Molecular markers associated with red shell color trait in vannamei shrimp and application

By developing molecular markers associated with the red shell color trait of Litopenaeus vannamei, the problem of lacking linked markers in body color trait research has been solved, enabling efficient and accurate identification of red-shelled individuals, simplifying the breeding process, and promoting variety improvement.

CN121294680BActive Publication Date: 2026-03-20INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511850927.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-10
Publication Date
2026-03-20
Estimated Expiration
2045-12-10

AI Technical Summary

Technical Problem

In the current technology, there are few studies on the body color trait of Litopenaeus vannamei, and there is a lack of molecular markers that are completely linked to body color, which affects breeding efficiency and variety improvement.

Method used

Molecular markers associated with the red shell color trait in Litopenaeus vannamei, namely LvRE1, LvRE2, and LvRE3 located on chromosomes, were developed. Red-shelled individuals can be identified through specific base mutations. PCR amplification and sequencing typing were performed using specific primer sets, providing a method for identifying individual red-shelled Litopenaeus vannamei.

Benefits of technology

It achieves high-accuracy identification of red-shelled individuals, simplifies the breeding process, lays the foundation for the targeted breeding of red-shelled varieties, and has universality and ease of operation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121294680B_ABST
    Figure CN121294680B_ABST
Patent Text Reader

Abstract

The application belongs to the field of aquatic animal germplasm protection and molecular breeding, and particularly relates to a kind of molecular marker related to Litopenaeus vannamei red shell color and application. The molecular marker is located on a chromosome, i.e. one or several of LvRE1, LvRE2 and LvRE3; the base sequence of LvRE1 is shown in SEQ ID No. 1, the base T at the 192th position in the sequence is mutated to C; the base sequence of LvRE2 is shown in SEQ ID No. 2, the base A at the 56th position in the sequence is mutated to G; the base sequence of LvRE3 is shown in SEQ ID No. 3, the base C at the 185th position in the sequence is mutated to T. The molecular marker related to Litopenaeus vannamei red shell color provided by the application has universality in germplasm from different sources, is simple to operate, has high accuracy, and has a broad application prospect in the genetic breeding research of Litopenaeus vannamei.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of aquatic animal germplasm protection and molecular breeding, and particularly relates to a molecular marker related to the red shell color trait of Litopenaeus vannamei and application thereof. BACKGROUND

[0002] At present, 15 new varieties of Litopenaeus vannamei have been bred in China, and these varieties mainly focus on growth, survival rate and resistance traits, and the study on shell color traits is less.

[0003] In animal genetic breeding, body color is an important economic trait, which not only affects the market appeal of products, but also is closely related to nutritional ingredients and health conditions in some cases. In aquatic animals, the body color of an individual is often one of the important target traits for breeding new varieties or new strains; in addition, the change of body color may also be accompanied by physiological and metabolic changes, thereby affecting the nutritional value and quality of aquatic products, for example, the new variety of Mizuho Gold Chlamys fimbriata, which has orange-red adductor muscle, is rich in carotenoids and can be used as an important source of vitamin A and antioxidant. The golden yellow yellow turtle has significantly higher contents of protein, total amino acids, flavor amino acids and trace element selenium in its skirt edge tissue than the ordinary Chinese soft-shelled turtle, and is a precious food material with comprehensive nutrition and high antioxidant value. The purple Apostichopus japonicus is rich in amino acids and linoleic acid, and can be used as an excellent protein source and natural antioxidant. Therefore, breeding individuals with improved body color traits has significant economic and social benefits for improving the quality of aquatic products and meeting the needs of consumers for high-quality aquatic products. SUMMARY

[0004] The application aims to provide a molecular marker related to the red shell color trait of Litopenaeus vannamei and application thereof.

[0005] To achieve the above-mentioned purpose, the technical scheme adopted by the application is as follows:

[0006] A molecular marker related to the red shell color trait of Litopenaeus vannamei, wherein the molecular marker is located on a chromosome, i.e., one or several of LvRE1, LvRE2 and LvRE3;

[0007] The base sequence of LvRE1 is shown in SEQ ID No. 1, wherein the base T at position 192 is mutated to C;

[0008] The base sequence of LvRE2 is shown in SEQ ID No. 2, wherein the base A at position 56 is mutated to G;

[0009] The base sequence of LvRE3 is shown in SEQ ID No. 3, wherein the base C at position 185 is mutated to T.

