Application of GsRZ1A gene in improving plant alkali tolerance
By cloning the GsRZ1A gene and constructing an overexpression vector to transform soybeans, the expression level of the GsRZ1A gene in soybeans was increased, which solved the problem of soybean tolerance to high concentrations of NaHCO3 stress and achieved enhanced growth and antioxidant capacity of soybeans under alkaline stress.
Patent Information
- Application Number
- CN202511881155.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-15
- Publication Date
- 2026-03-17
- Estimated Expiration
- 2045-12-15
AI Technical Summary
Existing technologies are insufficient to effectively improve plant tolerance to salt and alkali stress, especially the tolerance of soybeans to high concentrations of NaHCO3, which affects their growth and yield.
The GsRZ1A gene was cloned and transformed into soybeans by constructing an overexpression vector to increase the expression level of the GsRZ1A gene. The gene was then introduced into soybeans using methods such as Agrobacterium-mediated transformation to enhance the alkali resistance of soybeans.
Soybean lines overexpressing the GsRZ1A gene exhibited faster growth rate, larger leaf area and root system under alkaline stress, increased antioxidant enzyme activity, reduced oxidative damage, increased soluble sugar accumulation, and enhanced tolerance to alkaline stress.
Smart Images

Figure CN121294526B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the application of the GsRZ1A gene in improving plant alkali tolerance. Background Technology
[0002] Soil salinization is one of the major abiotic stresses affecting global agricultural production. Statistics show that over 1.125 billion hectares of land worldwide are affected by salinization, severely restricting crop growth and yield. High concentrations of saline-alkali soil lead to ion imbalance, osmotic stress, water deficit, and the accumulation of reactive oxygen species in plant cells, resulting in oxidative damage, inhibiting plant growth, and even causing plant death. Soybeans, as an important food and oilseed crop and economic crop, are particularly sensitive to saline-alkali stress, and their yield and planting area are significantly limited by saline-alkali soils. Therefore, exploring salt-alkali tolerant gene resources and breeding salt-alkali tolerant soybean varieties has become an urgent need for current agricultural production and genetic improvement.
[0003] Wild soybean (Glycine soja), a closely related wild species to cultivated soybean, possesses rich genetic diversity and strong environmental adaptability, exhibiting particularly excellent characteristics in drought and salinity tolerance. There is no reproductive isolation between wild and cultivated soybeans, allowing for the introduction of superior traits into cultivated varieties through hybridization, providing valuable genetic resources for improving soybean stress resistance. Previous research has screened the extremely saline-alkali tolerant wild soybean germplasm G07256 from the heavily saline-alkali soils of Baicheng City, Jilin Province, China, laying the material foundation for the discovery and functional study of alkali-tolerant genes.
[0004] Posttranscriptional regulatory mechanisms play a crucial role in plant responses to abiotic stress. RNA-binding proteins (RBPs) are a class of proteins that specifically bind to RNA molecules, participating in RNA processing, transport, stability regulation, and translation, thereby influencing the final expression level of genes. Therefore, cloning and analyzing GRP genes responding to alkali stress from extremely salt-tolerant wild soybean not only contributes to a deeper understanding of the molecular mechanisms of plant alkali tolerance but also provides potential genetic resources and technical pathways for breeding new alkali-tolerant soybean varieties using genetic engineering. Summary of the Invention
[0005] In view of the problems existing in the prior art, the purpose of this invention is to provide the application of the GsRZ1A gene in improving the alkali tolerance of plants.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] The application of the GsRZ1A gene in improving plant alkali tolerance, the amino acid sequence encoded by the GsRZ1A gene is shown in SEQ ID NO:2.
[0008] Based on the above scheme, the nucleic acid sequence of the GsRZ1A gene is shown in SEQ ID NO:1.
[0009] Based on the above approach, the alkali tolerance of plants can be improved by increasing the expression level of the GsRZ1A gene in plants.
[0010] Based on the above approach, the expression level of the GsRZ1A gene in plants was increased by constructing the GsRZ1A gene into a plant expression vector and transforming the plants.
