Application of GmRALF4 gene in inhibition of shading-induced soybean stem elongation

Abstract

The invention discloses an application of a rapid alkalization factor GmRALF4 gene and an encoded protein thereof in inhibition of shade-induced soybean stalk elongation, which comprises the following steps: amplifying an encoded nucleotide sequence of the soybean rapid alkalization factor GmRALF4 gene, and carrying out carrier recombination by adopting a seamless connection method; the coding nucleotide sequence of the soybean rapid alkalization factor GmRALF4 gene is efficiently cloned to a pBF vector; positive transformed seedlings are obtained through herbicide resistance screening of the transformation receptor endowed with the herbicide-resistant marker gene. The soybean rapid alkalization factor GmRALF4 gene disclosed by the invention has a remarkable inhibition effect on shading-induced soybean stem elongation, the result is accurate and reliable, and the regulation and control method is simple and convenient to operate, can be formulated and is easy to popularize and apply.

Description

Technical Field

[0001] This invention relates to the fields of botany and plant genetic engineering technology, specifically to a rapid alkalization factor that inhibits shade-induced soybean plant height. GmRALF4 Applications of genes and their encoded proteins. Background Technology

[0002] my country is the world's largest consumer of soybeans, with annual consumption exceeding 100 million tons. However, due to limited land area, my country's soybean production falls far short of the industry's demand, with over 80% of soybeans imported. On limited arable land, dense planting and intercropping are important ways to improve my country's soybean self-sufficiency rate. However, under these planting patterns, soybeans are shaded by neighboring crops, and most soybean varieties exhibit excessive stem elongation. Therefore, developing shade-tolerant soybean varieties is of great significance for increasing my country's soybean yield. Summary of the Invention

[0003] This invention provides a rapid alkalization factor to inhibit shade-induced soybean stem elongation. GmRALF4 The application of genes and their encoded proteins, through overexpression GmRALF4 The coding sequence of a gene, GmRALF4 This invention can significantly inhibit shade-induced soybean stem elongation. The invention is achieved through the following technical solution:

[0004] A gene for inhibiting shade-induced soybean stem elongation, said gene derived from soybean rapid alkalization factor. GmRALF4 The gene's coding nucleotide sequence is shown in SEQ ID NO.1, its full-length genome nucleotide sequence is shown in SEQ ID NO.2, and its full-length protein sequence is shown in SEQ ID NO.3. The protocol includes the following steps:

[0005] Carrier construction:

[0006] A. Rapid alkalization factor for soybeans GmRALF4 The nucleotide sequence from position 1 to 345 of the gene's coding nucleotide sequence was amplified:

[0007] Primer1 SEQ ID No.4: 5' - ttacgaacgatagccggtaccATGTCAAGTGTTTCTTTTCTTT - 3';

[0008] Primer2 SEQ ID No.5: 5' – tgtagtccaccactttgtacagAGAATTACGGCAACGGGT – 3’;

[0009] B. The fragment was constructed into the pBF vector using in-Fusion seamless cloning to obtain... pBF-GmRALF4-Flag Recombinant plasmids;

[0010] C. The recombinant plasmid was transformed into *E. coli* DH5α. The bacterial culture was spread onto LB solid medium containing 50 μg / mL kanamycin and incubated overnight at 37°C. After identifying positive clones by colony PCR and enzyme digestion, single positive colonies were picked and incubated overnight at 37°C with shaking in LB liquid medium containing 50 μg / mL kanamycin. The plasmid was extracted and sequenced using a kit. The primers used for colony PCR identification were:

[0011] Primer3 SEQ ID No.6: 5' - ATGTCAAGTGTTTTCTTTCTT - 3';

[0012] Primer4 SEQ ID No.7: 5' - AGAATTACGGCAACGGGT - 3';

[0013] D. The enzyme digestion site for identification is Bsp1407I, and the enzyme digestion identification system is: 16 µL of nuclease-free water, 2 µL of 10 × Buffer Tango, and recombinant plasmid. pBF-GmRALF4-Flag 1 µL of Thermo Scientific Bsp1407I and 1.0 µL of the solution were reacted at 37 °C for 1 h.