[0010] The genotype of the marker LvRE1 in the red individual is CC, the genotype of the marker LvRE2 is GG, and the genotype of the marker LvRE3 is TT.

[0011] The application of the molecular marker related to the red shell color trait of Litopenaeus vannamei in identifying red shell Litopenaeus vannamei individuals.

[0012] A primer for detecting the molecular marker related to the red shell color trait of Litopenaeus vannamei:

[0013] The primer pair of LvRE1 is LvRE1F: TGCCTTTCCTACAAAGGGAAA and LvRE1R: TCATTGTGGAGCTCTTCGCC;

[0014] The primer pair of LvRE2 is LvRE2F: GACCGACTTTCGCAATCTGC and LvRE2R: GCCAAGTGCTCGTAAAAGGC;

[0015] The primer pair of LvRE3 is LvRE3F: ACTTCATAACGGGCTCACGG and LvRE3R: GGTCTCCACTTTGCACTCGA.

[0016] The application of the primer set in identifying red shell Litopenaeus vannamei individuals.

[0017] A kit for detecting the molecular marker related to the red shell color trait of Litopenaeus vannamei, comprising the primer set.

[0018] A method for identifying red shell Litopenaeus vannamei individuals, comprising the following steps: extracting genomic DNA of the to-be-detected Litopenaeus vannamei; taking the extracted genomic DNA as a template, amplifying a sequence fragment containing a target SNP site by using the primer set or the primers in the kit, performing genotyping on the amplification product by using an ABI 3730XL sequencer or other genotyping methods, identifying the genotype of the to-be-detected Litopenaeus vannamei, and determining the red shell Litopenaeus vannamei according to the genotype.

[0019] If the genotype of the marker LvRE1 is CC, the genotype of the marker LvRE2 is GG, and the genotype of the marker LvRE3 is TT, the corresponding to-be-detected individual is red; if the genotype of the marker LvRE1 is CT, the genotype of the marker LvRE2 is AA or AG, and the genotype of the marker LvRE3 is CC or CT, the corresponding to-be-detected individual is ordinary Litopenaeus vannamei with a bluish gray color.

[0020] The application has the following advantages:

[0021] The application provides a molecular marker related to the red shell color trait of Litopenaeus vannamei, which is universal in different sources of germplasm, simple to operate and high in accuracy. The molecular marker solves the problem of a lack of completely linked markers related to the body color trait of Litopenaeus vannamei, and can be used not only for the breeding of Litopenaeus vannamei with red shell color, but also for positioning genes related to the red shell color, thereby laying a foundation for subsequent directional breeding. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 A photo of the red Litopenaeus vannamei mutant provided for the embodiment of the application.

[0023] Figure 2 The SNP marker related to the red shell color trait of Litopenaeus vannamei provided for the embodiment of the application; wherein A is the SNP marker LvRE1 related to the red shell color trait, B is the SNP marker LvRE2 related to the red shell color trait, and C is the SNP marker LvRE3 related to the red shell color trait.

[0024] Figure 3 The application of the marker in the identification of red germplasm provided for the embodiment of the application; wherein A is the application result of the SNP marker LvRE1 related to the red shell color trait, B is the application result of the SNP marker LvRE2 related to the red shell color trait, and C is the application result of the SNP marker LvRE3 related to the red shell color trait. DETAILED DESCRIPTION

[0025] The specific embodiments of the application are further described below in conjunction with examples, and it should be pointed out that the specific embodiments described herein are only for the purpose of illustrating and explaining the application, and are not limited to the application.

[0026] One or several of the three SNP markers completely linked in the application can be used for the identification of the red shell color trait; other primers designed based on the sequences of the SNP markers related to the red shell color trait of the application and the application thereof in the identification of the red shell color trait.

