KASP molecular marker kit for detecting early flowering stage traits of pears

Abstract

The invention discloses an application of a single nucleotide polymorphism site as a detection target in preparation of a kit for detecting the early flowering stage character of pears, and belongs to the technical field of plant molecular markers, the single nucleotide polymorphism site is that the 247th site of a nucleotide sequence shown as SEQ ID NO.1 has polymorphism of C > T, and the 247th site of the nucleotide sequence shown as SEQ ID NO.2 has polymorphism of C > T; the single nucleotide polymorphism site is used as a detection target spot for detecting the early flowering stage character of the pear; the method is rapid, simple and convenient, has high specificity, can realize high-throughput detection, and has important significance in early flowering stage variety identification, new variety breeding, breeding period shortening and breeding efficiency improvement.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant molecular markers, and particularly relates to a KASP molecular marker kit for detecting early flowering traits of pear. BACKGROUND

[0002] Pear (Pyrus) is a deciduous fruit tree, which originated from the high-altitude areas near the Hengduan Mountains in Southwest China. Pear is cultivated in both the northern and southern parts of China, with a wide cultivation area and a large total yield. As a deciduous fruit tree, pear flower buds enter a dormant state in winter and germinate in the spring of the following year. China is the original habitat of pear, and has rich pear germplasm resources. In the long-term evolution process, pear varieties in different regions have gradually adapted to the local ecological environment. In northern China, the time to reach the suitable temperature in spring is relatively late, and early flowering is prone to low temperature, causing damage to flower organs and being not conducive to the natural propagation of pear trees. Therefore, there are fewer varieties with early flowering in northern China. In southern China, the spring temperature rises early, and early flowering does not have obvious disadvantages, so this trait exists in local varieties.

[0003] In recent years, with the intensification of global climate change, extreme weather phenomena such as warm winters and spring frosts have occurred frequently, which has had a huge impact on the fruit tree industry. At present, different cultivation environments have different requirements for the flowering period of pear. In open field cultivation, a slightly later flowering period is beneficial to avoiding spring frosts, protecting flower organs from cold damage, and ensuring yield and quality. In protected cultivation, varieties with early flowering have earlier fruiting and maturation, which can help to seize the market and extend the supply period of fruit products. The above requirements force breeders to select pear varieties with different flowering periods.

[0004] DAM proteins belong to the AGL24 / SVP branch of the MADS-box family and are key proteins for regulating the flowering period of woody fruit trees. In pear, five DAM genes have been identified, among which DAM1, DAM2, and DAM3 are tandemly repeated on chromosome 8. Studies have shown that the DAM gene locus on chromosome 8 is highly related to the germination time of pear, but there is still a lack of specific variations that change the flowering period of pear.

[0005] Molecular markers can be used for variety identification and selection of hybrid offspring. Single nucleotide polymorphism (SNP) is the most numerous and widely distributed DNA polymorphism in the genome, which is suitable for developing molecular markers. KASP technology, i.e., Kompetitive Allele Specific PCR, can accurately determine the double alleles of SNPs in genomic DNA samples. At present, there are few KASP markers related to the flowering period of pear. The development of KASP molecular markers for the flowering period of pear is of great significance for the selection of new varieties with different flowering periods. SUMMARY

[0006] The purpose of this invention is to address the shortcomings of existing technologies by providing a KASP molecular marker kit for detecting early flowering traits in pears. This kit can distinguish pear varieties with earlier flowering periods at a low cost.

[0007] The objective of this invention is achieved through the following technical solution: the application of single nucleotide polymorphism sites as detection targets in the preparation of a kit for detecting the early flowering trait of pear, wherein the single nucleotide polymorphism site is the 247th position of the nucleotide sequence shown in SEQ ID NO.1, which exhibits a C>T polymorphism.

[0008] Furthermore, the kit includes a specific primer for detecting a single nucleotide polymorphism at position 247 of the nucleotide sequence shown in SEQ ID NO.1.

