Application of corn gene ZmARF16 in controlling ear row number, tassel branch number and grain protein content
By knocking out the ZmARF16 gene in maize using the CRISPR/Cas9 system, the problems of controlling the number of rows in the ear, the number of branches in the tassel, and the protein content of the kernels were solved, thus improving the yield and quality of maize.
Patent Information
- Application Number
- CN202511761036.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-27
- Publication Date
- 2026-01-09
AI Technical Summary
Existing technologies are insufficient to effectively control the number of rows in the corn ear, the number of branches in the tassel, and the protein content of the kernels, thus affecting the increase of corn yield.
By knocking out, suppressing, or silencing the expression of the maize gene ZmARF16 using the CRISPR/Cas9 system, its expression level in maize was reduced, increasing the number of ear rows, decreasing the number of tassel branches, and increasing the grain protein content.
This resulted in an increase in the number of rows in the corn ear, a decrease in the number of branches in the tassel, and an increase in the protein content of the kernels, thereby improving corn yield and quality.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology. Specifically, it relates to the application of the maize gene ZmARF16 in controlling the number of ear rows, the number of tassel branches, and the grain protein content. The gene of this invention is located on the 4th chromosome of maize and controls important yield traits such as the number of tassel branches and the number of ear rows. Background Technology
[0002] Ear length, number of kernels per row, number of rows per ear, ear weight, and cob weight are important components of maize yield. Analyzing maize yield traits into different yield factors helps to elucidate the genetic basis of yield trait formation, enabling breeders to more effectively utilize genetic resources to design breeding strategies and achieve high-efficiency breeding. At a specific planting density, maize yield per unit area is determined by the kernel yield per ear and the number of ears; the kernel yield per ear is determined by the number of kernels per ear and the weight of 100 kernels, while the number of kernels per ear is determined by the number of rows per ear and the number of kernels per row; ear length and ear diameter are significantly correlated with the number of kernels per row and the number of rows per ear, respectively. Referring to yield and related trait data of 32 different maize varieties published in Argentina from 1965 to 2016, a consistent maximum possible planting density was maintained in the experimental design, with three replicates in a randomized block design. The results showed that over the past 50 years of breeding, maize yield has increased at an average rate of 113 kg / ha / year. This increase in yield was positively correlated with the increase in the number of kernels per ear, but unrelated to changes in individual kernel weight. Ear biomass accumulation increased year by year, while the tasseling and silking interval shortened, and flowering time became more consistent. However, kernel formation efficiency remained unchanged. The gradual trends of all traits were as expected, indicating that the increase in the number of kernels per ear is a key reason for the year-on-year increase in yield. Understanding the genetic basis of ear length and row kernel number is crucial for comprehending the mechanism of maize yield formation and provides a theoretical basis for breeding practices.
[0003] Therefore, this study used genetic methods to isolate a gene, ZmARF16, located on chromosome 4 of maize, which controls the number of tassel branches, the number of rows per ear, and the protein content of the kernels. This gene encodes an ARF-transcription factor 16. Based on the genetic phenotype and related molecular biological analysis of transgenic materials, the biological function of this gene in controlling traits such as the number of tassel branches, the number of rows per ear, and the protein content of the kernels was confirmed. Genetic transformation studies of ZmARF16 can provide genetic resources and theoretical support for maize breeding. Summary of the Invention
[0004] The purpose of this invention is to provide the application of the maize gene ZmARF16 in controlling the number of ear rows, the number of tassel branches, and / or the protein content of the kernels, wherein the protein encoded by the gene is shown in SEQ ID NO.2.
[0005] To achieve the above objectives, the present invention adopts the following technical measures:
[0006] The application of reducing the expression of the maize gene ZmARF16 in controlling the increase of maize ear row number, the decrease of tassel branch number and / or the increase of kernel protein content, wherein the protein encoded by the gene is shown in SEQ ID NO.2.
[0007] In the above-described applications, preferably, the reduction of maize gene ZmARF16 expression is achieved by knocking out, inhibiting, or silencing the expression of maize gene ZmARF16;
[0008] In the above-described applications, preferably, the knockout is performed using the CRISPR / Cas9 system, and the protein translated from the knocked-out gene is non-functional or has no original function, thus achieving the effect of the present invention.
[0009] In the applications described above, preferably, the target sites of gRNA in the CRISPR / Cas9 system are GCCCTTCGGTCGGTAGTCGAG and GGAGGTAGACTAGGATAGTT.
[0010] In the applications described above, maize with increased ear row number, decreased tassel branch number, and / or increased grain protein content after CRISPR / Cas9 system editing has the polynucleotide shown in SEQ ID NO.4 or SEQ ID NO.5.
[0011] Application of the maize gene ZmARF16 in creating maize with increased ear row number, reduced tassel branch number, and / or increased kernel protein content.
