One-tube detection method and kit for weed herbicide target gene resistance mutation based on combination of CRISPR-Cas and LAMP

Abstract

The invention discloses a one-tube detection method and kit for resistance mutation of a weed herbicide target gene based on combination of CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (Clustered Regularly Interspaced Short Palindromic Repeats) and LAMP (Loop-Mediated Isothermal Amplification), and the rapid detection of resistance mutation of sites such as 1999, 2027 and 2041 of an ACCase gene is realized by integrally integrating a CRISPR / Cas system specific recognition cutting technology and an LAMP efficient amplification technology. The detection lower limit of the technology reaches 1%, homozygous / heterozygous mutation typing can be completed within 60 minutes, the method is suitable for large-scale resistance screening in fields, and key technical support is provided for precise pesticide application and weed resistance management.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and agricultural biotechnology, specifically to a one-tube detection method and kit for detecting resistance mutations in weed herbicide target genes based on the combination of CRISPR-Cas and LAMP, named OpCas-LAMP. It is used for rapid and accurate detection and analysis of target gene mutations (sites 1999, 2027, and 2041) in weeds associated with resistance to ACCase herbicides. Background Technology

[0002] In agriculture, herbicide resistance in weeds has become a major challenge for global agricultural production. Resistance to acetyl-CoA carboxylase (ACCase) inhibitors, in particular, has become widespread among weeds associated with various crops. Traditional detection methods, such as phenotypic and biochemical assays, while still valuable in certain scenarios, are difficult to implement on a large scale in the field due to their long detection cycles, complex operations, and susceptibility to environmental factors. Molecular detection methods, such as PCR-RFLP and AS-PCR, while offering high sensitivity and specificity, rely on expensive instruments and complex primer designs, making them difficult to implement in resource-constrained areas. Therefore, developing a rapid, accurate, and field-suitable herbicide resistance detection technology has become an urgent problem to be solved in agriculture.

[0003] In recent years, loop-mediated isothermal amplification (LAMP) has been widely used in clinical diagnostics and food safety testing as a powerful nucleic acid amplification technique. However, traditional LAMP technology faces challenges in single nucleotide polymorphism (SNP) detection, including complex primer design and high specificity requirements. In particular, allele-specific primers must precisely match the mutation site while avoiding non-specific binding, which places stringent requirements on parameters such as primer length and melting temperature, often necessitating multiple optimizations. Furthermore, the high amplification efficiency of LAMP technology makes it susceptible to interference from non-specific binding or contamination, leading to false positive results. Compared to real-time PCR, LAMP technology has limited multiplex detection capabilities; as the number of target sequences increases, the complexity of primer design and the possibility of primer dimer formation also increase, affecting amplification efficiency. Therefore, improving the specificity and sensitivity of LAMP technology in SNP detection has become a research hotspot in this field.

[0004] As a revolutionary molecular diagnostic platform, the CRISPR / Cas system has demonstrated immense potential in gene editing and molecular detection due to its programmable nucleic acid targeting capabilities. The CRISPR / Cas system achieves single-base resolution genome localization through complementary pairing of guide RNA (gRNA) with the target sequence and the specific recognition of PAM sequences by effector nucleases (such as Cas9, Cas12, and Cas13). Compared to traditional gene editing tools, the CRISPR / Cas system offers core advantages such as precise targeting and efficient vector construction. In particular, when combined with isothermal amplification technologies (such as RPA and LAMP) and signal transduction modules (fluorescent probes, lateral flow chromatography strips), single-base resolution detection with sub-femtomolar sensitivity can be achieved. The dual specificity of this technology (gRNA-target complementarity and PAM-dependent nuclease) and its ease of field deployment without thermal cycling make it a cornerstone of point-of-care testing in the post-pandemic era. Therefore, developing a novel herbicide resistance detection method by combining the CRISPR / Cas system with LAMP technology has significant theoretical and practical implications. Summary of the Invention

[0005] This invention provides a one-tube detection method and kit for herbicide resistance mutations in weed target genes using a combination of CRISPR-Cas and LAMP. It is used for the rapid and accurate detection of herbicide resistance-related gene mutations in plants. This method achieves highly efficient detection of target gene mutations by designing specific CRISPR / Cas guide RNA (crRNA & tracrRNA) and LAMP primers, combined with optimized reaction conditions.