[0011] Based on the above scheme, the method of transforming plant bodies is one of Agrobacterium-mediated transformation, gene gun transformation, electroporation transformation, PEG transformation, and liposome transformation.
[0012] Based on the above scheme, the Agrobacterium is Agrobacterium tumefaciens or Agrobacterium rhizogenes.
[0013] Based on the above scheme, the plant mentioned is soybean.
[0014] Based on the above scheme, the alkali resistance is at least resistant to 50 mM NaHCO3.
[0015] Advantages of the technical solution of this invention
[0016] This invention cloned the gene GsRZ1A, associated with plant alkali tolerance, from wild soybean. The expression level of this gene significantly increased after alkali stress treatment. Transgenic lines were obtained by constructing an overexpression vector of the GsRZ1A gene and transforming it into soybean. Alkali stress treatment of the transgenic lines showed that the soybean lines overexpressing GsRZ1A exhibited a faster relative growth rate, with higher total leaf area, leaf chlorophyll content, and relative water content than the control lines transfected with an empty vector. The total root length and total root surface area were also significantly greater than the control group, indicating that GsRZ1A can improve the alkali tolerance of soybean. Stress physiological indicators of the treatment groups were measured, revealing that GsRZ1A enhances the tolerance of soybean to alkali stress by increasing the activity of antioxidant enzymes, reducing the accumulation of superoxide anions and malondialdehyde, and increasing the accumulation of osmotic regulators such as soluble sugars.
[0017] In summary, the GsRZ1A gene originates from wild soybean germplasm with strong alkali tolerance. It is not only closely related to cultivated soybean and easy to hybridize, facilitating gene introduction and trait integration in subsequent breeding, but it can also be applied to the genetic improvement of alkali tolerance in soybeans and other crops, providing key gene resources for breeding new varieties adapted to saline-alkali land. It has significant breeding and production application value. Attached Figure Description
[0018] Figure 1Expression analysis of GsRZ1A in different tissues of wild soybean;
[0019] Figure 2 Relative expression level of GsRZ1A in wild soybean after salt stress;
[0020] Figure 3 Relative expression level of GsRZ1A in wild soybean after alkali stress;
[0021] Figure 4 Relative expression level of GsRZ1A in wild soybean under abscisic acid (ABA) treatment;
[0022] Figure 5 Relative expression level of GsRZ1A in wild soybean under methyl jasmonate (MeJA) treatment;
[0023] Figure 6 This is a subcellular localization analysis diagram of GsRZ1A;
[0024] Figure 7 Relative expression levels of GsRZ1A in empty vector and overexpressing plants;
[0025] Figure 8 Leaf phenotypes of different plant types under normal treatment and alkali stress treatment;
[0026] Figure 9 Root phenotypes of different plant types under normal and alkali stress treatments;
[0027] Figure 10 Changes in total leaf area under normal conditions and alkali stress treatment;
[0028] Figure 11 Changes in total chlorophyll content under normal conditions and alkali stress treatment;
[0029] Figure 12 Changes in relative water content of leaves under normal conditions and alkali stress treatment;
[0030] Figure 13 Changes in relative growth under normal conditions and alkali stress treatment;
[0031] Figure 14 Changes in total root length under normal conditions and alkali stress treatment;
[0032] Figure 15 Changes in total root surface area under normal conditions and alkali stress treatment;
[0033] Figure 16 Changes in malondialdehyde (MDA) content under normal conditions and alkaline stress treatment;
[0034] Figure 17Changes in soluble sugar content under normal conditions and alkali stress treatment;
[0035] Figure 18 Superoxide anion (O2) under normal conditions and under alkaline stress - Changes in content;
[0036] Figure 19 Changes in peroxidase (POD) activity under normal conditions and alkaline stress treatment;
[0037] Figure 20 Changes in superoxide dismutase (SOD) activity under normal conditions and alkaline stress;
[0038] Figure 21 Changes in catalase (CAT) activity under normal conditions and alkaline stress.