[0012] The preferred application described above is the introduction of a substance that reduces the expression level of the maize gene ZmARF16 into maize.
[0013] In the above-described applications, preferably, the substance is a nucleic acid molecule that knocks out, inhibits, or silences the expression of the maize gene ZmARF16, or its expression cassette, recombinant vector, or recombinant microorganism.
[0014] In the above-described applications, preferably, the expression cassette, recombinant vector, or recombinant microorganism in the applications contains the polynucleotide shown in SEQ ID NO. 3.
[0015] Compared with the prior art, the present invention has the following advantages:
[0016] This invention cloned and confirmed the gene ZmARF16 in maize, which controls the number of ear rows, the number of tassel branches, and the kernel protein content. The relationship between the number of ear rows and tassel branches and the expression level of ZmARF16 was confirmed; reducing its expression level increased the number of ear rows and decreased the number of tassel branches. The differences in ear row and tassel branch numbers between transgenic and wild-type materials are due to the decrease in the protein level encoded by the gene caused by editing of its coding region. This invention provides a new genetic resource for maize yield improvement. Attached Figure Description
[0017] Figure 1 A schematic diagram and expression pattern of maize ZmARF16 gene knockout material.
[0018] Where: A is a schematic diagram of gene editing types, and B is a schematic diagram of ZmARF16 expression patterns.
[0019] Figure 2 Phenotypes of maize ZmARF16 gene-edited materials and wild-type materials;
[0020] The top image shows the entire plant, and the bottom image shows the fruit cluster.
[0021] Figure 3 Phenotypes of maize ZmARF16 gene-edited materials and wild-type materials;
[0022] The top figure shows plant height statistics, and the bottom figure shows the number of male tassel branches.
[0023] Figure 4 Phenotypes of maize ZmARF16 gene-edited materials and wild-type materials;
[0024] The top figure shows the number of rows of ears, and the bottom figure shows the weight of ears.
[0025] Figure 5 Phenotypes of maize ZmARF16 gene-edited materials and wild-type materials;
[0026] The top figure shows the statistics of the main axis length of the male spike, and the bottom figure shows the statistics of the net photosynthetic rate.
[0027] Figure 6 Phenotypes of maize ZmARF16 gene-edited materials and wild-type materials;
[0028] The top figure shows statistics during the silking period, and the bottom figure shows statistics on grain protein content.
[0029] Figure 7 Phenotypes of maize ZmARF16 gene-edited materials and wild-type materials;
[0030] The top figure shows the ear width statistics, and the bottom figure shows the leaf number statistics. Detailed Implementation
[0031] The following embodiments further define the present invention. Based on the following description and examples, those skilled in the art can determine the basic features of the present invention, and can make appropriate improvements and modifications to the present invention without departing from its spirit and scope, so as to make it suitable for various uses and conditions. Unless otherwise specified, the technical solutions described in this invention are conventional solutions in the art; the reagents or materials described, unless otherwise specified, are all derived from commercial channels or publicly disclosed materials.
[0032] Example 1:
[0033] Cloning of the maize ZmARF16 gene:
[0034] Total DNA was extracted from leaves of inbred line KN5585 (Liu, et al. High-throughput CRISPR / Cas9 mutagenesisstreamlines trait gene identification in maize. The Plant Cell, 2020, 32:1397–1413). Primers 980-F and 980-R were designed based on the genome reference sequence of maize B73 (National Crop Germplasm Center). The ZmARF16 gene was amplified by PCR and resequencing in KN5585 material, and the complete CDS nucleotide sequence of the ZmARF16 gene was obtained (SEQ ID NO.1). The protein encoded by this gene is shown in SEQ ID NO.2.
[0035] Table 1. Primers and their sequences used in this invention
[0036]
[0037] Example 2: Genetic transformation and phenotypic analysis of ZmARF16 in maize
[0038] Genetic transformation to knock out the ZmARF16 gene involved using ZmARF16 from the transgenic recipient material KN5585 as the applied gene, with the sequence shown in SEQ ID NO.1. The transformation was performed using the CRISPR-P website (…). http: / / cbi.hzau.edu.cn / crispr / Gene targets were designed to obtain Guide RNAs (Target1: GCCTTCGGTCGGTAGTCGAG and Target2: GGAGGTAGACTAGGATAGTT). The ZmU6-Target-sgRNA fragment (SEQ ID NO.3) was synthesized using gene synthesis and constructed into the commercial pEASY-T1 vector.