[0014] E. After the recombinant plasmid was correctly sequenced, the plasmid was transferred into Agrobacterium EHA105. The bacterial culture was spread onto LB solid medium containing 50 µg / mL kanamycin and 25 µg / mL rifampicin and incubated upside down at 28°C for 2 days. After the colony was identified as a positive clone by PCR, a single positive colony was picked and transferred to LB liquid medium containing 50 µg / mL kanamycin and 25 µg / mL rifampicin and incubated with shaking at 28°C for 2 days. The strain was then preserved in glycerol at a final concentration of 30%.

[0015] Overexpression of soybean fast alkalization factor in soybeans GmRALF4 Gene:

[0016] A. Select round, plump soybean seeds that are uniform in size and free of disease spots, and sterilize them with chlorine for 16 hours;

[0017] B. Expand the Agrobacterium strain stored at -80℃ to OD. 650 =0.8-1.0, centrifuge at 5000 rpm for 10 min to collect bacterial cells, and resuspend the bacterial cells in infection medium to OD.650 =0.6-0.8;

[0018] C. Soybean seeds soaked in sterile water for about 16 hours were divided evenly, true leaves were removed, cotyledon nodes were wounded, and the prepared explants were immersed in the infection solution for 30 minutes and then cultured in a co-culture medium for 5 days.

[0019] D. Insert the explant with the wound facing upwards obliquely into the bud induction medium and culture for 4 weeks, changing the medium every two weeks;

[0020] E. After removing the cotyledons of the bud induction material, transfer it to the bud elongation medium and culture for 8 weeks. When the buds have elongated to about 5 cm in length, root induction is performed.

[0021] F. When the induced roots grow to about 1 cm in length and number 2-3, they can be transferred to the soil for acclimatization.

[0022] G. After the compound leaves of the acclimatized seedlings have fully expanded, apply a 1‰ BASTA solution to the leaves to test for herbicide resistance;

[0023] H. Based on soybean rapid alkalization factor GmRALF4 The gene's encoding nucleotide sequence contains 348 base pairs, and its encoded amino acid sequence consists of 115 amino acids. Its molecular weight is 12746 Da. qRT-PCR was used to detect herbicide-resistant transformation seedlings. GmRALF4 Gene overexpression status ( Figure 1 ).

[0024] Rapid alkalization factor of soybeans under shade GmRALF4 Phenotypic identification of gene overexpression materials:

[0025] A. Soybean seeds were planted in nutrient soil, maintaining the control group and soybean rapid alkalization factor. GmRALF4 Gene overexpression materials ( GmRALF4-OE Planted at a uniform depth, they germinate in the dark;

[0026] B. Soybean Shade Treatment: After seed germination, immediately transfer the soybeans to normal light (WL) and shade (Shade) conditions until stage V2, observe and record changes in plant height. For example... Figure 2 As shown. Under shade, soybean rapid alkalization factor GmRALF4 Gene overexpression materials ( GmRALF4-OE The plant height of the ) was significantly smaller than that of the control.

[0027] Beneficial effects:

[0028] This invention discloses a rapid alkalization factor that inhibits shade-induced soybean stem elongation. GmRALF4 The application of genes and their encoded proteins, through the rapid alkalization factor in soybeans.GmRALF4 Nucleotides 1-345 of the gene's coding nucleotide sequence were amplified, and vector recombination was performed using the In-Fusion seamless cloning method to introduce the soybean rapid alkalization factor. GmRALF4 The full-length nucleotide coding sequence of the gene was cloned into pBF On the vector; herbicide resistance screening of transformation recipients conferred by glufosinate-resistant marker genes, and detection of soybean rapid alkalization factor by qRT-PCR. GmRALF4 Gene expression ensures accurate and rapid detection of positive seedlings. This invention relates to a soybean rapid alkalization factor. GmRALF4 The gene and its encoded protein have a significant inhibitory effect on shade-induced soybean stem elongation. The results are accurate and reliable, and the regulation method is simple, convenient, can be formalized, and is easy to promote and apply. Attached Figure Description

[0029] Figure 1 Comparison of Williams 82 (W82) and soybean rapid alkalization factor GmRALF4 Gene overexpression materials ( GmRALF4-OE (Image showing the creation, identification of glufosinate resistance, and gene expression level.)

[0030] Figure 2 Comparison of Williams 82 (W82) and soybean rapid alkalization factor GmRALF4 Gene overexpression materials ( GmRALF4-OE Phenotypic and statistical graphs under white light (WL) and shaded conditions. Detailed Implementation

[0031] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field. Unless otherwise specified, the reagents and materials used in the following embodiments are commercially available.