[0006] The technical solution provided by this invention is as follows: First aspect: A reaction system for detecting gene mutations related to herbicide resistance in plants; all reaction components are placed in the same reaction vessel to form a tube-type detection system; the reaction components include: (a) CRISPR effector proteins; (b) DNA polymerases with strand displacement activity; (c) Primer set for loop-mediated isothermal amplification of target sequences; and (d) sgRNA (CRISPR guide RNA) that specifically recognizes the target sequence; The primer set used for loop-mediated isothermal amplification of the target sequence includes at least one set of primers targeting specific mutation sites in the acetyl-CoA carboxylase (ACCase) gene; the mutation sites include at least one of the 1999, 2027, and 2041 sites. The sgRNA includes at least one crRNA that targets a specific site of the ACCase gene.

[0007] The CRISPR effector proteins include at least one of Cas9, Cas12a, and Cas12b proteins.

[0008] The Cas9 protein is preferably SpyCas9 or FnCas9; The Cas12a protein is preferably FnCas12a or LbCas12a; The Cas12b protein is preferably AacCas12b or BhCas12b.

[0009] As one embodiment of the present invention, the sgRNA includes: At least one crRNA targeting a specific site of the ACCase gene, wherein the crRNA is selected from: crRNA 1999-Cas9 with the sequence shown in SEQ ID NO.14, crRNA 2027-Cas9 with the sequence shown in SEQ ID NO.15, or crRNA-2041 with the sequence shown in SEQ ID NO.18; When the CRISPR effector protein is Cas9, the sgRNA further includes a universal tracrRNA with the sequence shown in SEQ ID NO.16; the tracrRNA binds to the crRNA 1999-Cas9 to form sgRNA-Cas9 complex 1; Alternatively, the tracrRNA may bind to the crRNA 2027-Cas9 to form sgRNA-cas9 complex 2.

[0010] As one embodiment of the present invention, the primer set for loop-mediated isothermal amplification of the target sequence includes at least one set of primers targeting specific sites of the acetyl-CoA carboxylase (ACCase) gene; the sites include at least one of the sites 1781, 1999, 2027, 2041, 2078, 2088, and 2096. The primer set targeting the ACCase gene 2027 site includes: 2027-F3 as shown in SEQ ID NO.1, 2027-B3 as shown in SEQ ID NO.2, 2027-FIP as shown in SEQ ID NO.3, 2027-BIP as shown in SEQ ID NO.4, and 2027-LF as shown in SEQ ID NO.5; and / or, The primer set targeting the ACCase gene site 1999 includes: sequences as shown in SEQ ID NO. 6 (1999-F3), SEQ ID NO. 7 (1999-B3), SEQ ID NO. 8 (1999-FIP), and SEQ ID NO. 9 (1999-BIP); and / or, The primer set targeting the ACCase gene 2041 site includes: 2041-F3 as shown in SEQ ID NO.10, 2041-B3 as shown in SEQ ID NO.11, 2041-FIP as shown in SEQ ID NO.12, and 2041-BIP as shown in SEQ ID NO.13.

[0011] Furthermore, the CRISPR / Cas system is a CRISPR / Cas9 system and / or a CRISPR / Cas12 system.

[0012] The CRISPR / Cas9 system uses Cas9 or a functional variant thereof, which recognizes the protospacer adjacent motif (PAM) sequence NGG; the concentration of Cas9 in the reaction system is 200-300 nM; The CRISPR / Cas system is a CRISPR / Cas12 system; the Cas protein used in the CRISPR / Cas12 system is Cas12 or a functional variant thereof, which recognizes the protospacer adjacent motif (PAM) sequence as TTN; the concentration of Cas12 in the reaction system is 200-300 nM; In one embodiment of the present invention, the target gene is the acetyl-CoA carboxylase (ACCase) gene. In the acetyl-CoA carboxylase (ACCase) gene, the resistance-related single nucleotide polymorphism (SNP) sites are located at the following amino acid positions: 1781, 1999, 2027, 2041, 2078, 2088, and 2096, or at least one of the nucleotide sites corresponding to these positions.

[0013] The DNA polymerases with strand substitution properties include one or more of Bst, Vent, phi29, and Taq DNA polymerases.

[0014] Furthermore, the DNA polymerase with strand displacement activity is Bst DNA polymerase, and its concentration in the reaction system is 0.48-0.5 U.

[0015] The reaction system also contains dNTPs and Mg. 2+ , reaction buffer, fluorescent dye.