[0027] Example 1: Identification of the molecular marker related to the red shell color trait of Litopenaeus vannamei

[0028] (1) Discovery of the red mutant of Litopenaeus vannamei

[0029] For Litopenaeus vannamei, the body color of the conventional Litopenaeus vannamei is light gray, and the red mutant is discovered in the breeding according to the group breeding method by Hainan Xinfang Aquaculture Co., Ltd., and the main feature is that the body surface is red. The red individual obtained above is used for separate breeding to produce offspring, and the offspring are all red. The strain has been stably inherited after multiple generations of breeding. Figure 1

[0030] ​(2) Sample sampling and resequencing analysis

[0031] A total of 106 red mutant individuals were taken from the breeding base of Hainan Xinfang Seed Company Limited, and 200 ordinary Litopenaeus vannamei individuals were taken from the previous data of different sources of germplasm, including domestic self-breeding germplasm and imported germplasm. After extracting DNA from the above samples, high-throughput sequencing library construction and whole genome resequencing were performed, and high-throughput sequencing was performed using an MGISEQ-T7 sequencer. The sequencing data of each sample was 20G.

[0032] (3) Whole genome SNP discovery

[0033] After filtering the sequencing data using fastp v0.23.4 software, high-quality reads were obtained, which were aligned to the Litopenaeus vannamei reference genome (http: / / www.shrimpbase.net / vannamei.html) using BWA, and SNP typing was performed using GATK4 software to obtain SNP sites. Further filtering of these SNP sites using Vcftools was performed by minimum allele frequency (> 0.05) and site typing success rate (> 0.9) to obtain high-quality SNP sites, a total of about 15M SNP sites were obtained.

[0034] (4) Identification of red shell color trait-related SNPs

[0035] Using the obtained high-quality SNP sites, combined with the phenotype information of each individual, rMVP was used for analysis, and mixed linear model (MLM) was used to identify SNP markers closely related to the red phenotype trait. The results showed that the trait-related markers were on chromosome 16, and 6 markers were selected for verification in 306 samples. The verification method used direct first-generation sequencing after PCR amplification, and after verification, the following four markers showed complete differences in all red and ordinary individuals (see Figure 2 ), the genotype of marker LvRE1 in red individuals was CC, the genotype of marker LvRE2 was GG, and the genotype of marker LvRE3 was TT. The genotype of marker LvRE1 in ordinary Litopenaeus vannamei was CT, the genotype of marker LvRE2 was AA or AG, and the genotype of marker LvRE3 was CC or CT, so these markers were determined as red skin trait-related SNP markers. The sequences of these markers are as follows:

[0036] LvRE1 sequence

[0037] SEQ ID No. 1

[0038] TATATATGATTATGAATTACATTATATATGCCTTTCCTACAAAGGGAAAGGTATGAGATTATGATAATGTTAAACAATATGATATTTTTGGTACTTCACTCAAACATAAATTATGATTCGCTTTATGTACATTAGGTAAAAGAGTATCTTTATTTTCACGCATATTTCTATTATAATATTAGAAGGGCCCA[C / T]AACGGACCTATGGCCAGTGCCATTGTAGGTAATGCGATACGTATATACTGAATCATGATATAAATTATCATAAACTTTGTTTTAAATTTAATTCAAATATTCCTCTCTTCATACCTCCCTTGGCGTCAGCGGGAGCAGACTGGCCGGGGTGATCGGCGAAGAGCTCCACAATGAGATCC

[0039] LvRE2 sequence

[0040] >SEQ ID No. 2

[0041] GACCGACTTTCGCAATCTGCGTGAGGTCATGGGATACCATTCCTATAGGAATATT[A / G]GCGTCAAAAACTCACTGTTCACCGTATTCAATAACCTGTAGGTAATAATTACACAATTAACGAGTCTGCAATGAAAGTGCAACAGTAAAGCACGCCTTTTACGAGCACTTGGC