[0032] Example 1 Construction of recombinant plasmid

[0033] A. Download the soybean rapid alkalization factor from the Phytozome website (https: / / phytozome-next.jgi.doe.gov / ). GmRALF4 The coding nucleotide sequence of the gene (Glyma.03G213000) is shown in SEQ ID NO.1. Primers were designed as follows:

[0034] Forward primer Primer1 SEQ ID No.4: 5' – ttacgaacgatagccggtaccATGTCAAGTGTTTCTTTTCTTT – 3';

[0035] Reverse primer Primer2 SEQ ID No. 5: 5' – tgtagtccaccactttgtacagAGAATTACGGCAACGGGT – 3';

[0036] B. RNA was extracted from soybean Williams 82 and reverse transcribed into cDNA as a template. RNA extraction and reverse transcription were performed using the Chengdu Fuji Biotechnology Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (FOREGENE, RE-05024) and the Master Premix system (FOREGENE, RT-01032) for first-strand cDNA synthesis. Amplification was performed using the above-mentioned forward primer SEQ ID No. 4 and reverse primer SEQ ID No. 5. Amplification was performed using the high-fidelity enzyme Phanta Flash Master Mix (Vazyme #P510). The reaction system (50 μL) was as follows: 20 µL ddH2O; 25 µL 2 × PhantaFlash Master Mix; 2 µL Primer1; 2 µL Primer2; 1 µL Williams 82 cDNA template. The PCR reaction program was as follows: 98℃ pre-denaturation for 1 min; 98℃ denaturation for 10 s, 58℃ annealing for 30 s, 72℃ extension for 3 min 30 s, 34 cycles; 72℃ extension for 5 min; storage at 4℃.

[0037] C. Construct the fragment using In-Fusion seamless cloning. pBF On the vector, the restriction endonucleases used to prepare the linearized plasmid were KpnI and Bsp1407I. The PCR products were then mixed with the linearized plasmid using the ClonExpress II One Step Cloning Kit (Vzayme, C112-01). pBF To reorganize;

[0038] D. Recombinant plasmid pBF-GmRALF4-Flag Add the recombinant bacteria to Escherichia coli competent cells DH5α (Qingke TSC C14) and transform them according to the product instructions. After transformation, spread the recombinant bacteria onto LB solid medium containing 50 µg / mL kanamycin and incubate overnight at 37°C with the medium inverted.

[0039] E. Colony PCR identification of single colonies on LB solid medium: First, each single colony was picked and placed into 20 µL ddH2O, boiled at 95℃ for 3 min, and used as a template. The colony PCR reaction system was as follows: 20 µL ddH2O; 25 µL 2 × Taq Master Mix; 2 µL Primer3; 2 µL Primer4; 1 µL template. The reaction program was as follows: 98℃ pre-denaturation for 1 min; 98℃ denaturation for 10 s, 58℃ annealing for 30 s, 72℃ extension for 6 min, 32 cycles; 72℃ extension for 10 min; storage at 12℃. Primers for colony identification were as follows:

[0040] Primer3 SEQ ID No.6: 5' - ATGTCAAGTGTTTTCTTTCTT - 3';

[0041] Primer4 SEQ ID No.7: 5' - AGAATTACGGCAACGGGT - 3';

[0042] F. Positive colonies were sent to the company for sequencing identification. The sequencing results were compared with the original sequence to confirm the correct colonies. The correct colonies were then transferred to LB liquid medium containing 50 µg / mL kanamycin and incubated overnight at 37°C and 180 rpm. Plasmids were then extracted. pBF-GmRALF4-Flag For use in subsequent experiments.

[0043] Example 2 Agrobacterium-mediated transformation of soybean cotyledonary nodes

[0044] get pBF-GmRALF4-Flag After expressing the vector, the plasmid was transformed into Agrobacterium EHA105 competent cells according to the instructions for Escherichia coli EHA105 Chemically Competent Cell (Qingke TSC A03). The competent cells were then plated on LB agar containing 50 µg / mL kanamycin and 25 µg / mL rifampicin and incubated at 28°C for 2 days. After positive colony PCR identification, the strain was preserved in 30% glycerol. The colony PCR reaction system and procedure were the same as described above. The Agrobacterium-mediated soybean transformation steps are as follows:

[0045] A. Select round, plump soybean seeds that are uniform in size and free of disease spots, place them in a desiccator, mix 100 mL of 84 disinfectant and 5 mL of HCl liquid to generate chlorine gas, and sterilize in a sealed container for 16 hours.