[0016] In one embodiment of the present invention, the total volume of the reaction system is 25 μL, comprising: 1 μL Bst DNA polymerase (final concentration 0.48 U), 1 μL Mg 2+ 1 μL dNTPs (final concentration 2 mM), 2.5 μL 10× Buffer (B1 for Cas12, B2 for Cas9), 1 μL 25× primer mixture (FIP / BIP:LF / LB:F3 / B3 final concentrations 1.6, 0.8, 0.4 μM, respectively), 1 μL EverGreen I dye (25× stock), 1 μL Cas protein (Cas9 500 nM, and / or Cas12 200 nM), 1 μL sgRNA (sgRNA-cas9 complex 1300 nM, and / or sgRNA-cas9 complex 1300 nM, and / or crRNA-2041 250 nM), 0.5 μL genomic DNA template, and bring to 25 μL with RNase-free dd H2O.

[0017] Secondly, the present invention provides a nucleic acid detection method based on CRISPR and loop-mediated isothermal amplification, comprising the following steps: The nucleic acid sample to be tested is mixed with the reaction system described above, and the following reaction is carried out: a) The target sequence is specifically cleaved by the CRISPR effector protein under the mediation of the sgRNA; b) Perform loop-mediated isothermal amplification on the sheared system; The genotype of the target sequence is determined by detecting the product of the loop-mediated isothermal amplification. The detection results are then interpreted using fluorescence signals or colorimetric reactions to differentiate between wild-type, heterozygous, and homozygous mutants.

[0018] The specific shearing reaction conditions are: 30-37℃ for 20-40 min; the loop-mediated isothermal amplification reaction conditions are: 55-65℃ for 20-40 min.

[0019] In this invention, nucleic acid samples are added to the reaction system mixture for a one-tube reaction; the program and temperature settings are as follows: first, a constant temperature (37℃) CRISPR / Cas nuclease shearing reaction is performed for 30 min, followed by a LAMP amplification reaction at 65℃ for 30 min.

[0020] The CRISPR / Cas nucleases include one or a variant of SpyCas9, FnCas9, FnCas12a, LbCas12, BhCas12b, BsCas12b, LsCas12b, SbCas12b, AaCas12b, AkCas12, AmCas12b, BsCas12b, DiCas12b, TcCas12b, AacCas12b, LwCas13, and Cas14.

[0021] In one embodiment of the present invention, the CRISPR / Cas system is a CRISPR / Cas9 system; the Cas protein used in the CRISPR / Cas9 system is Cas9 or a functional variant thereof, which recognizes the protospacer adjacent motif (PAM) sequence NGG; the concentration of Cas9 in the reaction system is 300 nM; Alternatively, the CRISPR / Cas system is a CRISPR / Cas12 system; the Cas protein used in the CRISPR / Cas12 system is Cas12 or a functional variant thereof, which recognizes the protospacer adjacent motif (PAM) sequence as TTN; the concentration of Cas12 in the reaction system is 200 nM; CRISPR / Cas is designed to target wild-type recognition sites, the sequence of which is the same as the PAM base sequence (e.g., NGG or TTN). When a mutation occurs at the site, the Cas protein will be unable to correctly recognize and cleave the mutant, thereby amplifying the recognition of the mutant site.

[0022] The method is used to detect plant herbicide target resistance. The herbicide target resistance is determined by detecting mutations in the target gene; preferably, the target gene is selected from the acetyl-CoA carboxylase (ACCase) gene. The nucleic acid molecules to be detected in the nucleic acid sample include one or more mutations in single-stranded DNA, double-stranded DNA, and single-stranded RNA, and the sample types include wild-type targets (WT), heterozygous mutant targets (HT mutant), and homozygous mutant targets (HM mutant).

[0023] The DNA polymerases with strand substitution properties include one or more of Bst, Vent, phi29, and Taq DNA polymerases.

[0024] Third aspect A kit comprising the reaction system described above. The kit is suitable for rapid field detection, enabling detection within 60 minutes.

[0025] The kit is suitable for detecting the following weed genera and species: Digitaria sp., Echinochloa sp., Alopecurus sp., Beckmannia syzigachne, Leptochloa P. Beauv., and Lolium multiflorum Lamk.

[0026] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. High sensitivity: The detection limit can reach 1%, which is suitable for the detection of low-concentration mutant samples.

[0027] 2. High specificity: The CRISPR / Cas system accurately identifies target sites, avoiding false positives and false negatives.

