of NCM460 assay in normal colon cells, and B and C are the results of CCK8 assay in HCT116 and LS174T colon cancer cells, respectively. It can be seen that cell growth and proliferation were significantly inhibited in a way that depended on the protein concentration gradient.
[0048] Figure 25The results of CCK8 assays in NCM460, HCT116, and LS174T cells at 24, 48, and 72 hours after the delivery of exogenous p53 protein into these cells using the transmembrane peptide p28 were shown. In the figure, A represents the results of normal NCM460 colon cells, while B and C represent the CCK8 assay results of HCT116 and LS174T colon cancer cells, respectively. It is evident that cell growth and proliferation were significantly inhibited at 24, 48, and 72 hours, while normal NCM460 colon cells remained unaffected.
[0049] Figure 26 To investigate the CCK8 assay results of LS174T colorectal cancer cells after CEABP1 fusion to the C-terminus of p28-p53 for protein delivery, it was found that the growth of LS174T colorectal cancer cells was significantly inhibited compared to the delivery of p28-p53 protein.
[0050] Figure 27 The results are from fluorescence detection of normal NCM460 cells.
[0051] Figure 28 The results are from fluorescence detection of HCT116 cells.
[0052] Figure 29 The results of fluorescence detection of LS174T colorectal cancer cells.
[0053] Figure 30 To evaluate the effect of p28-p53 protein delivery on the proliferation ability of colon cancer cells based on the EdU experiment; A and B are the statistical results of normal cells NCM460 and colon cancer cells HCT116, respectively; the statistical proportions of the EdU proliferation experiment results are expressed as mean ± standard error (n=9), *** represents p<0.001, **** represents p<0.0001, and ns represents no statistical significance.
[0054] Figure 31 This shows the change in tumor volume in mice over time.
[0055] Figure 32 This shows the change in mouse body weight over time.
[0056] Figure 33 This shows the change in tumor volume in mice over time.
[0057] Figure 34 This shows the change in mouse body weight over time.
[0058] Figure 35 This shows the change in tumor volume in mice over time.
[0059] Figure 36 The tumor weight of the mice is shown on the last day of the experiment.
[0060] Figure 37 This shows the change in mouse body weight over time.
[0061] Figure 38 The results of qRT-PCR experiments on the p53 target genes cdkn1a and bax in mouse tumor tissue on the last day are statistically analyzed; where A and B are the statistical results of cdkn1a and bax genes, respectively.
[0062] Figure 39 This shows the change in tumor volume in mice over time.
[0063] Figure 40 This shows the change in tumor volume in mice over time.
[0064] Figure 41 The tumor weight of the mouse on the last day.
[0065] Figure 42 This shows the change in mouse body weight over time.
[0066] Figure 43 The qRT-PCR statistics of p53 target genes cdkn1a and bax in mouse tumor tissue on the last day are shown; where A and B are the statistical results of cdkn1a and bax related genes, respectively.
[0067] Figure 44 The results of apoptosis examination of mouse tumor tissue cells on the last day.
[0068] Figure 45 H&E staining analysis of various organ tissues of mice on the last day. Detailed Implementation
[0069] The following examples are divided into three stages: heterologous protein expression and in vitro purification, cell experiments, and mouse experiments. In the first stage, the cDNA of the fusion protein of human p53 and various transmembrane peptides was cloned into the E. coli expression plasmid, and heterologous expression was performed using E. coli BL21(DE3) strain. The protein was then purified in vitro by affinity chromatography, ion exchange chromatography, and molecular sieve chromatography to obtain a tumor suppressor protein with a purity of over 90%.
[0070] In the following examples, various tags were added to the N-terminus or C-terminus of the tumor suppressor protein p53, such as a histidine tag (amino acid sequence HHHHHH), a maltose-binding protein (MBP, amino acid sequence as shown in SEQ ID NO: 8) tag, and an enhanced green fluorescence protein (EGFP, amino acid sequence as shown in SEQ ID NO: 9) tag. An attempt was made to add a TEV protease cleavage site (sequence ENLYFQG) and a linker peptide (amino acid sequence as shown in SEQ ID NO: 10) to cleave the tags after affinity chromatography purification, allowing for heterologous protein expression and in vitro purification. Based on this complex, CEABP1 or CEABP2 proteins targeting the tumor marker CEA on the colorectal cancer cell membrane were designed de novo to enhance the targeting of this protein drug.
[0071] The second stage is cell experiments. After obtaining the purified p53-membrane-penetrating peptide fusion protein through heterologous expression and in vitro purification in the first stage, cell delivery experiments were conducted in HCT116, LS174T colorectal cancer cells, and HeLa cervical cancer cells. Cell proliferation, cell cycle, apoptosis, and the key target gene cdkn1a (encoding p21) of p53 were detected. CIP1 The study examined changes in the mRNA levels of p53 (encoding Bax protein). Then, fusion of CEABP1 or CEABP2 proteins, which target the colon cancer cell tumor marker protein CEA, with the membrane-penetrating peptide p53 was performed again to observe whether it could further enhance the anti-tumor effect of p53 protein. HeLa and NCM460 cells were preserved in the applicant's laboratory and were standard experimental cells. HCT116 cells were purchased from Sewell, and LS174T cells were purchased from Pronosei.
[0072] The third stage is mouse experiments. BALB / c nude mice (with a homozygous mutation at the nude gene locus in linkage group VIII, resulting in congenital thymus deficiency and lack of immune response, making them a commonly used model animal for cancer and drug research) were used for subcutaneous tumorigenesis experiments. The in vivo antitumor effect of the tumor suppressor protein was verified by tail vein administration.
[0073] The plasmid (vector) and protein construction involved in the examples were commissioned to BGI Genomics.
[0074] The DMEM high-glucose medium used in the examples was purchased from Corning Incorporated; complete medium was obtained by adding 10% fetal bovine serum (purchased from Bovogen) to the DMEM high-glucose medium.
[0075] Example 1: Cloning, Heterologous Expression, and In Vitro Purification Results of Tumor Suppressor Protein p53
[0076] 1. Plasmid construction
[0077] This embodiment constructs two types of p53-related plasmids for different purposes.
[0078] The first type is to obtain pure p53 protein with a green fluorescent tag so that it can be tested in subsequent experiments to see if the protein can be delivered into cells; the second type of plasmid is to express pure, non-tagged, and functional p53 protein.
[0079] 1.1) Construct four expression plasmids for the transmembrane peptide p53 tagged with green fluorescent protein (GFP): pMALc2x-TEV-p28, penetratin, pep1, and TAT-EGFP-linker-p53.