[0042] LvRE3 sequence

[0043] >SEQ ID No. 3

[0044] ACTTCATAACGGGCTCACGGACACTTATGTGTCCAATAACTTCGTTAGTTTTGAGTTGCGAAGGAAGTACATAGAAGAAAAGTTTCTTAGAATCACTCGCTTTATCATTTGCATATGTTATTTTTCGTCTAAAAGGCGGCTGGCAGAATTTTGACCAATACCCACATCTGTAGTTCAGTTAAAT[C / T]ACCTCGCGTGTACAGCATAGTTAGCAAACTGGTAACTACGAAACCTTCTGGAGATATTCTACAACTCTCAAATATCCTCGATCGTACGTCAAGTCTCCGGGAATTGCTACAAGAAACGATGACTTTCTTCACTTTCCTTAAAATACCCAGACTTCCGACTTTCATAATCAGAGAAGCATTGCAATGACTATTGGCACCCAATTGACATAAACACAAACTAATGGGAACTCCTTATTATTCTCTTACTTACAATTTCTTTCACTGGCACTTCCGTCAGGCTCATCATACTCAGGTCGAGTTCATTGCCATCTAGCTTGTCTCGGAGGTTATTCTTGGCCATTTTGCGAGGCGAGAGAGGCTGCCTTGTGGTACGAGCGTAGAACAGCTGATCGAGTGCAAAGTGGAGACC.

[0045] Example 2: Application of the red shell color related molecular marker of Litopenaeus vannamei

[0046] This example provides the application of the marker in red germplasm identification, which is not limited to the method, and can also be used for rapid breeding of red skin individuals with molecular marker assistance, etc.

[0047] (1) Extraction of DNA from Litopenaeus vannamei

[0048] Sixty-two red individuals of Litopenaeus vannamei were randomly selected from Xinfang Seed Company Limited, and forty-eight ordinary Litopenaeus vannamei (including twelve Litopenaeus vannamei of Zhengda germplasm, eight Litopenaeus vannamei of Huanghua population, four Litopenaeus vannamei of “Kehai No. 1” germplasm material, four Litopenaeus vannamei of “Guangtai No. 1” germplasm, four Litopenaeus vannamei of “Bohai No. 1” germplasm, four Litopenaeus vannamei of “Purmo” germplasm, four Litopenaeus vannamei of blue gene germplasm, and eight Litopenaeus vannamei of Ecuadorian origin) were collected from the market, which together constituted the experimental materials.

[0049] The DNA of muscle tissue of red skin individuals and common individuals was extracted using Tian Gen plant genome extraction kit, and the DNA concentration and quality were detected by Nanodrop and agarose gel electrophoresis.

[0050] (2) PCR amplification and sequencing typing

[0051] The sequence of the target region of each individual was amplified by using the following primer pairs:

[0052] Primer 1:

[0053] LvRE1F: TGCCTTTCCTACAAAGGGAAA (SEQ ID No. 4)

[0054] LvRE1R: TCATTGTGGAGCTCTTCGCC (SEQ ID No. 5)

[0055] Primer 2:

[0056] LvRE2F: GACCGACTTTCGCAATCTGC (SEQ ID No. 6)

[0057] LvRE2R: GCCAAGTGCTCGTAAAAGGC (SEQ ID No. 7)

[0058] Primer 3:

[0059] LvRE3F: ACTTCATAACGGGCTCACGG (SEQ ID No. 8)

[0060] LvRE3R: GGTCTCCACTTTGCACTCGA (SEQ ID No. 9).

[0061] The PCR amplification system was as follows: 12.5 μl 10×Golden polymerase Buffer, 0.5 μl forward primer, 0.5 μl reverse primer, 0.25 μl Golden polymerase, 2 μl DNA template, 9.75 μl DEPC water. The amplification program was as follows: 94℃ for 5 minutes, then 94℃ for 30 seconds, 60℃ for 30 seconds, 72℃ for 40 seconds, a total of 35 cycles, and finally 72℃ for 10 minutes;

[0062] The PCR amplification product was sequenced by using ABI 3730XL sequencer, and the sequencing primer was primer 1. According to the sequencing peak map, the three SNP sites of LvRE1, LvRE2 and LvRE3 were typed.