[0028] 3. High throughput: CRISPR technology is easy to implement for high-throughput detection, and can detect a large number of samples simultaneously in a 96-well plate, thereby greatly improving detection efficiency.

[0029] 4. Fast and efficient: The integrated reaction is completed within 60 minutes, making it suitable for real-time field monitoring.

[0030] 5. Low cost: No expensive instruments are required, simplifying the operation process and reducing testing costs. Attached Figure Description

[0031] Other features, objects, and advantages of the present invention will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings: Figure 1 Here are the workflow diagrams for OpCas-LAMP. (A) Flowchart of OpCas-LAMP detection for wild-type (WT) samples, showing the workflow in four main stages: (1) Sample processing; (2) Rapid DNA extraction; (3) OpCas-LAMP detection; (4) Result reading. (B) Schematic diagram of OpCas-LAMP detection for heterozygous resistant (HT) samples. (C) Schematic diagram of OpCas-LAMP detection for homozygous resistant (HM) samples.

[0032] Figure 2Optimization of CRISPR / Cas cleavage and concentration. (A) Fluorescence signal of Cas9 enzyme cleavage at site 2027 in wild-type (TGG) and mutant (TCG / TGT). (B) Fluorescence signal of Cas12 enzyme cleavage at site 2041 in wild-type (ATT) and mutant (AAT). (C) Cas9 enzyme concentration optimization scheme. (D) Cas12 enzyme concentration optimization scheme. (E) Cas9 enzyme gRNA (crRNA and tracrRNA) concentration optimization scheme. (F) Cas12 enzyme crRNA concentration optimization scheme.

[0033] Figure 3 Optimization for LAMP detection. (A) LAMP primer optimization. (B) P3 primer melting curve. (C) LAMP reaction temperature optimization. (D) Mg 2+ Optimization. (E) dNTPs optimization. (F) Bst polymerase optimization.

[0034] Figure 4 Experimental results of OpCas-LAMP detection of wild-type and mutant samples. (A) Detection results of OpCas9-LAMP on HM (TCG), HT (TGG / TCG), and WT (TGG) samples at the W2027C locus. (B) Detection results of OpCas9-LAMP on HM (TGT), HT (TGG / TGT), and WT (TGG) samples at the W2027S locus. (C) Detection results of OpCas9-LAMP on HM (TGC), HT (TGG / TGC), and WT (TGG) samples at the W1999C locus. (D) Detection results of OpCas12-LAMP on HM (AAT), HT (ATT / AAT), and WT (ATT) samples at the N2041I locus.

[0035] Figure 5 Analysis of the detection limit of OpCas-LAMP.

[0036] Figure 6 Field sample testing and typing analysis. (A) High-throughput testing workflow for field samples. (B) Visualized detection results of OpCas-LAMP for different drug-resistant samples (R1-R8) and sensitive samples (S1-S8). (C) Sanger sequencing results of drug-resistant samples (R1-R8). Detailed Implementation

[0037] The present invention will be described in detail below with reference to embodiments. These embodiments will help those skilled in the art to further understand the present invention, but do not limit the invention in any way. It should be noted that those skilled in the art can make several adjustments and improvements without departing from the concept of the present invention. These all fall within the protection scope of the present invention.

[0038] Example 1 Susceptibility study of different Digitaria sanguinalis populations to cyhalofop-butyl 1.1 Plant cultivation and resistance analysis Multiple samples of *Digitaria sanguinalis* (a type of wild crabgrass) were collected from farmland in different regions of Jiangsu Province. D. ciliaris var. Chrysoblephara The population covered areas known to be susceptible to cyhalofop-butyl and areas where resistance may have developed. Collected *Digitaria zebrina* was then thoroughly mixed with sand, clay, and organic matter in a 1:1:2 ratio (pH 6.3, organic matter content 1.1%). This mixture was poured into plastic cups with drainage holes at the bottom, and the samples were then planted in them. Subsequent experiments were conducted in a greenhouse at a temperature of (25±2)℃, a light duration of 16 hours per day, and a relative humidity of (60±5)%.