[0039] In the above figures, different lowercase letters indicate significant differences (P<0.05), and different uppercase letters indicate extremely significant differences (P<0.01). Detailed Implementation
[0040] The terminology used in this invention, unless otherwise specified, generally has the meanings commonly understood by those skilled in the art. The invention is further described in detail below with reference to specific embodiments and data. The following embodiments are merely illustrative and are not intended to limit the scope of the invention in any way.
[0041] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the experimental materials, reagents, and chemicals used in the following embodiments can be obtained through general channels.
[0042] In the following embodiments,
[0043] Wild soybean G07256: This is an alkali-tolerant wild soybean variety from Northeast China, 'G07256', which was kindly donated by the Plant Bioengineering Research Laboratory of Northeast Agricultural University.
[0044] pMD19-T vector: purchased from Takara Bio Engineering (Dalian) Co., Ltd.;
[0045] Escherichia coli DH5α: purchased from Nanjing Novizan Biotechnology Co., Ltd.;
[0046] Agrobacterium rhizogenes K599: Beijing Coollab Technology Co., Ltd.;
[0047] Plant expression vector pSuper1300: kindly provided by China Agricultural University;
[0048] The Williams 82 soybeans were a generous donation from Northeast Agricultural University.
[0049] Example 1
[0050] Cloning the GsRZ1A gene
[0051] (1) Total RNA was extracted from wild soybean G07256 using the RNAsimple Total RNA Extraction Kit (Tiangen, China). cDNA was synthesized using the FastKing cDNA First Strand Synthesis Kit (Tiangen, China). The cDNA stock solution was diluted five times and stored at -20℃ for later use.
[0052] (2) Using the total cDNA of wild soybean synthesized above as a template, PCR amplification was performed using GsRZ1A specific primers and KOD HotStart DNA polymerase (Toyobo, Japan).
[0053] The PCR reaction system consisted of: 2 μL 10× Buffer, 2 μL dNTP mix (2 mM each), 0.8 μL MgSO4 (25 mM), 0.6 μL 5' PCR Primer (10 μM), 0.6 μL 3' PCR Primer (10 μM), 0.5 μL cDNA template, 0.2 μL KOD Hot Start DNA Polymerase, and 13.3 μL ddH2O to make up the volume (total volume 20 μL).
[0054] The PCR reaction conditions were: 94℃ 2min → [94℃ 15s → 60℃ 30s → 68℃ 31s] × 30 → 4℃.
[0055] The PCR products were detected by 1% agarose gel electrophoresis. The target band was recovered using the EZNA® Gel Extraction Kit (Omega Bio-tek Inc., USA) and ligated into the pMD19-T vector. The ligation product was transformed into E. coli DH5α, plated on LB agar plates containing ampicillin, and single colonies were picked for identification. Based on the colony PCR results, the identified positive clones were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.
[0056] The nucleic acid sequence of the GsRZ1A gene obtained by sequencing is shown in SEQ ID NO:1, and the amino acid sequence it encodes is shown in SEQ ID NO:2.