[0009] Furthermore, the specific primers are in two pairs, wherein the nucleotide sequence of the forward primer 1 of primer pair I is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer 3 is shown in SEQ ID NO.4; the nucleotide sequence of the forward primer 2 of primer pair II is shown in SEQ ID NO.3, and the nucleotide sequence of the reverse primer 3 is shown in SEQ ID NO.4.

[0010] The present invention also provides a KASP molecular marker kit for detecting the early flowering trait of pear, the kit comprising: a primer set for specifically detecting the single nucleotide polymorphism at position 247 in the nucleotide sequence shown in SEQ ID NO.1.

[0011] Furthermore, the primer set includes forward primer 1, forward primer 2 and reverse primer 3, whose nucleotide sequences are shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0012] This invention also provides a method for identifying early-flowering pear varieties / lines, comprising the following steps: (1) Genomic DNA of the pear variety to be tested was extracted as a template, and PCR reaction was performed using a primer set specifically for detecting the single nucleotide polymorphism at position 247 in the nucleotide sequence shown in SEQ ID NO.1; (2) Determine the early flowering trait of the sample to be tested based on the genotype of the product: If the product genotype is CT or TT, the sample to be tested is determined to be a variety / strain with an earlier flowering period; If the product genotype is CC, the sample to be tested is determined to be a variety / strain with a later flowering period.

[0013] Further, in step (1), the primer set with nucleotide sequences such as SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 is used to perform KASP reaction detection; in step (2), the fluorescence data of the reaction product is read, and each sample is genotyped according to the relative intensity of fluorescence at different wavelengths.

[0014] Furthermore, the KASP reaction system consists of: FLU-ARMS 2x PCR Mix, forward primer 1 with a final concentration of 0.1 μM, forward primer 2 with a final concentration of 0.1 μM, reverse primer 3 with a final concentration of 0.3 μM, and 100 ng of genomic DNA template.

[0015] Compared with existing technologies, the beneficial effects of this invention are as follows: This invention provides a kit for detecting early-flowering pear varieties / lines, containing three KASP primers designed based on DAM1 single nucleotide polymorphism (SNP). DAM1 SNP is significantly associated with the early-flowering trait, and KASP technology can efficiently detect SNPs at specific loci in the genes of the tested varieties / hybrid progeny. This method is rapid, simple, highly specific, and can achieve high-throughput detection, which is of great significance for identifying early-flowering varieties and breeding new varieties, shortening the breeding cycle, and improving breeding efficiency. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1 This is a schematic diagram of the DAM1 gene mutation sites.

[0018] Figure 2 The image shows the results of KASP genotyping using 63 pear samples. Circles represent samples with genotype CC, triangles represent samples with genotype CT, and squares represent samples with genotype TT. Detailed Implementation

[0019] The present invention will now be described in detail with reference to the accompanying drawings. Unless otherwise specified, the features of the following embodiments and implementations can be combined with each other.

[0020] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0021] This invention analyzed the DAM1 sequence of northern and southern varieties of Pyrus pyrifolia. It was found that, compared to the northern varieties, the southern varieties, which flower earlier, exhibited a C-to-T variation at position 247 of the DAM1 coding region (nucleotide sequence shown in SEQ ID NO. 1). Figure 1 As shown, when the base is C, it represents the normal genetic state of the DAM1 gene. When the base is T, a stop codon TAA is formed, leading to premature termination of protein translation. This results in the protein lacking active domains such as the K-box, leading to protein inactivation.

[0022] Further analysis of the genotypes at this SNP locus in 263 pear samples from different regions across the country revealed three types: CC, CT, and TT. Further analysis of the initial spring flowering time of different genotypes showed that individuals carrying the mutant genotype T (i.e., individuals with the CT and TT genotypes) had a significantly earlier initial spring flowering time (Table 1). These SNPs can serve as molecular markers for determining the flowering time of unknown varieties, or as molecular markers for determining the flowering time of offspring when using early-flowering varieties carrying genotype T as parents in variety breeding.

[0023] Table 1: DAM1 base variation is significantly correlated with the time of initial flowering in spring. As an application of the aforementioned molecular markers, the present invention also provides a reagent component specifically for the identification of early-flowering varieties and their offspring, comprising a KASP marker primer pair for detecting the nucleotide type of the aforementioned SNP site.