[0039] After cultivating the seedlings of *Digitaria sanguinalis* to the 3-4 leaf stage, spray them with different concentrations of cyhalofop-butyl solution. The recommended field dose-sensitive population gradients are 0, 30, 60, 120, and 240 g ai ha -1 The resistance population gradients were set to 0, 120, 480, 960, and 1920 g ai ha -1 Twenty-one days after treatment, the fresh weight of the aboveground parts of the plants was measured, and the GR50 values ​​for each population were calculated. The experiment was repeated twice, with four replicates for each treatment. Twenty individual plants were collected from each population, and young leaves were selected, cut, and preserved in liquid nitrogen. Data processing was performed using SigmaPlot 15.0 software. The GR50 values ​​for different Digitaria zebrina populations were statistically calculated, and the Log-Logistic model was used for analysis. The fitted equation is as follows:

[0040] In the formula, y represents the percentage of treatment relative to the control, c is the lower limit of inhibition rate, d is the upper limit of inhibition rate, b is the slope, and x is the herbicide dosage. The relative resistance multiple is derived from the GR50 of the resistant *Gnaphalium affine* population / the GR50 of the sensitive *Gnaphalium affine* population.

[0041] 1.2 Analysis of resistance to Digitaria pilosa and comparison of mutation sites Bioassay results for Dioscorea opposita resistance indicate that 19-C3 is a highly resistant population, with a GR50 value of 1025.6867 g aiha. -1 The resistance index was 41.2, 21-C7 was a moderately resistant population, and the GR50 value was 119.46 g ai ha -1 The resistance index was 4.8. The GR50 value of the susceptible population 21-C3 was 24.88 g ai ha -1 .

[0042] DNA extraction from *Digitaria sanguinalis* was performed using rapid nucleic acid extraction technology. The specific method is described in patent CN119162165A, and the steps are as follows: Cut a plant leaf into strips approximately 1 mm × 5 mm wide and place them in a 2 mL centrifuge tube, or use a punch with a diameter of approximately 3 mm to collect the sample. Add 200 μL of a single-tube plant DNA rapid extraction reagent to the centrifuge tube, mix well, and let stand for 5 minutes. Take 10 μL of the above DNA rapid extraction reagent and add it to 90 μL of DNA / RNase-free double-distilled water (diluted 10-fold). Use 2 μL for PCR amplification and subsequent OpCas-LAMP experiments.

[0043] The PCR amplification primers used were Accase-F: AGGTGGATTATTGACTCTGTTGTG (SEQ ID No. 19) and Accase-R: TCTTGGAGTTCCTCTGATCTGAA (SEQ ID No. 20). The amplification system is shown in Table 1. The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 25 sec, 58℃ annealing for 30 sec, 72℃ extension for 15 sec, for a total of 34 cycles; and a final extension at 72℃ for 10 min. After amplification, the DNA was analyzed by 1% agarose gel electrophoresis to confirm the accurate size of the target gene. Sanger sequencing was then performed to determine the mutation information of the resistant and susceptible populations. Among them, the mutation type 19-C3 in the resistant population was W2027C (TGG-TCG), and the mutation type 21-C7 was W2027S (TGG-TGT).

[0044] The OpCas-LAMP technology of this invention integrates the CRISPR / Cas system with LAMP, which not only achieves rapid detection of resistance mutations in weed herbicide targets with high specificity and sensitivity, but also simplifies the operation process, reduces dependence on professional equipment and personnel, provides strong support for large-scale resistance screening and precision application in the field, and effectively promotes the formulation and implementation of weed resistance management strategies.

[0045] Table 1. PCR reaction system for amplifying the ACCase gene of Dioscorea opposita

[0046] Example 2 1. Establishment, optimization, and performance analysis of the OpCas-LAMP detection technology system 1.1 Design of OpCas-LAMP detection primers The guide RNA used for CRIPSR / Cas cleavage was designed with wild-type ACCase sites 1999 (TGG) and 2027 as the benchmark for Cas9 PAM recognition. A single-stranded guide RNA (sgRNA) was designed, consisting of a complex of crRNA and tracrRNA. Wild-type ACCase site 2041 (ATT) was used as the benchmark for Cas12 PAM recognition. The sequences of the sgRNA (containing crRNA and tracrRNA) used for Cas9 and the crRNA used for Cas12 are shown in Table 2. These sequences were synthesized by Shanghai Sangon Biotech Co., Ltd. (Sangon Biotech, Shanghai, China).

[0047] In vitro transcription was performed using the HiScribe™ T7 RNA Synthesis Kit (NEB), and RNA purification was performed using the RNA Clean & Concentrator™-25 RNA purification kit (ZYMO RESEARCH, Irvine, USA).