[0057] SEQ ID NO:1 (5'→3')
[0058] ATGTCTGACGTGGAAGAGTATCGTTGTTTCATTGGTGGCCTTGCGTGGTCAACATCTGATAGAAAGTTAAAGGATACGTTTGAAAAGTTTGGCAAGCTTATTGAGGCAAAGGTGGTTGTTGACAAGTTCTCTGGGCGTTCTCGTGGTTTTGGATTTGTCACATTTGATGACAAGAAAGCAATGGACGAGGCTATTGATGCTATGAATGGGATGGATTTAGACGGGCGAACTATTACTGTTGATAGAGCTCAGCCTCAACAAGGATCAACTAGAGGTGATGGTGATCGCTACCGGGATCGTGGTCGTGATCGTGACCGAGATCATGGAGGTGGAGGTGGCCGAGGATCTAATGGTGGTGAATGCTTTAAGTGTGGAAAACCTGGTCATTTTGCTAGGGAGTGCCCTAGTGAAGGGTCCAGGGGAGGAAAGTATGGTGGTAGGGAAAGTAGATATGGTGGAAGCAGTGGTGGTGGTTATGGACCAGATAGAGCAGATCGTTCTTCAGGGGGGCGCAGCAGGGGATGGTGGTAG
[0059] SEQ ID NO:2
[0060] MSDVEEYRCFIGGLAWSTSDRKLKDTFEKFGKLIEAKVVVDKFSGRSRGFGFVTFDDKKAMDEAIDAMNGMDLDGRTITVDRAQPQQGSTRGDGDRYRDRGRDRDRDHGGGGGRGSNGGECFKCGKPGHFARECPSEGSRGGKYGGRESRYGGSSGGGYGPDRADRSSGGRSRGWW
[0061] The specific primer sequences of GsRZ1A are as follows:
[0062] GsRZ1A-F: 5'-ATGTCTGACGTGGAAGAGTATCGTTG-3' (SEQ ID NO:3);
[0063] GsRZ1A-R: 5'-CCACCATCCCCTGCTGCG-3' (SEQ ID NO:4);
[0064] Example 2
[0065] (1) Tissue expression characteristics analysis of GsRZ1A gene
[0066] Soak plump, disease-free wild soybean seeds (G07256) in concentrated H2SO4 for 8-10 minutes to remove the mud film. Then, pour off the concentrated H2SO4, rinse 3-4 times with sterile water, and inoculate the seeds onto 1 / 2 MS solid medium (pH 5.8). Incubate in the dark at 25°C, and after germination, place them in sunlight for growth. When the seedlings have grown for 3 weeks, collect their roots, stems, leaves, and cotyledons, and flash-freeze them with liquid nitrogen, then store them at -80°C.
[0067] Real-time quantitative PCR (qRT-qPCR) was used to analyze the expression specificity of the GsRZ1A gene in different tissues of soybean (root, stem, leaf, and cotyledon). Total RNA was extracted from the roots, stems, leaves, and cotyledons of soybean and reverse transcribed into cDNA, which was then used as a template. Real-time quantitative PCR (qRT-qPCR) was performed using SYBR Green PCR Master Mix (Toyobo, Japan) on a CFX96 Touch™ real-time PCR detection system (Bio-Rad, USA) to detect the relative expression levels in different tissues. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was selected as an internal control gene because it showed stable expression under alkaline stress. Two [units of data were used]. -ΔΔCt The method involves relative quantitative analysis of the data, and all samples were subjected to three biological and technical replicate experiments.
[0068] The real-time quantitative primers for the GsRZ1A gene are as follows:
[0069] RT-GsRZ1A-F: 5'-GCTCAGCCTCAACAAGGATCAA-3' (SEQ ID NO: 5);
[0070] RT-GsRZ1A-R: 5'-TTTCCACACTTAAAGCATTCACC-3' (SEQ ID NO: 6);
[0071] The real-time fluorescence quantitative primers for the internal control GAPDH gene are as follows:
[0072] RT-GsGAPDH-F: 5'-GACTGGTATGGCATTCCGTGT-3' (SEQ ID NO: 7),
[0073] RT-GsGAPDH-R: 5'-GCCCTCTGATTCCTCCTTGA-3' (SEQ ID NO: 8).
[0074] The results are as follows Figure 1 As shown, the GsRZ1A gene is expressed in the roots, stems, leaves and cotyledons of wild soybean, with the highest expression level in the cotyledons. There is no significant difference in the relative expression level between the roots and leaves, while the relative expression level is the lowest in the stems.
[0075] (2) Analysis of the expression characteristics of GsRZ1A gene under salt and alkali stress
[0076] When the wild soybean seedlings grew to 3 weeks, the soybean roots were immersed in 100 mM NaCl and 50 mM NaHCO3, respectively. Total RNA was extracted from the roots and leaves of wild soybean at 0 h, 1 h, 3 h, 6 h and 12 h after treatment, and reverse transcribed into cDNA. Using cDNA as a template, the relative expression level of the GsRZ1A gene after salt and alkali stress was analyzed by real-time quantitative PCR (qRT-qPCR), using the same method as above.