[0080] The p53 protein is expressed with an N-terminus containing an MBP tag, a TEV restriction site, different transmembrane peptides (p28, penetratin, pep1, TAT), an EGFP tag, a linker sequence, and a p53 protein, respectively. The expression sequences are: MBP-TEV-CPP-EGFP-linker-p53, MBP-TEV-penetratin-EGFP-linker-p53, MBP-TEV-pep1-EGFP-linker-p53, and MBP-TEV-TAT-EGFP-linker-p53.
[0081] 1.2) Four p53 expression plasmids without fluorescent tags: pMALc2x-TEV-p28, penetratin, pep1, and TAT-linker-p53:
[0082] The expression contains, sequentially, an MBP tag, a TEV restriction site (SEQ ID NO: 20), different transmembrane peptides (p28, penetratin, pep1, TAT), a linker sequence, and p53 protein (SEQ ID NO: 1) at the N-terminus, namely MBP-TEV-CPP-linker-p53.
[0083] 2. Results of p53 protein expression and purification
[0084] 2.1) Expression and purification results of the membrane-penetrating peptide p53 protein tagged with green fluorescent GFP
[0085] Expression and purification of four plasmids: pMALc2x-TEV-p28, penetratin, pep1, and TAT-EGFP-linker-p53. These plasmids were induced at 16℃ for 18 h, and the proteins were purified by MBP column affinity chromatography. The results are as follows: Figure 1 As shown, the target protein, which was specifically induced and overexpressed, was present in both the effluent and the eluent.
[0086] The above attempts explored the expression and purification of MBP-TEV-p28 / penetratin / pep1 / TAT-EGFP-linker-p53 proteins, ultimately yielding suitable proteins. The final determined protocol involved inducing the expression and purification of four plasmids: pMALc2x-TEV-p28, penetratin, pep1, and TAT-EGFP-linker-p53, at 16℃ for 18 hours. Following this, MBP affinity chromatography was performed. TEV enzyme (protein to enzyme mass ratio of 20:1, the same below) and β-mercaptoethanol (protein to β-mercaptoethanol volume ratio of 1000:1, i.e., 1 μL of β-mercaptoethanol per 1 mL of protein, the same below) were added to the chromatographically extracted protein. The mixture was incubated overnight at 4℃ for enzyme digestion. After digestion, the protein was concentrated and then subjected to Superdex 200 molecular sieve chromatography. The results are as follows: Figure 2 As shown, this purification method can yield a large quantity and relatively pure amount of the four transmembrane peptide p53 proteins tagged with EGFP, which can be used in subsequent delivery experiments to observe whether the proteins can enter cells.
[0087] 2.2) Expression and purification results of p53 protein without green fluorescent GFP tag
[0088] The expression and purification protocol was as follows: pMALc2x-TEV-p28, penetratin, pep1, and TAT-linker-p53 plasmids were induced at 16℃ for 18 h, respectively. The proteins were then purified by MBP affinity chromatography. TEV enzyme (protein to enzyme mass ratio 20:1) and β-mercaptoethanol (protein to β-mercaptoethanol volume ratio 1000:1) were added to the purified proteins, and the mixture was incubated overnight at 4℃. After digestion, the protein was concentrated and subjected to molecular sieve chromatography. The results are as follows: Figure 3 As shown, penetratin-p53, p28-p53, pep1-p53, and TAT-p53 proteins with high purity have been obtained and can be used for subsequent experiments.
[0089] Figure 4The results of SDS-PAGE analysis of p28-p53 protein purified by Superdex 200 column are shown. The amino acid sequence of the protein is shown in SEQ ID NO: 11, and its sequence contains a 20aa linker sequence (SEQ ID NO: 10).
[0090] Example 2: Regarding the tumor suppressor protein p14 ARF Cloning construction, expression, and purification results
[0091] The Mdm2 (also known as Hdm2) protein acts as an E3 ubiquitin ligase, binding to p53, ubiquitinizing it, and then degrading it via the 26S proteasome pathway. Therefore, Mdm2 is a proto-oncoprotein that can promote cell proliferation by negatively regulating p53. (p14) ARF The protein can bind to Mdm2 via its N-terminal peptide, inhibiting Mdm2's negative regulation of p53, thereby stabilizing the p53 protein and inhibiting cell proliferation. p14 ARF The homologous similar protein of this protein in mice is called p19. ARF .
[0092] This embodiment performed sequence alignment of the p14 gene in different ethnic groups, and the results are as follows: Figure 5 As shown, it was found that the p14-MDM2 complex exhibits high conservation in amino acids 1-63, and the complex was predicted using alphafold3, with the results as follows. Figure 6 As shown, this further proves p14 ARF It mainly binds to MDM2 through its N-terminal 1-63 amino acids.
[0093] For p14 ARF In this example, different p14 proteins were used for experiments, one of which was p14 protein carrying the green fluorescent protein EGFP. ARF The protein was used to observe protein delivery efficiency; a p14 protein without an EGFP tag was used. ARF Proteins. This example cloned and constructed several full-length human p14 proteins as shown in Table 1 below. ARF Protein expression plasmids:
[0094] Table 1, p. 14 ARF Protein expression status
[0095]
[0096] Experimental results show that the above plasmids are effective against p14. ARF The expression and purification effects were not ideal, so only two proteins with the MBP tag could be used for the experiment: MBP-EGFP-linker-TEV-linker-p14. ARF(amino acid residues 1-63)-linker-p28 and MBP-TEV-p14 ARF (Amino acid residues 1-63)-linker-p28. Its expression detection results are as follows: Figure 7 As shown in the figure, the results indicate that the expression level of the target protein is low and there are many impurity bands.
[0097] MBP-EGFP-linker-TEV-linker-p14 ARF (1-63)-linker-p28 and
[0098] MBP-TEV-p14 ARF (1-63)-linker-p28 plasmid expression and purification: Expression was induced at 16℃ for 18h, the protein was purified by MBP affinity chromatography, and then subjected to molecular sieve chromatography. The expression detection results are as follows: Figure 8 As shown, the optimized MBP-EGFP-linker-TEV-linker-p14 was obtained. ARF (1-63)-linker-p28 (its amino acid sequence is shown in SEQ ID NO: 13) and MBP-TEV-p14 ARF (1-63)-linker-p28 protein (its amino acid sequence is shown in SEQ ID NO: 12).
[0099] Example 3: Design a protein that targets and binds to the colorectal cancer marker CEA, and fuse it with p53 protein for expression and purification.
[0100] like Figure 9 As shown, this example employs RFdiffusion technology based on a diffusion model for de novo construction of the binding protein backbone. By introducing noise into the initially randomly arranged amino acid residues, and considering the CEA structure, noise is progressively reduced through multiple iterations to simulate the dynamic evolution of the protein in a physiological environment, ultimately generating a backbone structure with ideal folding and spatial complementarity to specific binding sites on the CEA. During this process, energy functions and geometric constraints are used to optimize the backbone, avoiding the influence of local potential wells. In each iteration, the backbone is evaluated and modified based on the structural characteristics of the target protein to better match the binding interface or functional region on the CEA surface, ultimately selecting a design scheme with high stability and strong complementarity.