[0024] To address the single nucleotide polymorphism (SNP) at a specific site in the DAM1 gene, this invention designed a set of KASP molecular marker primers, including two specific upstream primers and one specific downstream primer. Each specific upstream primer corresponds to a specific C and T base sequence. The forward primer 1 is fronted with a universal fluorescent sequence FAM, and the forward primer 2 is fronted with a universal fluorescent sequence HEX. These primers, along with the reverse primer 3, are used for specific PCR amplification, producing a 65 bp product. After the reaction, the fluorescence intensity at two different wavelengths in the reaction solution is read to determine the genotype of the corresponding base.

[0025] Specifically, the sequences of the upstream and downstream primers for PCR are as follows: Forward primer 1: 5'GAAGGTGACCAAGTTCATGCTCATACTGGTGGGGAAAAATCGGATC3' (as shown in SEQ ID NO. 2); Forward primer 2: 5'GAAGGTCGGAGTCAACGGATTCATACTGGTGGGGAAAAATCGGATT3' (as shown in SEQ ID NO. 3); Reverse primer 3: 5'ATATTGAACTGAATAACCTGCAGTTGGTG3' (as shown in SEQ ID NO. 4); It also includes reagents such as PCR premix required for KASP labeling, which can be replaced by commercially available conventional KASP labeling kits, and is common knowledge to those skilled in the art.

[0026] The PCR reaction system consists of the following components in a total volume of 10 μL: 5 μL of FLU-ARMS 2x PCR Mix, 0.1 μL of 10 μM forward primer 1, 0.1 μL of 10 μM forward primer 2, 0.3 μL of 10 μM reverse primer 3, 3.5 μL of ddH2O, and 1 μL of DNA template (approximately 100 ng / μL).

[0027] This invention also provides a method for detecting the presence of the aforementioned single nucleotide polymorphism (SNP) C to T in an in vitro DNA sample, the specific steps of which are as follows: 1. Pear genomic DNA was extracted as a template, and KASP molecular marker amplification was performed using DAM1 gene-specific upstream and downstream primers to obtain amplification products. The DAM1 gene-specific primers consist of two pairs, namely forward primer 1 and reverse primer 3, and forward primer 2 and reverse primer 3. 2. After PCR amplification, use a real-time PCR instrument to read the fluorescence and perform genotyping on each sample based on the relative intensity of fluorescence at different wavelengths; 3. Using individuals with known genotypes CC (Cuiguan Pear), CT (Yeshen Pear), and TT (Hengxian Lingshan Pear) as controls in the genotyping results, the genotype of the unknown variety is determined. If the genotype is CT or TT, it indicates that the individual flowers earlier and is suitable for cultivation in areas where spring temperatures rise earlier or in greenhouses.

[0028] Example 1: DAM1 gene single nucleotide polymorphism and early flowering trait detection kit 1. Identification of SNPs associated with early flowering trait Based on the above research, we found that the C>T base variation was significantly associated with the early flowering trait. Therefore, in this embodiment, we designed KASP marker primers for detecting single nucleotide polymorphisms at specific sites in the DAM1 gene, and finally designed a kit for detecting the early flowering trait.

[0029] 2. Prepare a dedicated reagent kit (100 tests, see Table 2 for specific reagent composition). Table 2: Composition of the DAM1 gene single nucleotide polymorphism detection kit 3. Extraction of DNA from the tested varieties Genotyping of specific loci of the DAM1 gene was analyzed in 63 pear varieties. Among them, Cui Guan pear (genotype CC), Ye Shen pear (genotype CT), and Hengxian Lingshan pear (genotype TT) served as control varieties. 0.2g of young tissue from each variety was collected, and genomic DNA was extracted using the traditional CATB method or a commercially available plant genomic DNA extraction kit. The extracted genomic DNA was dissolved in ddH2O, adjusted to a concentration of approximately 100 ng / μL, and stored at low temperature for later use.