[0048] Based on the ACCase-encoding gene sequence of Dioscorea opposita, specific LAMP amplification primers were calculated (Table 2). In OpCas-LAMP detection, the LAMP primers must contain the mutation site to ensure amplification analysis of resistant mutants. Primers were used to detect the Trp-2027-Cys / Ser mutation, the Trp-1999-Cys mutation at position 1999, and the Ile-2041-Asn mutation at position 2041. The primers were synthesized by Shanghai Sangon Biotech Co., Ltd. (Sangon Biotech, Shanghai, China).

[0049] Table 2 OpCas-LAMP primer sequences

[0050] Table 3 Guiding Sequence

[0051] 1.2. Principle of OpCas-LAMP Detection of Digitaria Resistance SNPs The resistance mechanism of *Digitaria buergeriana* to the acetyl-CoA carboxylase (ACCase) inhibitor herbicide cyhalofop-butyl originates from mutations at the Trp-2027 / Trp-1999 / Lie-2041 sites. In this study, single nucleotide polymorphisms (SNPs) at the 1999, 2027, and 2041 sites significantly enhanced the relevant properties of *Digitaria buergeriana*. These mutations lead to the loss of the protospacer adjacent motif (PAM) of the Cas protein, thus serving as a key site for precise Cas protein recognition. The OpCas-LAMP principle is as follows: Figure 1As shown, Cas9 sgRNA (crRNA & tracrRNA) or Cas12 crRNA is designed to target the PAM site of WT. The Cas / sgRNA complex only digests the expected site in the WT sample, and the digested genomic DNA is then amplified by LAMP. Because the template is digested by Cas protease, wild-type LAMP will result in invalid amplification. Figure 1 A). Figure 1 In section A, (1) is sample processing; (2) is rapid DNA extraction; (3) is OpCas-LAMP detection; and (4) is result reading.

[0052] For resistant mutants, due to the mutation at the PAM site, the Cas protein cannot recognize the target site, and no enzymatic cleavage occurs during the reaction. Figure 1 B), thus generating a LAMP amplification signal. Specifically, the interpretation of the results can be divided into three types: (1) if the sample is only homozygous wild-type, then LAMP cannot generate an amplification curve; (2) if the sample is heterozygous resistance, then the LAMP amplification curve is between that of homozygous wild-type and mutant; (3) if the sample is homozygous mutant, then the LAMP amplification curve will be similar to that of the LAMP positive control. Figure 1 This is a schematic diagram of OpCas-LAMP detection for homozygous resistant (HM) samples (C).

[0053] 1.3 Optimization of the OpCas-LAMP optimal detection system Optimization of the optimal CRISPR / Cas splicing system includes optimizing Cas protein concentration and crRNA concentration, such as... Figure 2 Optimized for CRISPR / Cas shearing and concentration. Figure 2 A) Fluorescent signals at site 2027 of wild-type (TGG) and mutant (TCG / TGT) enzymes cleaved by Cas9. Figure 2 B) Fluorescent signals at site 2041 of wild-type (ATT) and mutant (AAT) enzymes cleaved by the Cas12 enzyme. Figure 2 C) Cas9 enzyme concentration optimization scheme. Figure 2 D) Optimization scheme for Cas12 enzyme concentration. Figure 2 E) Optimization scheme for Cas9 enzyme gRNA (crRNA and tracrRNA) concentration. Figure 2 F) Optimization scheme for Cas12 enzyme crRNA concentration.

[0054] Among them, when the concentrations of Cas9 or Cas12 proteins are 500 nM and 200 nM respectively ( Figure 2 C and Figure 2D), the concentrations of sgRNA:cas9 complex 1 or sgRNA:cas9 complex 2 were 300 nM; the concentration of Cas12 (crRNA, SEQ ID No. 18) helper RNA was 250 nM. Figure 2 E and Figure 2 At time F), the Cas protein exhibits the highest shearing efficiency.