[0101] The ProteinMPNN method was used for amino acid sequence design. This method, based on graph neural networks, integrates spatial and energy information through a message-passing mechanism to select the most suitable amino acid type for each residue position, ensuring a high degree of sequence-backbone matching and good stable folding potential. In the design of CEA-binding proteins, ProteinMPNN particularly focused on optimizing the hydrophobic core, hydrogen bond network, and salt bridge at the interface, significantly improving binding affinity and specificity.
[0102] Using a two-step "backbone-sequence" approach, a series of protein ligands with high binding affinity, stability, and expression capacity were designed by inputting parameters such as the three-dimensional structure of the CEA protein, hotspot residues, and noise denoising scale. RFdiffusion technology solved the problems of spatial geometric constraints and functional residue carrying capacity, while the ProteinMPNN method ensured stable folding and highly selective binding of the residue combinations. The synergistic effect of these two methods improved the functionality and expressibility of the designed proteins.
[0103] Finally, AlphaFold3 and Rosetta were used to exclude poorly folded sequences. Then, the binding of the protein to the target protein was evaluated to reduce the false positive rate. AlphaFold3 was used to predict the protein complex structure, focusing on indicators such as PAE and RMSD to assess the stability of the interface; Rosetta was used to quantify the binding interface free energy, analyze interaction characteristics such as hydrogen bonds and spatial complementarity, correct potential problems, and conduct multiple rounds of iterative optimization. Using a custom weighting function, combined with the evaluation indicators of AlphaFold3 and the energy function of Rosetta, after multiple rounds of screening and redesign, dozens of sequences were finally selected. Molecular dynamics simulations were used to observe the dynamic interaction between the protein and the target protein, assess the stability of the binding interface, and screen for dynamically stable, specifically binding structures.
[0104] Further, 4-5 target proteins with EGFP fluorescent protein were synthesized for each domain to detect the binding ability of CEA protein. Through a series of experiments, artificially designed binding proteins CEABP1 (amino acid sequence: SEQ ID NO: 6) targeting the A3 domain of CEA and CEABP2 (amino acid sequence: SEQ ID NO: 7) targeting the B2 domain of CEA were finally screened. Figure 10 , Figure 11 These are schematic diagrams showing the predicted structures of CEABP1 and CEABP2, which are binding proteins to the A3 domain of CEA, a tumor marker for colorectal cancer, and their binding sites on CEA.
[0105] CEABP1 and CEABP2 were fused to the N-terminus or C-terminus of the p28-p53 protein for expression. The enhancing effect of CEABP1 and CEABP2 on the inhibition of colorectal cancer cells by p28-p53 protein was investigated. The specific protein expression and purification methods are as described in Example 1. In this example, after designing and obtaining the amino acid sequences of CEABP1 and CEABP2, BGI Genomics Co., Ltd. synthesized them into the pET28a-EGFP vector, and then cloned them into the N-terminus or C-terminus of p53 in the pMAL-C2x-p28-p53 vector by PCR and homologous recombination.
[0106] SDS-PAGE results of CEABP2-p28-p53 protein, p28-p53-CEABP1 protein, and CEABP1-p28-p53 protein purified by Superdex 200 (10 / 300GL) column are as follows: Figure 12 As shown, CEABP2-p28-p53 protein, p28-p53-CEABP1 protein, and CEABP1-p28-p53 protein have been successfully obtained.
[0107] Example 4 Cell Experiment
[0108] In this embodiment, pure p28-p53 protein and MBP-TEV-p14 were obtained through heterologous expression and in vitro purification as described in Examples 1-2. ARF Cell delivery experiments were conducted on (1-63)-linker-p28 proteins and their corresponding EGFP-tagged proteins in HCT116 colorectal cancer cells and HeLa cervical cancer cells.
[0109] First, the cell delivery assay of the tumor suppressor protein tagged with green fluorescent protein was used to examine the transmembrane peptide-p53 / p14 purified in Examples 1-2. ARF The study aimed to assess the delivery efficiency of proteins into cancer cells, thereby screening for transmembrane peptides that can efficiently deliver various tumor suppressor proteins into cancer cells. Next, purified, tag-free p28-p53 protein was delivered into HCT116 and LS174T colon cancer cells, and quantitative reverse transcription-polymerase chain reaction (qRT-PCR) experiments were performed to investigate whether the p53 protein expressed and purified in Example 1 could promote the transcription of its target genes such as cdkn1a and bax after delivery into colorectal cancer cells. The study also included the addition of p14... ARFThe study explored whether the incorporation of artificially designed target proteins CEABP1 or CEABP2 could further enhance the inhibition of transcription of target genes. Flow cytometry was used to perform cell cycle assays and TUNEL (TdT-mediated dUTP Nick-End Labeling) assays to investigate whether proteins such as p53, after being delivered into colorectal cancer cells, could exert their biological functions, such as inhibiting the cell cycle and promoting apoptosis. Colony formation assays and CCK8 assays were performed in HCT116 or LS174T colorectal cancer cells to investigate whether various expressed and purified proteins, after being delivered into colorectal cancer cells, could inhibit the growth of colorectal cancer cells.
[0110] 1. Cell delivery experiment of p53 protein
[0111] This embodiment demonstrates the cell delivery of p53 tagged with EGFP to four different types of transmembrane peptides in HCT116 colorectal cancer cells or HeLa cervical cancer cells. The delivery experiments were performed using conventional methods in the art, and the reference in this embodiment is "Palm-Apergi, C., Dowdy, SF (2022). Protein Delivery by PTDs / CPPs. In: Langley, (eds) Cell Penetrating Peptides. Methods in Molecular Biology, vol 2383. Humana, New York, NY. https: / / doi.org / 10.1007 / 978-1-0716-1752-6_17” The method disclosed is as follows.
[0112] Test results as follows Figure 13 , Figure 14 As shown, the transmembrane peptides p28, penetratin, pep1, and TAT can all successfully deliver p53 protein (showing green) tagged with MBP-GFP into HCT116 cells or HeLa cervical cancer cells, with low cytotoxicity and normal cell morphology.
[0113] 2. p14 ARF Protein cell delivery experiments
[0114] This embodiment uses p14 with an EGFP tag. ARF The fusion protein of the protein and the p28 transmembrane peptide was used in cell delivery experiments in HCT116 colorectal cancer cells.