[0030] 4. PCR amplification and fluorescence signal reading Prepare the KASP genotyping mixture (excluding the DNA template) according to the following formula. Pipette the KASP genotyping mixture thoroughly and centrifuge. Aliquot the mixture into 96-well plates, 9 μL per well, adding 1 μL of DNA template (approximately 100 ng / μL) to each well. Seal the 96-well plate with sealing film and centrifuge.

[0031] Table 3: KASP typing reagent formulation for a single test PCR amplification was performed using a real-time PCR instrument, and the amplification procedure is shown in Table 4.

[0032] Table 4: PCR amplification procedures used for KASP typing The plate reading step is to scan the fluorescence; simply select to read the FAM and HEX fluorescence values ​​in the settings.

[0033] 5. SNP typing and flowering time determination of tested varieties like Figure 2 As shown in the example experiment, pear varieties were clustered into three different types, successfully distinguishing varieties with CC, CT, and TT genotypes. Among them, the square and triangular individuals had genotypes of TT and CT, respectively, and were predicted to have earlier flowering periods; the round individuals had genotype CC, and were predicted to have later flowering periods.

[0034] The above embodiments are only used to illustrate the design concept and features of the present invention, and their purpose is to enable those skilled in the art to understand the content of the present invention and implement it accordingly. The protection scope of the present invention is not limited to the above embodiments. Therefore, all equivalent changes or modifications made based on the principles and design ideas disclosed in the present invention are within the protection scope of the present invention.

Claims

1. The application of single nucleotide polymorphism sites as detection targets in the preparation of kits for detecting early flowering trait in pears, characterized in that, The single nucleotide polymorphism site is the nucleotide sequence shown in SEQ ID NO.1, where position 247 has a C>T polymorphism.

2. The application as described in claim 1, characterized in that, The kit includes specific primers for detecting a single nucleotide polymorphism at position 247 of the nucleotide sequence shown in SEQ ID NO.

1.

3. The application as described in claim 2, characterized in that, The specific primers consist of two pairs, wherein the nucleotide sequence of the forward primer 1 of primer pair I is shown in SEQ ID NO.2 and the nucleotide sequence of the reverse primer 3 is shown in SEQ ID NO.4; the nucleotide sequence of the forward primer 2 of primer pair II is shown in SEQ ID NO.3 and the nucleotide sequence of the reverse primer 3 is shown in SEQ ID NO.

4.

4. A KASP molecular marker kit for detecting early flowering trait in pear, characterized in that, The kit includes a set of primers for the specific detection of a single nucleotide polymorphism at position 247 of the nucleotide sequence shown in SEQ ID NO.

1.

5. The KASP molecular marker kit for detecting the chilling requirement trait of pears as described in claim 4, characterized in that, The primer set includes forward primer 1, forward primer 2 and reverse primer 3, whose nucleotide sequences are shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, respectively.

6. A method for identifying early-flowering pear varieties / lines, characterized in that, Includes the following steps: (1) Genomic DNA of the pear variety to be tested was extracted as a template, and PCR reaction was performed using a primer set specifically for detecting the single nucleotide polymorphism at position 247 in the nucleotide sequence shown in SEQ ID NO.1; (2) Determine the early flowering trait of the sample to be tested based on the genotype of the product: If the product genotype is CT or TT, the sample to be tested is determined to be a variety / strain with an earlier flowering period; If the product genotype is CC, the sample to be tested is determined to be a variety / strain with a later flowering period.

7. The method for identifying low chilling-requirement pear varieties / lines as described in claim 6, characterized in that, In step (1), the KASP reaction detection is performed using primer sets with nucleotide sequences such as SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4; in step (2), the fluorescence data of the reaction products are read, and each sample is genotyped according to the relative intensity of fluorescence at different wavelengths.

8. The method for identifying low chilling-requirement pear varieties / lines as described in claim 7, characterized in that, The KASP reaction system consists of: FLU-ARMS 2x PCR Mix, forward primer 1 with a final concentration of 0.1 μM, forward primer 2 with a final concentration of 0.1 μM, reverse primer 3 with a final concentration of 0.3 μM, and 100 ng of genomic DNA template.

Images