[0063] (3) Result analysis

[0064] According to the genotyping results, 110 individuals were obtained. If the following conditions are met, the individual is determined to be a red skin individual: the genotype of marker LvRE1 is CC, the genotype of marker LvRE2 is GG, and the genotype of marker LvRE3 is TT. If the following conditions are met, the individual is determined to be a normal Litopenaeus vannamei individual: the genotype of marker LvRE1 is CT, the genotype of marker LvRE2 is AA or AG, and the genotype of marker LvRE3 is CC or CT. Through the above four markers, 62 red individuals and 48 normal individuals were identified. Among the red individuals, the genotype of marker LvRE1 is CC, the genotype of marker LvRE2 is GG, and the genotype of marker LvRE3 is TT. Taking “Ke Hai No. 1” and “Guangtai No. 1” as examples, the genotype of marker LvRE1 is CT, the genotype of marker LvRE2 is AA or AG, and the genotype of marker LvRE3 is CC or CT. See Table 2. Figure 3 .

[0065] The identification accuracy of red individuals and normal white individuals using the marker is 100%, which confirms the effectiveness of the marker.

Claims

1. A molecular marker associated with the red shell color trait of Litopenaeus vannamei, characterized in that: The molecular markers are located on the chromosome, specifically one or more of LvRE1, LvRE2, and LvRE3; The base sequence of LvRE1 is shown in SEQ ID No.1, in which the 192nd base T is mutated to C; The base sequence of LvRE2 is shown in SEQ ID No. 2, in which the 56th base A is mutated to G; The base sequence of LvRE3 is shown in SEQ ID No.3, in which the 185th base C is mutated to T.

2. The molecular marker related to the red shell color trait of Litopenaeus vannamei according to claim 1, characterized in that: In the red individuals, the genotype of LvRE1 was CC, the genotype of LvRE2 was GG, and the genotype of LvRE3 was TT.

3. The application of a molecular marker related to the red shell color trait of Litopenaeus vannamei as described in claim 1, characterized in that: Application of the molecular markers in identifying individual Litopenaeus vannamei; In the red individuals, the genotype of LvRE1 was CC, the genotype of LvRE2 was GG, and the genotype of LvRE3 was TT.

4. An application of a primer set for detecting molecular markers related to the red shell color trait of Litopenaeus vannamei as described in claim 1, characterized in that: Application of the primer set in identifying individual Litopenaeus vannamei; Specifically, using the extracted genomic DNA as a template, the sequence fragment containing the target SNP site was amplified using a primer set; the genotype of LvRE1 in Litopenaeus vannamei individuals was CC, the genotype of LvRE2 was GG, and the genotype of LvRE3 was TT. The primer pairs for LvRE1 are LvRE1F: TGCCTTTCCTACAAAGGGAAA and LvRE1R: TCATTGTGGAGCTCTTCGCC; The primer pairs for LvRE2 are LvRE2F: GACCGACTTTCGCAATCTGC and LvRE2R: GCCAAGTGCTCGTAAAAGGC; The primer pairs for LvRE3 are LvRE3F: ACTTCATAACGGGCTCACGG and LvRE3R: GGTCTCCACTTTGCACTCGA.

5. A method for identifying individual Litopenaeus vannamei, characterized in that: Genomic DNA was extracted from the Litopenaeus vannamei to be tested; using the extracted genomic DNA as a template, the sequence fragment containing the target SNP site was amplified using the primer set described in claim 4; the amplification product was sequenced by an ABI 3730XL sequencer or other genotyping methods to identify the genotype of the Litopenaeus vannamei to be tested, and the red-shelled Litopenaeus vannamei was determined based on the genotype. If the genotype of LvRE1 is CC, the genotype of LvRE2 is GG, and the genotype of LvRE3 is TT, or one or more of these, the corresponding individual to be tested will have a red genetic color. If the genotype of LvRE1 is CT, the genotype of LvRE2 is AA or AG, and the genotype of LvRE3 is CC or CT, or one or more of these, the corresponding individual to be tested will have a bluish-gray genetic color, typical of Litopenaeus vannamei.

Citation Information

Patent Citations

  • SNP (single nucleotide polymorphism) marker significantly correlated with weight trait of whiteleg shrimps, and application of SNP marker

    CN109971865A