[0115] p14 ARFThe protein gene sequence was obtained from the NCBI database and synthesized by BGI Genomics into the pET28a-EGFP expression vector. However, experiments showed that the vector failed to successfully express p14. ARF The protein was therefore designed to link EGFP-linker-TEV-linker-p14. ARF (1-63aa) was cloned into the pMAL-C2x vector via PCR and homologous recombination to obtain the pMAL-C2x-EGFP-linker-TEV-linker-p14ARF(1-63aa). After expression and purification using MBP column affinity chromatography, the transmembrane peptide linker-p28 was cloned into the C-terminus of pMAL-C2x-EGFP-linker-TEV-linker-p14ARF(1-63aa) via PCR and homologous recombination to obtain the pMAL-C2x-EGFP-linker-TEV-linker-p14ARF(1-63aa)-linker-p28 vector. This was then processed using MBP column affinity chromatography and molecular sieve chromatography to obtain the MBP-EGFP-linker-TEV-linker-p14ARF(1-63aa)-linker-p28 vector. ARF Experiments were conducted using the (1-63aa)-linker-p28 vector, ultimately yielding the transmembrane peptide MBP-EGFP-linker-TEV-linker-p14. ARF (1-63)-linker-p28 protein (SEQ ID NO: 13). Its delivery results are as follows: Figure 15 As shown, this indicates that the protein can be successfully delivered into HCT116 cells, enter the nucleus (the nucleus is stained blue with DAPI), and has low cytotoxicity with normal cell morphology.
[0116] Example 5: qRT-PCR detection experiment
[0117] 1. The effect of p53 protein delivery in colorectal cancer cells on the transcription of target genes cdkn1a and bax.
[0118] p53 protein is a transcription factor that can bind to the promoter DNA sequences of its target genes, such as p21 and bax, promoting the transcription of genes like cdkn1a and bax. This embodiment uses quantitative reverse transcription-polymerase chain reaction (qRT-PCR) to examine the amount of cdkn1a mRNA and bax mRNA transcribed after the p28-p53 protein complex is delivered into HCT116 and LS174T colon cancer cells. This allows for the assessment of whether the purified exogenous p53 protein can function normally as a transcription factor after being delivered into cancer cells, promoting the transcription of target genes such as cdkn1a and bax.
[0119] The qRT-PCR assay composition was as follows: 5 μL of 2×MagicSYBR Mixture; 0.2 μL of PrimerForward (10 μM); 0.2 μL of PrimerReverse (10 μM); 50 ng of cDNA, with ddH2O added to a total volume of 10 μL. The assay program was: 95℃ for 30 seconds, 95℃ for 15 seconds, and 58℃ for 30 seconds, for a total of 45 cycles.
[0120] Test results as follows Figure 16 As shown, after the p28-p53 protein complex was delivered into HCT116, LS174T, and HeLa cells, the mRNA levels of cdkn1a and bax genes significantly increased. The internal control gene primers were: upstream primer: ATGTGGCCGAGGACTTTGATT (SEQ ID NO: 14), downstream primer: AGTGGGGTGGCTTTTAGGATG (SEQ ID NO: 15); the cdkn1a gene detection primers were: upstream primer: CTTTCTGGCCGTCAGGAACA (SEQ ID NO: 16), downstream primer: CTTCTATGCCAGAGCTCAACATGT (SEQ ID NO: 17); the bax gene detection primers were: upstream primer: TCAGGATGCGTCCACCAAGAAG (SEQ ID NO: 18), downstream primer: TGTGTCCACGGCGGCAATCATC (SEQ ID NO: 19).
[0121] 2. p53 protein and p14 ARF Effects of co-delivery on cdkn1a transcription
[0122] like Figure 17 As shown, the p28-p53 protein with the amino acid sequence shown in SEQ ID NO: 11 was delivered into HCT116 cells, transfected with the pcDNA-Mdm2 plasmid, and then delivered with MBP-TEV-p14. ARF qRT-PCR following delivery of (1-63)-linker-p28 (SEQ ID NO: 12) protein showed an increase in cdkn1a expression after delivery of p28-p53 protein, while transfection with Mdm2 inhibited cdkn1a expression. However, delivery of purified MBP-TEV-p14 protein resulted in an increase in cdkn1a expression. ARF The inhibition was reversed after delivery of the (1-63)-linker-p28 protein. Delivery of MBP-TEV-p14 can be analyzed. ARF (1-63)-linker-p28 protein can inhibit the degradation of p53 protein by Mdm2, thereby enhancing its function.
[0123] 3. Effects of CEABP1 and CEABP2 proteins on the transcription of target genes cdkn1a and bax by p28-p53 protein.
[0124] The de novo-designed CEA-binding proteins CEABP1 and CEABP2 were fused to the N-terminus or C-terminus of the p28-p53 protein, respectively, to obtain CEABP1-p28-p53, p28-p53-CEABP1, and CEABP2-p28-p53 proteins. These proteins were then delivered to LS174T colorectal cancer cells that highly express CEA. The expression levels of cdkn1a and bax were detected by quantitative real-time PCR to determine the enhancing effect of CEABP1 and CEABP2 targeting. The qRT-PCR results are as follows: Figure 18 As shown, this demonstrates the synergistic effect of CEABP1 and CEABP2 proteins on p28-p53 proteins.
[0125] Example 6: TUNEL (TdT-mediated dUTP Nick-End Labeling) Detection Experiment
[0126] p53 can promote the transcription of its target gene, bax, thereby increasing the expression level of Bax protein. Bax protein mainly functions in the apoptosis pathway. Bax protein antagonizes the apoptosis-inhibiting function of Bcl-2 protein, promoting the release of cytochrome c from mitochondria, thus leading to apoptosis. Based on this, this embodiment uses a TUNEL assay to detect apoptosis: when the genomic DNA of a cell is broken, the exposed 3... ′ -OH can be catalyzed by terminal deoxynucleotidyl transferase (TdT) to add fluorescein-labeled dUTP, which can then be detected by fluorescence microscopy.
[0127] In this embodiment, purified exogenous p53 protein was delivered into HCT116 colorectal cancer cells and HeLa cervical cancer cells using a transmembrane peptide. The TUNEL assay kit was then used to detect whether the delivered exogenous p53 protein could promote tumor cell apoptosis. The experimental results are as follows: Figure 19 As shown, when purified exogenous p53 protein was delivered into HCT116 and HeLa cells using the transmembrane peptide p28, the cells exhibited significant apoptosis. Figure 19 (The red dot in the middle).
[0128] Example 7 Cell Cycle Detection Experiment
[0129] p53 can promote the transcription of its target gene cdkn1a, thereby stimulating p21. CIP1 Protein expression levels are elevated. p21 CIP1The protein is a cell cycle inhibitor that can bind to and inhibit the Cdk-Cyclin protein complex, thereby causing cell cycle arrest and inhibiting cell proliferation.