[0077] The relative expression levels of the GsRZ1A gene in soybean leaves and roots under 100 mM NaCl stress at different time points were analyzed using qRT-PCR. The results are as follows: Figure 2 As shown, the relative expression level of the GsRZ1A gene did not change significantly under NaCl stress treatment.
[0078] The relative expression levels of the GsRZ1A gene in soybean leaves and roots under 50 mM NaHCO3 stress at different time points were analyzed using qRT-PCR. The results are as follows: Figure 3 As shown, under NaHCO3 stress, the relative expression level of GsRZ1A in roots was slightly downregulated at 1 h, significantly upregulated at 6 h, and peaked at 12 h, reaching 6 times the expression level at 0 h. In leaves, GsRZ1A expression showed continuous upregulation, peaking at 12 h, reaching 9 times the expression level at 0 h. These results indicate that GsRZ1A expression is significantly induced by alkali stress and may play an important role in the response of wild soybean to alkali stress.
[0079] (3) Analysis of the expression characteristics of GsRZ1A gene under stress-related hormone treatment
[0080] When the wild soybean seedlings reached 3 weeks of growth, the leaves of wild soybean were sprayed with 100 μM ABA (abscisic acid) and 50 μM MeJA (methyl jasmonate), respectively. Total RNA was extracted from the roots and leaves of wild soybean at 0 h, 1 h, 3 h, 6 h and 12 h after treatment, and reverse transcribed into cDNA. Using cDNA as a template, the relative expression level of the GsRZ1A gene after treatment with stress-related hormones was analyzed by real-time quantitative PCR (qRT-qPCR), using the same method as above.
[0081] The relative expression levels of the GsRZ1A gene in soybean leaves and roots under different time points of 100 μM ABA treatment were analyzed by qRT-PCR. The results are as follows: Figure 4 As shown, under 100 μM ABA treatment, the relative expression level of GsRZ1A in soybean roots was slightly upregulated, with the highest expression level at 12 h; while in leaves, the relative expression level was slightly upregulated at 3 h and significantly upregulated at 12 h, more than 6 times higher than at 0 h.
[0082] The relative expression levels of the GsRZ1A gene in soybean leaves and roots at different time points after treatment with 50 μM MeJA were analyzed using qRT-PCR. The results are as follows: Figure 5 As shown, GsRZ1A expression was not significantly induced in leaves under MeJA treatment, but its expression was consistently upregulated in roots, with the expression level being 2.5 times that of the untreated group after 12 h of treatment.
[0083] Example 3
[0084] Subcellular localization of GsRZ1A protein
[0085] Based on the polyclonal restriction sites of the plant expression vector pSuper1300 carrying the GFP subcellular localization tag, specific amplification primers with restriction sites (Xba I and Kpn I) for GsRZ1A to remove the stop codon were designed:
[0086] The upstream is 5'-GCTCTAGAATGTCTGACGTGGAAGAGTATCGTTG-3' (SEQ ID NO:9).
[0087] The downstream component is 5'-GGGGTACCCCACCATCCCCTGCTGCG-3' (SEQ ID NO:10).