[0039] The fragment was amplified by PCR using primers pU6F1 and gRR1 (primer sequences are shown in Table 1, primer ID2), and Hind... The CPB-ZmUbi-hspCas9 vector was linearized by single enzyme digestion, recovered by electrophoresis gel extraction and detection, and the guide RNA was ligated into the target vector CPB-ZmUbi-hspCas9 (CN113004383A) via homologous recombination. Finally, the obtained clone was sequenced using CRISPR vector detection primers (primer sequences are shown in Table 1, primer ID is 3) to confirm that the target fragment was ligated into the vector.
[0040] The correctly cloned plasmid was transformed into the maize inbred line KN5585 via Agrobacterium-mediated transformation (genetic transformation was performed by the Life Science and Technology Center of China Seed Group Co., Ltd.). Using primers specific to the ZmARF16 gene (primer sequences are shown in Table 1, primer ID 4), two maize transformation events with KN5585 as the background were screened and obtained. Figure 1 CR-zmarf16-1 and CR-zmarf16-2, where CR-zmarf16-1 is missing 55 bases and 2 bases (the mutated gene is shown in SEQ ID NO.4), and CR-zmarf16-2 is missing 8 bases and 1 base (the mutated gene is shown in SEQ ID NO.5). These base deletions all lead to premature termination of protein translation. Figure 1 (A)
[0041] Furthermore, in 2024, phenotypic values of plant height, number of tassel branches, number of panicle rows, panicle weight, main axis length of tassel, net photosynthetic rate, silking date, grain protein content, panicle width, and number of leaves in ZmARF16 gene knockout families were investigated in Hainan. Figures 2-7 As shown), the results indicate that, relative to WT, after the ZmARF16 gene is lost of function, CR-zmarf16-1 (i.e., Figure 2 KO1) and CR-zmarf16-2 (i.e. Figure 2The KO2 maize variety showed a reduction of approximately 2 tassel branches (WT1 vs. KO1, P=0.0026, WT2 vs. KO2, P=5.8E-05); an increase of approximately 2 rows of ears (WT1 vs. KO1, P=0.01, WT2 vs. KO2, P=4.3E-05); an increase of approximately 1 percentage point in protein content (WT1 vs. KO1, P=0.0009); a decrease of approximately 15 cm in plant height (WT1 vs. KO1, P=1E-18, WT2 vs. KO2, P=0.01); and an earlier silking rate of approximately 5 days (WT1 vs. KO1, P=2.3E-16, WT2 vs. KO2, P=6.7E-06). Simultaneously, net photosynthetic rate and ear width were also significantly improved.
[0042] Based on the above results, it can be demonstrated that reducing the expression of the ZmARF16 gene, compared with the wild type, can increase the number of ear rows, reduce the number of tassel branches, and increase the protein content of the kernels.
[0043] Example 3: Expression analysis of ZmARF16
[0044] Based on the maize B73 expression database, the expression pattern of the ZmARF16 gene was analyzed. The expression level of the ZmARF16 gene was very high in both male and female ears of maize during the early development stage. Figure 1 (B in the middle).
[0045] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.
Claims
1. Reduce corn gene content ZmARF16 The expression of this gene is used to control the increase of the number of rows in maize ears, the decrease of the number of branches in the tassel, and / or the increase of grain protein content. The protein encoded by this gene is shown in SEQ ID NO.
2.
2. The application according to claim 1, characterized in that: Lowering maize genes ZmARF16 The expression is achieved by knocking out, suppressing, or silencing the maize gene. ZmARF16 The expression is realized.
3. The application according to claim 2, characterized in that: The knockout was performed using the CRISPR / Cas9 system, and the protein translated from the knocked-out gene was either non-functional or had no original function.
4. The application according to claim 3, characterized in that: The target sites of gRNA in the CRISPR / Cas9 system are GCCCTTCGGTCGGTAGTCGAG and GGAGGTAGACTAGGATAGTT.
5. The application according to claim 4, characterized in that: Corn with increased ear row number, decreased tassel branch number, and / or increased kernel protein content after CRISPR / Cas9 system editing has the polynucleotide shown in SEQ ID NO.4 or SEQ ID NO.
5.
6. Maize genes ZmARF16 Application in creating maize with increased ear row number, reduced tassel branch number and / or increased kernel protein content, wherein the protein encoded by the gene is shown in SEQ ID NO.
2.
7. The application according to claim 6, characterized in that: This will reduce the genetic value of corn. ZmARF16 The substance expressing the desired amount was introduced into maize.
8. The application according to claim 7, characterized in that: The substance described is a gene knockout, inhibition, or silencing substance in maize. ZmARF16 Nucleic acid molecules or their expression cassettes, recombinant vectors, and recombinant microorganisms that express these molecules.
9. The application according to claim 7, characterized in that: The expression cassette, recombinant vector, and recombinant microorganism in the application described herein contain the polynucleotide shown in SEQ ID NO.3.
Citation Information
Patent Citations
Application of corn gene ZmEREB102 in improvement of corn yield
CN113004383A