[0130] This embodiment employs flow cytometry to detect cell cycle progression. Cells are sorted according to their cell cycle stage (G1, S, and G2 / M phases) using the flow cytometer, and the percentage of cells in each phase is obtained. In this embodiment, purified exogenous p53 protein was delivered into HCT116 colon cancer cells using the transmembrane peptide p28, and then analyzed by flow cytometry to obtain the percentage of cells in each cell cycle phase, thereby examining whether the delivery of exogenous p53 protein can promote cell cycle arrest. The experimental results are as follows: Figure 20 As shown, after the transmembrane peptide p28 delivered exogenous p53 protein into HCT116 cells, compared with the control group, the proportion of cells in G1 phase increased from 62.49% to 85.29%, the proportion of cells in S phase decreased from 8.35% to 5.82%, and the proportion of cells in G2 / M phase decreased from 29.16% to 8.89%. This indicates that when purified exogenous p53 protein is delivered into HCT116 cells, exogenous p53 protein induces cell cycle arrest in HCT116 cells.
[0131] Example 8: Colony Formation Assay
[0132] 1. p53 protein assay
[0133] This embodiment uses a colony formation assay to detect the rate of cell growth and proliferation. The operation steps are as follows: Take monolayer cultured cells in the logarithmic growth phase, digest them with 0.25% trypsin and pipette them into single cells, and suspend the cells in DMEM medium containing 10% fetal bovine serum for later use; dilute the cell suspension, seed 1000 cells per well in a 6-well plate, and culture in a cell culture incubator at 37°C for 10-12 days, changing the complete medium every 3 days during this period; stop the culture when visible clones appear in the culture dish; discard the original medium, wash twice with PBS buffer, add fixative (methanol:acetic acid = 3:1), fix at room temperature for 20 minutes, discard the fixative, wash with PBS, then add crystal violet staining solution for 15-20 minutes, then slowly wash away the staining solution with running water and air dry.
[0134] In this embodiment, four different transmembrane peptides, p28, penetratin, pep1, and TAT, were used to deliver purified exogenous p53 protein into HCT116 colorectal cancer cells to conduct colony formation experiments, and to investigate whether the exogenous p53 protein delivered into the cells could inhibit the proliferation of cancer cells. Figure 21 Photo of the culture medium. Figure 22 For statistical purposes, the above experimental results indicate that after the four transmembrane peptides delivered exogenous p53 protein to HCT116 colorectal cancer cells, the proliferation rate of HCT116 cells was indeed significantly slowed down. Among the four transmembrane peptides, p28 and TAT transmembrane peptides showed more significant inhibition of cell proliferation.
[0135] 2. p53 protein and p14 ARF Protein-protein coupling assay
[0136] In this embodiment, the membrane-penetrating peptide p28 was used to transmit purified exogenous p53 protein and p14 protein, respectively. ARF Protein (MBP-TEV-p14) ARF (1-63)-linker-p28) was delivered into HCT116 colorectal cancer cells, and colony formation assays were performed to examine the exogenous p14 delivered into the cells. ARF Can the protein further enhance the inhibitory effect of p53 protein on the proliferation of colorectal cancer cells?
[0137] Experimental results are as follows Figure 23 As shown, p53 protein and p14 ARF When the protein was co-delivered to HCT116 colorectal cancer cells, its inhibitory effect on tumor cell proliferation was significantly stronger than that of p53 protein alone.
[0138] Example 9: Detection of cell proliferation using the CCK8 assay
[0139] This embodiment uses the CCK-8 assay to detect cell viability and growth. The CCK-8 solution contains WST-8 (2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfonic acid benzene)-2H-tetrazole monosodium salt), which, in the presence of the electron coupling reagent 1-methoxy-5-methylphenazineonium sulfate dimethyl ester (1-methoxy PMS), can be reduced by mitochondrial dehydrogenases to a highly water-soluble orange-yellow formazan product. The amount of formazan generated is directly proportional to the number of viable cells. Therefore, this characteristic can be used to directly analyze cell proliferation and toxicity; the more and faster the cell proliferation, the darker the color; the greater the cytotoxicity, the lighter the color. Measuring the absorbance using an enzyme-linked immunosorbent assay (ELISA) reader indirectly reflects the number of viable cells.
[0140] In this embodiment, exogenous p53 protein purified from the transmembrane peptide p28 at different concentrations was delivered into HCT116, LS174T colon cancer cells, or NCM460 normal colon cells. The cell counts were measured after 72 hours. Alternatively, the same protein concentration was delivered, and the cell counts were measured every 24 hours using the CCK8 assay. The specific experimental steps are as follows: Cells were collected after protein delivery, the cell suspension concentration was adjusted, and cells were divided into 96-well plates (100 μL per well, 2000 cells / well). The cells were incubated at 37°C and 5% CO2 for 24 hours, 48 hours, and 72 hours, respectively. The supernatant was carefully aspirated, 90 μL of fresh culture medium was added, followed by 10 μL of CCK8 solution. The cells were incubated for another 4 hours, and the absorbance of each well was measured at 450 nm using an ELISA reader.
[0141] 1. p53 protein assay
[0142] Experimental results showed that after delivering different concentrations of exogenous p53 protein into NCM460 colon cells and HCT116 and LS174T colon cancer tumor cells using the transmembrane peptide p28, cck8 detection was performed after 72 hours. The detection results are as follows: Figure 24 As shown, colon cell growth was not significantly inhibited, while colon cancer cell growth was inhibited in a concentration gradient-dependent manner. Further, concentrations close to those at which colon cancer cell growth was inhibited by approximately 40% while normal colon cells were unaffected were selected, and the inhibitory effects were examined at different time points of 24h, 48h, and 72h on the three cell types. The results are shown below. Figure 25 As shown, after using the transmembrane peptide p28 to deliver exogenous p53 protein (at a concentration of 0.9375 μM) into HCT116 and LS174T colon cancer cells, cell growth and proliferation were significantly inhibited at 24, 48, and 72 h, while normal colon cells NCM460 were not affected.
[0143] 2. The synergistic effect of de novo-designed CEA-targeting proteins CEABP1 and CEABP2 on p28-p53 protein.
[0144] The targeted fusion proteins CEABP1-p28-p53, p28-p53-CEABP1, and CEABP2-p28-p53 were delivered to LS174T colon cancer cells that highly express CEA, and the results were as follows: Figure 26 As shown, increasing CEA targeting can significantly enhance the tumor-suppressing effect of p28-p53 protein.