[0088] Using the correctly sequenced GsRZ1A-pMD19-T gene as a template, the target gene with restriction enzyme sites was obtained by high-fidelity cloning. The target gene was run on a 1% agarose gel, and after gel recovery, it was ligated into the pMD19-T vector and sent for sequencing. The correctly sequenced pMD19-T-GsRZ1A and pSuper1300 vectors were double-digested with Xba I and Kpn I, respectively. The target gene fragments with restriction sites were recovered and ligated into the pSuper1300 linearized vector, which was then transformed into E. coli. Positive pSuper1300-GsRZ1A-GFP subcellular localization vectors were obtained by colony PCR and restriction enzyme digestion identification. These vectors were then transformed into Agrobacterium rhizogenes K599. Following the published genetic transformation method for soybean hairy roots [Fan, Y.-l., et al., One-step generation of compositesoybean plants with transgenic roots by Agrobacterium rhizogenes-mediated transformation. BMC Plant Biology, 2020. 20(1): p. 208.], Williams was infected. 82 soybeans were used to obtain soybean hairy root material transgenic with GsRZ1A-GFP protein. The expression of the fluorescent protein was observed using a laser confocal microscope at an excitation wavelength of 488 nm to determine the subcellular localization of the target protein. A single GFP transgenic line was used as a control.
[0089] The results are as follows Figure 6 As shown, GFP protein is expressed in all organelles of soybean root cells, while the GsRZ1A-GFP fusion protein is located in the nucleus, indicating that GsRZ1A is a nuclear localization protein.
[0090] Example 4
[0091] Application of GsRZ1A gene in improving plant alkali tolerance
[0092] (1) Construction of GsRZ1A gene overexpression vector
[0093] Design primers for full-length specific amplification of GsRZ1A gene with restriction enzyme sites (Xba I and Kpn I):
[0094] OE-GmRZ1A-F: 5'-GCTCTAGAATGTCTGACGTGGAAGAGTATCGTTG-3' (SEQ ID NO: 11),
[0095] OE-GmRZ1A-R: 5'-GGGGTACCCTACCACCATCCCCTGCTGCG-3' (SEQ ID NO: 12),
[0096] The target gene was amplified by high-fidelity PCR and recovered by gel extraction. It was then inserted into the plant overexpression vector pSuper1300 through double restriction sites of Xba I and Kpn I, thus obtaining the GsRZ1A gene overexpression vector pSuper1300-GsRZ1A.
[0097] (2) Obtaining soybean hairy root lines transgenic with GsRZ1A gene
[0098] Transgenic soybean hairy root lines were obtained by transforming Agrobacterium rhizogenes K599 with the GsRZ1A gene overexpression vector pSuper1300-GsRZ1A and infecting Williams 82 soybeans. The hairy root lines were obtained by using the empty vector pSuper1300 as a control.
[0099] GsRZ1A overexpressing soybean lines and empty vector soybean lines (OE-EV) were obtained through Agrobacterium rhizogenes-mediated soybean hairy root genetic transformation. Real-time quantitative PCR was used to detect GsRZ1A gene expression levels in each transformed line, revealing two lines with significantly higher GsRZ1A expression levels than the empty vector transformed lines OE-GsRZ1A-2 and OE-GsRZ1A-5. Figure 7 ).
[0100] (3) Alkali tolerance test of transgenic soybean hairy root lines
[0101] Two transgenic lines and an empty vector control line were cultured in Hoagland solutions containing 0 and 50 mmol / L NaHCO3, respectively, for 7 days. Phenotypic images of roots and leaves for each treatment group were acquired using an LA-S plant image analyzer system (Wanshen, China). The results are as follows: Figure 8 and Figure 9 As shown, under normal conditions, there was no significant difference between the GsRZ1A overexpression line and the empty vector line. Under 50 mmol / L NaHCO3 alkaline stress treatment, the leaf scanning images showed that the leaves of OE-EV were smaller than those of OE-GsRZ1A and also lighter in color. Figure 8 The root scan clearly shows that the roots of OE-EV are sparse due to alkali stress, while the roots of the overexpression lines are much denser. Figure 9 ).
[0102] Image analysis of GsRZ1A overexpressing lines and empty vector lines before and after alkali stress treatment yielded total root length, total root surface area, and total leaf area. Chlorophyll content, relative water content, and relative growth of the GsRZ1A overexpressing lines and empty vector lines before and after alkali stress treatment were also measured. The results are as follows: Figures 10-15 As shown, under normal conditions, there were no significant differences in total leaf area, chlorophyll content, relative leaf water content, total root length, total root surface area, and relative plant growth between the GsRZ1A overexpressing lines and the empty vector lines. Under 50 mmol / L NaHCO3 alkaline stress treatment, all indicators were significantly lower than those of the control, but the indicators of the OE-GsRZ1A lines were significantly higher than those of the OE-EV control group, indicating that GsRZ1A has a positive regulatory effect on alleviating alkaline stress.