[0055] Optimize key parameters of the LAMP amplification system, such as Figure 3 Optimization for LAMP detection. (A) LAMP primer optimization. (B) P3 primer melting curve. (C) LAMP reaction temperature optimization. (D) Mg 2+ Optimization. (E) dNTPs optimization. (F) Bst polymerase optimization. The optimal amplification system is: amplification temperature of 65℃, Bst DNA polymerase concentration of 0.48U, dNTPs concentration of 1.4mM, and Mg... 2+ The concentration was 2 mM. The optimal working system for single-tube OpCas-LAMP detection after optimization is as follows: The total volume of the reaction system was 25 μL, containing: 1 μL Bst DNA polymerase (final concentration 0.48 U), 1 μL Mg 2+ 1 μL dNTPs (final concentration 2 mM), 2.5 μL 10 × Buffer (B1 for Cas12, B2 for Cas9), 1 μL 25 × primer mixture (FIP / BIP:LF / LB:F3 / B3 final concentrations 1.6, 0.8, 0.4 μM respectively), 1 μL EverGreen I dye (25 × stock), 1 μL Cas protein (Cas9 500 nM, and / or Cas12 200 nM), 1 μL sgRNA (sgRNA-cas9 complex 1300 nM, and / or sgRNA-cas9 complex 1300 nM, and / or crRNA-204 1250 nM), 0.5 μL genomic DNA template, and bring to 25 μL with RNase-free ddH2O.

[0056] Among them, B1 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 μg / ml BSA, pH7.9@25°C), B2 (100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 100 μg / ml BSA, pH7.9@25°C).

[0057] In summary, the single-tube OpCas-LAMP reaction system and amplification reaction conditions are shown in Table 4.

[0058] Table 4. One-tube OpCas-LAMP reaction system and amplification procedure

[0059] 1.4 Detection Performance Analysis Based on OpCas-LAMP Technology Specific crRNA and tracrRNA primers designed for the ACCase gene 2027 mutation site and LAMP primers were used for OpCas-LAMP one-tube detection. The results showed that there was a significant difference in fluorescence signal intensity between wild-type homozygous samples (TGG) and mutant samples (TGT). Figure 4 A). In wild-type samples, the 2027 locus is unmutated (containing TGG), allowing CRISPR / Cas9 to recognize and cleave the wild-type target DNA, thus preventing LAMP amplification and resulting in no fluorescent signal in the wild-type sample. In mutant samples, the 2027 locus is mutated (TGG at the PAM site mutates into TCG or TGT), preventing the CRISPR / Cas9 system from recognizing and cleaving the target DNA. Therefore, the mutant target is amplified by LAMP, resulting in a higher fluorescent signal. Figure 4 (A and 4B). The method was validated for heterozygous resistance analysis by comparing the fluorescence signal intensity of homozygous mutant samples (TGT) and heterozygous mutant samples (TGT). Furthermore, to test the method's versatility, OpCas-LAMP analysis was also performed on the ACCase gene mutation sites 1999 and 2041. The results showed that OpCas-LAMP can accurately distinguish resistance mutations caused by PAM site changes at different sites. Figure 4 C and 4D).

[0060] To validate the detection limit of OpCas-LAMP in heterozygous samples, different proportions of mutant samples were used as templates (0%, 0.5%, 1%, 5%, 10%, 25%, 50%, 75%, and 100%) for OpCas-LAMP detection. Real-time fluorescence monitoring results showed that the fluorescence signal intensity significantly decreased as the proportion of mutant DNA decreased, until the difference became insignificant when the mutant DNA content dropped to 0.5%. Therefore, this indicates that OpCas-LAMP can detect heterozygous resistance alleles as low as 1%. Figure 5 ).

[0061] Example 3: Rapid Analysis Test of OpCas-LAMP on Field Population Samples OpCas-LAMP technology eliminates the need for complex thermal cycling equipment, enabling rapid analysis even under resource-constrained conditions. For example... Figure 6As shown, the OpCas-LAMP field testing process includes four steps ( Figure 6 A): (a) Field sample collection (sample information is shown in Table 5); Table 5

[0062] (b) Rapid DNA extraction, allowing users to choose between rapid release of nucleic acids from a single sample or rapid preparation of nucleic acids using high-throughput technology; (c) OpCas-LAMP amplification detection; (d) Result visualization. OpCas-LAMP can be used in conjunction with dye visualization technology via a portable thermal device.

[0063] Field sample analysis using OpCas-LAMP technology showed that for wild-type homozygous samples (no mutations), the CRISPR / Cas9 system precisely cleaved the target DNA, preventing LAMP amplification and thus eliminating the detection of fluorescence signals. In contrast, for mutant samples (TCG or TGT), due to the mutation at position 2027, the CRISPR / Cas9 system was unable to recognize and cleave the target DNA. Figure 6 B), OpCas-LAMP, by comparing with Sanger sequencing, accurately distinguished the heterozygous resistance of the *Ciliopteryx* variant *T. chrysoberyl* populations (TCG and TGT). Figure 6 C). Through real-time fluorescence monitoring and visual observation of fluorescence color development, the results of this study confirmed the high sensitivity and reliability of the OpCas-LAMP combined detection technology in a field environment.