[0145] Example 10 EdU Cell Proliferation Detection Experiment
[0146] EdU (5-ethynyl-2'-deoxyuridine) is a novel thymidine analog that can replace thymidine in the newly synthesized DNA during DNA synthesis. Simultaneously, the ethynyl group on EdU can covalently react with fluorescently labeled small azide probes (such as Azide Alexa Fluor 488, Azide Alexa Fluor 555, Azide Alexa Fluor 594, Azide Alexa Fluor 647, etc.) catalyzed by monovalent copper ions to form a stable triazole ring. Through this reaction, the newly synthesized DNA is labeled by the corresponding fluorescent probe, allowing the proliferation of cells to be detected using fluorescent detection equipment.
[0147] This embodiment describes the delivery of exogenous p53 protein purified from the transmembrane peptide p28 at different concentrations into HCT116, LS174T colon cancer cells, or NCM460 normal colon cells, with cell counts assessed after 72 hours. The specific steps are as follows: When cells are in good growth condition and the cell density reaches 80-90%, cells are digested, counted, and seeded into 96-well plates at 1000 cells / well. After static incubation overnight until cell attachment, the old culture medium is discarded, and protein at different molar concentrations is delivered. Cells are then cultured for another 48 hours. 2× EdU working solution is prepared by diluting EdU (10 mM) with complete culture medium to a 2× EdU working solution (20 μM). After 48 hours of culture, discard 50 μL of the original culture medium, retaining 50 μL. Add an equal volume of the previously prepared 2× EdU working solution (preheated to 37°C) to each well of a 96-well plate to achieve a final EdU concentration of 1×. Incubate for another 4 hours in a cell culture incubator. After EdU labeling, discard the culture medium, wash three times with PBS, add 100 μL of 4% paraformaldehyde to each well, and fix at room temperature for 15 minutes. Then discard the paraformaldehyde and wash each well three times with PBS for 3-5 minutes each time. Discard the PBS, add 100 μL of PBS solution containing 0.3% Triton X-100 to each well, and incubate at room temperature for 10-15 minutes. Discard the permeabilization buffer, and wash each well three times with PBS for 3-5 minutes each time. Prepare the Click Additive Solution according to the manufacturer's instructions, add 100 μL of Click reaction solution to each well, and incubate at room temperature in the dark for 30 minutes. Discard the Click reaction solution, and wash three times with PBS for 3-5 minutes each time. Prepare 1× Hoechst staining solution, add 100 μL of Hoechst solution to each well, incubate at room temperature in the dark for 10 minutes, discard the Hoechst staining solution, wash three times with PBS for 3-5 minutes each time, and photograph under a fluorescence microscope. Select 10-12 images from each group, then use ImageJ to count the number and proportion of EdU-positive cells in each image, and use GraphPad to plot the statistical graphs.
[0148] Figures 27-29 The fluorescence detection results for normal NCM460, HCT116, and LS174T colon cancer cells are shown below. The statistical results are as follows: Figure 30 As shown in the image, fluorescence microscopy captured images revealing a dose-dependent decrease in the intensity of EdU-positive signals in colon cancer cells delivered with p28-p53 protein, indicating inhibition of DNA synthesis. Quantitative analysis revealed a significant decrease in the proportion of EdU-positive cells in the p28-p53 delivery group compared to the control group, exhibiting a significant concentration-gradient-dependent inhibitory trend. This series of experiments further confirms that p28-p53 protein specifically interferes with the DNA synthesis process of colon cancer cells, thereby achieving selective proliferation inhibition, and that the intensity of this effect is positively correlated with drug concentration.
[0149] Example 11 Mouse Experiment
[0150] This embodiment uses BALB / c nude mice for subcutaneous tumorigenesis experiments. Cultured cancer cells (such as HCT116 colon cancer cells) were subcutaneously injected into the right axilla of the mice. Tumors formed one week later, and the mice were then divided into several groups according to experimental needs, including a negative control group, a positive control group, and a treatment group. Each group consisted of 5-10 BALB / c nude mice. Mice in the negative control group were injected with saline via the tail vein every three days. Mice in the positive control group were injected with saline-buffered saline containing cisplatin via the tail vein every three days. Mice in the treatment group were injected with saline-buffered saline containing a purified tumor suppressor protein and a certain membrane-penetrating peptide via the tail vein every three days. The length and width of the tumor were measured every three days, and the tumor volume was calculated using a formula commonly used in cancer research.
[0151]
[0152] To calculate tumor volume.
[0153] Simultaneously, mouse body weight was measured every three days to assess drug toxicity by observing any significant weight loss. Mice were administered the drug 5-8 times at a frequency of once every three days (or as a positive or negative control), and a series of tumor volume and body weight values were measured. Then, statistical methods were used to examine whether the candidate drug could effectively inhibit tumor growth and its toxic side effects.
[0154] Mouse experiment results:
[0155] 1. Fusion protein solution of membrane-penetrating peptide and p53
[0156] This study investigated whether complexes of various exogenously purified tumor suppressor proteins and transmembrane peptides could inhibit tumor growth in mice by subcutaneous tumor formation followed by intravenous administration via tail vein every three days.
[0157] First, HCT116 colon cancer cells cultured in vitro were subcutaneously injected into the right axilla of BALB / c nude mice at a rate of 2 million cells per mouse. Tumors formed one week later. The tumor-forming mice were then divided into 6 groups of 5 mice each. The groups were as follows:
[0158] Group 1: Negative control group, injected with physiological saline once every three days via tail vein, the injection dose is 200 μL / mouse; Group 2: Negative control group, injected with exogenous purified p53 protein solution (without membrane-penetrating peptides) once every three days via tail vein, the solvent is physiological saline (the same below), the injection dose is 10 mg / kg.
[0159] Group 3: p53 protein + penetrantin transmembrane peptide group, the exogenous purified penetrantin-p53 protein solution was injected once every three days via tail vein, the solvent was physiological saline, and the injection dose was 10 mg / kg.
[0160] Group 4: p53 protein + p28 membrane-penetrating peptide group, every three days, a solution of exogenously purified p28-p53 protein (its amino acid sequence is shown in SEQ ID NO: 11, the same below) was injected via tail vein, the solvent was physiological saline, and the injection dose was 10 mg / kg; Group 5: p53 protein + TAT membrane-penetrating peptide group, every three days, a solution of exogenously purified TAT-p53 protein was injected via tail vein, the solvent was physiological saline, and the injection dose was 10 mg / kg;
[0161] Group 6: Positive control group, cisplatin solution was injected into the tail vein every three days, with the solvent being physiological saline, and the injection dose was 25 mg / kg.
[0162] The above experiments involved a total of 6 administrations. Tumor length and width were measured every three days, and tumor volume was calculated. Mice were also weighed every three days. The results of tumor volume changes over time in mice are shown below. Figure 31 As shown, the change in mouse body weight over time is as follows: Figure 32 As shown.