[0103] Oxidation-related physiological parameters of GsRZ1A overexpressing lines and empty vector lines before and after alkali stress treatment were determined: malondialdehyde (MDA), soluble sugars, and superoxide anions (O2). - The levels of [unspecified substance] and the activities of peroxidase (POD), superoxide dismutase (SOD), and catalase (CAT) were measured using corresponding kits (Solepro Technology Co., Ltd., Beijing). Results are as follows: Figures 16-21 As shown, under normal growth conditions, overexpression of GsRZ1A has an effect on malondialdehyde (MDA), soluble sugars, and superoxide anions (O2) in soybean plants. - The content of malondialdehyde (MDA) and the activity of antioxidant protective enzymes were not affected. Under alkaline stress, overexpression of GsRZ1A could inhibit the increase of malondialdehyde (MDA) and superoxide anion content to a certain extent. Compared with the empty vector transformed lines, the activities of peroxidase (POD), superoxide dismutase (SOD), and catalase (CAT) in the GsRZ1A overexpression lines were stronger under alkaline stress, increasing by 26.03%, 17.16%, and 31.34%, respectively. In addition, under alkaline stress, the soluble sugar content of the GsRZ1A overexpression lines was 17.1% higher than that of the empty vector transformed lines. These results indicate that GsRZ1A can alleviate the toxicity of alkaline stress on soybeans by improving antioxidant capacity and the content of isotonic regulators such as saccharides under alkaline stress.
[0104] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any other way. Any person skilled in the art may make changes or modifications to the above-disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the protection scope of the present invention.
Claims
1. GsRZ1A The use of a gene in improving the salt tolerance of a plant, characterized in that The GsRZ1A The amino acid sequence encoded by the gene is shown as SEQ ID NO: 2; the alkali tolerance of the plant is improved by increasing the expression amount of the gene in the plant; and the plant is soybean. GsRZ1A The amino acid sequence encoded by the gene is shown as SEQ ID NO: 2; the alkali tolerance of the plant is improved by increasing the expression amount of the gene in the plant; and the plant is soybean.
2. The method of claim 1 GsRZ1A Use of the gene in improving plant tolerance to alkali, characterized in that, The nucleic acid sequence of the gene is set forth in SEQ ID NO:
1. GsRZ1A The nucleic acid sequence of the gene is set forth in SEQ ID NO:
1.
3. The method of claim 1 GsRZ1A Use of the gene in improving plant tolerance to alkali, characterized in that, By constructing the gene into a plant expression vector, transforming a plant, to increase the expression amount of the gene in the plant. GsRZ1A The gene is constructed into a plant expression vector, a plant is transformed, to increase the expression amount of the gene in the plant. GsRZ1A The gene is constructed into a plant expression vector, a plant is transformed, to increase the expression amount of 4. The method of claim 3 GsRZ1A Use of the gene in improving plant tolerance to alkali, characterized in that, The transformation of the plant body is one of Agrobacterium-mediated method, gene gun method, electric shock method, PEG method, and liposome method.
5. The method of claim 4 GsRZ1A Use of the gene in improving plant tolerance to alkali, characterized in that, The Agrobacterium is Agrobacterium tumefaciens or Agrobacterium rhizogenes.
6. The method of any one of claims 1-5 GsRZ1A Use of the gene in improving plant tolerance to alkali, characterized in that, The alkali tolerance is at least tolerant to 50 mM NaHCO3.
Citation Information
Patent Citations
Combination therapy with controlled-release CNP agonists
CN109843295A
Novel method for identifying and using upstream open reading frame
CN120077140A