[0064] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art can make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A reaction system for detecting gene mutations related to herbicide resistance in plants; characterized in that, All reaction components are placed in the same reaction vessel to form a tubular detection system; the reaction components include: (a) CRISPR effector proteins; (b) DNA polymerases with strand displacement activity; (c) Primer set for loop-mediated isothermal amplification of target sequences; and (d) sgRNA that specifically recognizes the target sequence; The primer set used for loop-mediated isothermal amplification of the target sequence includes at least one set of primers targeting specific sites of the acetyl-CoA carboxylase gene; the sites include at least one of the sites 1999, 2027, and 2041. The sgRNA includes at least one crRNA that targets a specific site of the ACCase gene.

2. The reaction system according to claim 1, characterized in that, The CRISPR effector proteins include at least one of Cas9, Cas12a, and Cas12b proteins.

3. The reaction system according to claim 1, characterized in that, The Cas9 protein is preferably SpyCas9 or FnCas9; the Cas12a protein is preferably FnCas12a or LbCas12a; and the Cas12b protein is preferably AacCas12b or BhCas12b.

4. The reaction system according to claim 2, characterized in that, The sgRNA includes: At least one crRNA targeting a specific site of the ACCase gene, wherein the crRNA is selected from: crRNA 1999-Cas9 with the sequence shown in SEQ ID NO.14, crRNA 2027-Cas9 with the sequence shown in SEQ ID NO.15, or crRNA-2041 with the sequence shown in SEQ ID NO.18; When the CRISPR effector protein is Cas9, the sgRNA further includes a universal tracrRNA with the sequence shown in SEQ ID NO.16; the tracrRNA binds to the crRNA 1999-Cas9 to form sgRNA-Cas9 complex 1; Alternatively, tracrRNA may bind to the crRNA 2027-Cas9 to form sgRNA-cas9 complex 2.

5. The reaction system according to claim 1, characterized in that, The primer set for loop-mediated isothermal amplification of the target sequence includes at least one set of primers targeting specific sites of the acetyl-CoA carboxylase gene; said sites include at least one of the sites 1781, 1999, 2027, 2041, 2078, 2088, and 2096. The primer set targeting the ACCase gene 2027 site includes: 2027-F3 as shown in SEQ ID NO.1, 2027-B3 as shown in SEQ ID NO.2, 2027-FIP as shown in SEQ ID NO.3, 2027-BIP as shown in SEQ ID NO.4, and 2027-LF as shown in SEQ ID NO.5; and / or, The primer set targeting the ACCase gene site 1999 includes: sequences as shown in SEQ ID NO. 6 (1999-F3), SEQ ID NO. 7 (1999-B3), SEQ ID NO. 8 (1999-FIP), and SEQ ID NO. 9 (1999-BIP); and / or, The primer set targeting the ACCase gene 2041 site includes: 2041-F3 as shown in SEQ ID NO.10, 2041-B3 as shown in SEQ ID NO.11, 2041-FIP as shown in SEQ ID NO.12, and 2041-BIP as shown in SEQ ID NO.

13.

6. The reaction system according to claim 1, characterized in that, The DNA polymerases with strand substitution properties include one or more of Bst, Vent, phi29, and Taq DNA polymerases.

7. A nucleic acid detection method based on CRISPR and loop-mediated isothermal amplification, characterized in that, Includes the following steps: The reaction system according to any one of claims 1-6 is mixed with the nucleic acid sample to be tested, and the following reaction is performed: a) Under the mediation of the sgRNA, the target sequence is specifically cleaved by CRISPR effector proteins; b) Perform loop-mediated isothermal amplification on the sheared system; The genotype of the target sequence is determined by detecting the product of the loop-mediated isothermal amplification.

8. The detection method according to claim 7, characterized in that, The specific shearing reaction conditions are: 30-37℃ for 20-40 min; the loop-mediated isothermal amplification reaction conditions are: 55-65℃ for 20-40 min.

9. A kit comprising the reaction system as described in any one of claims 1-6.

Images