[0163] 2. Study on the dosage of p28-p53 protein solution
[0164] This embodiment uses a reduced dosage to observe whether it can effectively inhibit tumor growth, while adding a negative control group of transmembrane peptide protein to rule out the inhibitory effect of transmembrane peptide protein itself on mouse tumors. In the experiment, HCT116 colon cancer cells cultured in vitro were injected subcutaneously into the right axilla of BALB / c nude mice at a rate of 2 million cells per mouse. Tumors formed one week later. The tumor-forming mice were then divided into 6 groups of 8 mice each: Group 1: Negative control group, receiving 200 μL of saline solution per mouse via tail vein every three days; Group 2: Negative control group, receiving 5 mg / kg of exogenously purified p28-GFP protein solution per mouse via tail vein every three days in saline solution.
[0165] Group 3: Negative control group, which received an injection of exogenously purified p28-GFP protein solution via tail vein every three days. The solvent was physiological saline, and the injection dose was 10 mg / kg.
[0166] Group 4: The experimental group received an injection dose of 5 mg / kg, with exogenous purified p28-p53 protein solution injected via the tail vein every three days. The solvent was physiological saline, and the injection dose was 5 mg / kg.
[0167] Group 5: The experimental group with an injection dose of 10 mg / kg received an injection of exogenously purified p28-p53 protein solution via the tail vein every three days. The solvent was physiological saline, and the injection dose was 10 mg / kg.
[0168] Group 6: Positive control group, cisplatin solution was injected into the tail vein every three days, with the solvent being physiological saline, and the injection dose was 25 mg / kg.
[0169] The drug was administered six times in total. Tumor length and width were measured every three days, and tumor volume was calculated. Mice were also weighed every three days. The results of tumor volume changes over time in the experimental mice are shown below. Figure 33 As shown, the change in mouse body weight over time is as follows: Figure 34 As shown.
[0170] The results of the mouse experiments above show that, compared with the negative control group, injection of purified p28-p53 protein solution at two doses (5 mg / kg and 10 mg / kg) significantly inhibited tumor growth in mice. In contrast, the same dose of p28-GFP protein in the negative control group did not inhibit tumor growth, further demonstrating that p53 protein, through the delivery of the transmembrane peptide p28, can inhibit mouse tumor growth. Furthermore, injection of purified p28-GFP protein and p28-p53 protein solution had no significant effect on mouse body weight, indicating that these drugs have no significant side effects. Compared with the 5 mg / kg injection dose, the 10 mg / kg dose did not produce a stronger inhibitory effect; in fact, mouse deaths occurred in the later stages of the experiment. Therefore, the 5 mg / kg dosage was chosen as the implementation plan for further research.
[0171] 3. p28-p53 protein and MBP-TEV-p14 ARF Study on the combined use of (1-63)-linker-p28 protein solution
[0172] In cell-level experiments, it was observed that simultaneous delivery of p53 and p14 proteins enhanced the inhibitory effect of p53 protein on tumor cell growth. Therefore, this embodiment designed a mouse experiment to simultaneously inject p53 and p14 proteins via tail vein to observe whether it could prolong the time of p53's inhibitory effect on tumor proliferation in vivo. Two dosing frequencies were set, and simultaneous delivery of p53 protein plus MBP protein was increased to exclude the effect of MBP protein. In the experiment, HCT116 colon cancer cells cultured in vitro were subcutaneously injected into the right axilla of BALB / c nude mice at a rate of 2 million cells per mouse. Tumors formed one week later. The tumor-forming mice were then divided into 7 groups of 7 mice each: Group 1: negative control group, injected with physiological saline (200 μL / mouse) via tail vein every three days; Group 2: experimental group, injected with exogenously purified p28-p53 protein solution (physiological saline) via tail vein every three days at a dose of 5 mg / kg.
[0173] Group 3: Positive control group, cisplatin solution was injected into the tail vein every three days, the solvent was physiological saline, and the injection dose was 25 mg / kg;
[0174] Group 4: Negative control group, injected with physiological saline once every six days via tail vein, the injection dose was 200 μL / mouse; Group 5: Experimental group, injected with exogenous purified p28-p53 protein plus MBP protein (molar ratio of 1:1) solution via tail vein once every six days, the solvent was physiological saline, the injection dose was 10 mg / kg.
[0175] Group 6: Experimental group, receiving exogenously purified p28-p53 protein (SEQ ID NO: 11) and MBP-TEV-p14 via tail vein injection every six days. ARF (1-63)-linker-p28 (SEQ ID NO: 12) protein solution (molar ratio of the two proteins is 1:1), solvent is physiological saline, injection dose is 10mg / kg;
[0176] Group 7: Positive control group, cisplatin solution was injected via tail vein once every six days, with the solvent being physiological saline, and the injection dose was 25 mg / kg.
[0177] The mice were administered the drug once every three days for a total of six doses, and once every six days for a total of three doses. Tumor length and width were measured and weighed every three days to calculate tumor volume. The first administration was recorded as Day 0, and the last administration as Day 15. Mice were sacrificed three days after the last administration, for a total of 18 days. The results of tumor volume changes over time in the experimental mice are shown below. Figure 35 As shown, the tumor weight of the mice on the last day of the experiment was as follows: Figure 36As shown, the change in mouse body weight over time is as follows: Figure 37 As shown, Figure 38 The results of qRT-PCR for the p53 target genes cdkn1a and bax in mouse tumor tissue on the last day of the experiment are statistically significant.
[0178] The results of the mouse experiments above show that, compared with the group that received p28-p53 once every six days, mice injected with purified p28-p53 and MBP-TEV-p14 showed significantly better results. ARF (1-63)-linker-p28 protein solution can more strongly inhibit tumor growth, even compared with the p28-p53 group administered once every three days, while simultaneously injecting MBP-TEV-p14. ARF Following the administration of (1-63)-linker-p28 protein, prolonged dosing time still achieved the same or even stronger inhibitory effect on tumor growth. On the last day, mice were sacrificed, and tumors were weighed; p28-p53+MBP-TEV-p14 was identified. ARF The tumor weight in mice in the (1-63)-linker-p28 protein group was significantly reduced compared to that in the p28-p53+MBP group, which also indicates that increased MBP-TEV-p14 ARF (1-63)-linker-p28 protein further enhances the tumor-inhibiting effect of p28-p53 protein, and this is not due to the action of the MBP-tagged protein. Compared with the experimental group, the chemotherapy drug cisplatin used in the positive control group killed cancer cells and normal cells equally, thus significantly reducing the weight of mice while inhibiting tumor growth. On the last day, RNA was extracted from mouse tumor tissue, reverse transcribed, and qPCR was performed to detect the expression of p53 downstream target genes cdkn1a and bax. Every 6 days, mice were simultaneously injected with p28-p53 protein and MBP-TEV-p14. ARF After using (1-63)-linker-p28 protein solution, the expression levels of cdkn1a and bax genes were further increased compared to using p28-p53 protein alone.