[0046] B. Add the Agrobacterium strain stored at -80℃ to liquid YEP medium containing 50 µg / mL kanamycin and 25 µg / mL rifampicin at a concentration of 1:200, and expand the culture at 28℃ and 220 rpm until OD. 650 =0.8-1.0; After the bacterial concentration reaches the required level, centrifuge at 5000 rpm for 10 min to collect the bacterial cells, and resuspend the bacterial cells in infection medium to OD. 650 =0.6-0.8;

[0047] C. Soybean seeds soaked in sterile water for about 16 hours were divided evenly with a sterile scalpel, true leaves were carefully removed, cotyledon nodes were slightly wounded, the prepared explants were immersed in the inoculum for 30 minutes, and then cultured in a co-culture medium for 5 days.

[0048] D. Insert the explant with the wound facing upwards obliquely into the bud induction medium and culture for 4 weeks, changing the medium every two weeks;

[0049] E. After removing the cotyledons of the bud induction material, transfer it to the bud elongation medium and culture for 8 weeks. When the buds have elongated to about 5 cm in length, root induction is performed.

[0050] F. When the induced roots grow to about 1 cm in length and number 2-3, they can be transferred to the soil for acclimatization.

[0051] G. After the compound leaves of the acclimatized seedlings have fully expanded, apply a 1‰ BASTA solution to the leaves to test for herbicide resistance;

[0052] H. Based on soybean rapid alkalization factor GmRALF4 The gene's coding nucleotide sequence contains 348 base pairs, and the encoded amino acid consists of 115 amino acids. Its molecular weight is 12746 Da. Figure 1 As shown, qRT-PCR was used to detect the rapid alkalization factor in soybeans from glufosinate-resistant transformed seedlings. GmRALF4 Gene overexpression status.

[0053] Example 3: Rapid Alkalization Factor for Soybeans under Shade GmRALF4 Phenotypic identification of gene overexpression materials

[0054] A. Soybean seeds were planted in nutrient soil, maintaining the control group and soybean rapid alkalization factor. GmRALF4 Gene overexpression materials ( GmRALF4-OE Planted at a uniform depth of about 1 cm, they germinate in the dark;

[0055] B. Soybean Shade Treatment: After seed germination but before emergence from the soil, immediately transfer the soybeans to normal light (WL) and shade (Shade) conditions until stage V2, observe and record changes in plant height. For example... Figure 2 As shown, under shade, the soybean rapid alkalization factor GmRALF4 Gene overexpression materials ( GmRALF4-OE The plant height of the control group was significantly smaller than that of the control group.

[0056] Furthermore, soybean rapid alkalization factor GmRALF4 Gene overexpression can be applied to crops such as rapeseed and corn, achieving high biomass output per unit area through reasonable dense planting or intercropping.

[0057] The above are merely preferred embodiments of the present invention. The scope of protection of the present invention is not limited to the embodiments shown herein. All technical solutions falling within the scope of the present invention's concept are within the scope of protection of the present invention. It should be noted that for those skilled in the art, any modifications and refinements made without departing from the principles of the present invention should also be considered within the scope of protection of the present invention.

Claims

1. Soybean rapid alkalization factor GmRALF4 Application of genes and their encoded proteins in inhibiting shade-induced soybean stem elongation.

2. The application according to claim 1, characterized in that, The soybean rapid alkalization factor GmRALF4 The nucleotide sequence encoding the gene is shown in SEQ ID No.

1.

3. The application according to claim 1, characterized in that, The soybean rapid alkalization factor GmRALF4 The full-length nucleotide sequence of the gene's genome is shown in SEQ ID No.

2.

4. The application according to claim 1, characterized in that, The amino acid sequence of the soybean rapid alkalization factor GmRALF4 protein is shown in SEQ ID No.

3.

5. The application according to claim 1, characterized in that, The application utilizes soybean genes. GmRALF4 To obtain genetically modified plants to reduce the plant height of soybeans under shade.

6. The application according to claim 5, characterized in that, The expression vector of the transgenic plant is pBF .

7. The application according to claim 6, characterized in that, The expression vector contains a glufosinate resistance marker gene.

Images