[0179] 4. Increase the binding proteins CEABP1 and CEABP2, which target the colorectal cancer tumor marker CEA protein, to enhance the anti-tumor effect of p28-p53.
[0180] This embodiment is based on the CEABP1 and CEABP2 proteins, which can bind to the surface of colon cancer, screened in Chinese cell experiments as described above. These proteins were fused with p28-p53 proteins, expressed, and purified to obtain CEABP2-p28-p53 and p28-p53-CEABP1 proteins. A mouse experiment was conducted by injecting CEABP2-p28-p53 and p28-p53-CEABP1 proteins via tail vein to observe whether they could enhance the tumor-inhibiting effect of p53 in vivo. Two rounds of animal experiments were performed.
[0181] First round of mouse experiments:
[0182] LS174T colon cancer cells, which are highly expressed in vitro and contain 8 million cells per mouse, were subcutaneously injected into the right axilla of BALB / c nude mice. Tumors formed one week later, and the tumors were allowed to grow to 100 mm². 3 Then, the mice with tumors were divided into 5 groups, with 7-8 mice in each group. The changes in tumor volume over time were as follows: Figure 39 As shown.
[0183] Second round of mouse experiments:
[0184] LS174T colon cancer cells, which are highly expressed in vitro and contain 8 million cells per mouse, were subcutaneously injected into the right axilla of BALB / c nude mice. Tumors formed one week later, and the tumors were allowed to grow to 100 mm². 3 Then, the tumor-bearing mice were divided into 5 groups, with 7-8 mice in each group. The groups were as follows:
[0185] Group 1: Negative control group, injected with physiological saline every three days via tail vein, with an injection dose of 200 μL / mouse; Group 2: Experimental group, injected with exogenous purified p28-p53 protein solution in physiological saline every three days via tail vein, with an injection dose of 5 mg / kg.
[0186] Group 3: Experimental group, p28-p53-CEABP1 solution was injected into the tail vein every three days. The solvent was physiological saline, and the injection dose was 6 mg / kg.
[0187] Group 4: Experimental group, receiving exogenously purified p28-p53 plus MBP-p14 via tail vein injection every three days. (1-63) -p28 protein (molar ratio 1:1) solution, with physiological saline as solvent, injection dose 10mg / kg;
[0188] Group 5: Positive control group, cisplatin solution was injected into the tail vein every three days, with the solvent being physiological saline, and the injection dose was 25 mg / kg;
[0189] The drug was administered once every three days for a total of six administrations. The length and width of the tumor were measured and weighed every three days, and the tumor volume was calculated. The first administration was recorded as Day 0, and the last administration as Day 15. The mice were sacrificed three days after the last administration, for a total of 18 days.
[0190] The change in tumor volume in mice over time is as follows: Figure 40 As shown, the tumor weight of the mice on the last day was as follows: Figure 41 As shown, Figure 42 This shows the change in mouse body weight over time. Figure 44 The results of microscopic examination of apoptosis in mouse tumor tissue on the last day. Figure 45 The results of H&E staining analysis of various organs and tissues of mice on the last day.
[0191] The above experimental results show that the above embodiments, targeting the CEA A3 domain binding protein and the p28-p53 fusion protein p28-p53-CEABP1, can enhance the inhibitory effect of p28-p53 protein on subcutaneous tumors in mice, and the effect is stronger than that of CEABP2-p28-p53 protein targeting the CEA B2 domain. On the last day of the mouse experiment, the tumor weight of the mice was also lower than that of the p28-p53 group, and there was no significant decrease in mouse body weight, spleen enlargement, or pathological changes in any organs. TUNEL staining of the mouse tumor tissue on the last day (…) Figure 44 ), it can be seen that it is similar to p14 ARF The combination of proteins and the addition of CEABP1 to target CEA in colorectal cancer cells resulted in more apoptosis, demonstrating that the protein CEABP1 designed in this embodiment to target the colorectal cancer marker CEA is safe and effective.
Claims
1. A p53 fusion protein based on the colorectal cancer marker CEA, characterized in that, The fusion protein is any one of the following proteins 1)-5): 1) p28-p53 protein, the amino acid sequence of which is shown in SEQ ID NO: 11; 2) MBP-TEV-p14 ARF (1-63)-linker-p28 protein: its amino acid sequence is shown in SEQ ID NO.12; 3) p28-p53-CEABP1 protein; its amino acid sequence from position 1 to 441 is shown in SEQ ID NO: 11, and its amino acid sequence from position 442 to 519 is shown in SEQ ID NO: 6; 4) CEABP1-p28-p53 protein; its amino acid sequence from position 1 to 78 is shown in SEQ ID NO: 6, and its amino acid sequence from position 79 to 519 is shown in SEQ ID NO: 11; 5) CEABP2-p28-p53: The amino acid sequence at positions 1-92 is shown in SEQ ID NO: 7, and the amino acid sequence at positions 93-519 is shown in SEQ ID NO:
11.
2. The use of at least one fusion protein as described in claim 1 in the preparation of a drug for inhibiting colorectal cancer.
3. The application as described in claim 2, characterized in that, The fusion protein is the p28-p53 protein and the MBP-TEV-p14 protein. ARF Composition of (1-63)-linker-p28 protein.
4. The application as described in claim 3, characterized in that, In the composition, the p28-p53 protein and the MBP-TEV-p14 ARF The molar ratio of (1-63)-linker-p28 protein is 1:
1.
5. A drug for treating colorectal cancer, characterized in that, The drug comprises at least one of the following proteins 1)-5): 1) p28-p53 protein, the amino acid sequence of which is shown in SEQ ID NO: 11; 2) MBP-TEV-p14 ARF (1-63)-linker-p28 protein: its amino acid sequence is shown in SEQ ID NO.12; 3) p28-p53-CEABP1 protein; its amino acid sequence from position 1 to 441 is shown in SEQ ID NO: 11, and its amino acid sequence from position 442 to 519 is shown in SEQ ID NO: 6; 4) CEABP1-p28-p53 protein; its amino acid sequence from position 1 to 78 is shown in SEQ ID NO: 6, and its amino acid sequence from position 79 to 519 is shown in SEQ ID NO: 11; 5) CEABP2-p28-p53: The amino acid sequence of its positions 1-92 is shown in SEQ ID NO: 7, and the amino acid sequence of its positions 93-519 is shown in SEQ ID NO:
11.
6. The drug as described in claim 5, characterized in that, The drug includes the p28-p53 protein and the MBP-TEV-p14. ARF (1-63)-linker-p28 protein.