Cell-free biosensor based on transcription factor and application of cell-free biosensor in detection of antibiotics in water environment

Abstract

The invention relates to a transcription factor-based cell-free biosensor and an application thereof in water environment antibiotic detection. Firstly, a cell-free biosensor containing TetR or MphR is constructed, the cell-free biosensor comprises a DNA template, a transcription factor TetR or MphR, RNA polymerase and a DFHBI-1T fluorescent probe, the DNA template comprises a reporter gene capable of being combined with the fluorescent probe, and an operon corresponding to the transcription factor TetR or MphR is arranged on the upstream of the reporter gene; the biosensor can respond to tetracycline or macrolide antibiotics, and further, the content of the antibiotics can be measured according to the change of fluorescence intensity in a cell-free biosensor system. The invention provides the cell-free biosensor with high sensitivity and high stability, and the biosensor can realize high-efficiency detection under different water body conditions and realize stronger environmental adaptability.

Description

Technical Field

[0001] This invention belongs to the field of biological detection, and in particular relates to a low-cost, easy-to-use, field-deployable cell-free biosensor based on transcription factors, which can be used for the detection of tetracyclines and / or macrolides in the water environment. Background Technology

[0002] The continuous growth of the global population and the expanding demand for animal protein have become significant trends of our time. The use of antibiotics has long since exceeded the scope of clinical treatment. Statistics show that 73% of antimicrobial drugs sold globally are used in animal husbandry. From antibiotic production wastewater and animal excrement to discarded medical waste, antibiotics enter environmental media such as water and soil through multiple pathways. If antibiotic residues in the environment are not treated promptly, they may contaminate drinking water, enter plant systems, and even enter the human body through the food chain. Studies have shown that antibiotic residues at levels of ng / L have been detected in drinking water. Due to improper wastewater treatment, surface water and groundwater are severely polluted with antibiotics, with concentrations reaching up to 6.5 mg / L. This pollution not only exacerbates the generation and spread of bacterial resistance but also disrupts the symbiotic microbial community in the soil-plant ecosystem, causing biotoxicity and neurotoxicity to aquatic plankton and potentially leading to an imbalance in the human gut microbiota. Tetracyclines and macrolides are of particular concern due to their stability, low metabolic rate, and toxicity. Therefore, developing accurate and rapid on-site detection methods is crucial for monitoring and controlling antibiotic pollution.

[0003] Currently, various methods have been established for the detection and quantitative analysis of antibiotics. High-performance liquid chromatography (HPLC) and liquid chromatography-tandem mass spectrometry (LC-MS / MS) have been used for the quantitative detection of single or multiple classes of antibiotics. Although these methods offer high precision and sensitivity, they rely on expensive instruments, involve complex and time-consuming sample pretreatment, and require highly skilled personnel, limiting their application in in-situ detection. Microbiological methods, as an early antibiotic detection approach, are low-cost and offer intuitive analysis, but their reliance on microbial bioactivity results in lower precision and susceptibility to numerous influencing factors, thus limiting their use for quantitative antibiotic detection; they are primarily used for analyzing antibiotic antibacterial activity. In contrast, enzyme-linked immunosorbent assay (ELISA) has attracted widespread attention due to its high specificity, sensitivity, and short processing time. With technological advancements, ELISA has achieved high-throughput detection and has become the mainstream method for quantitative antibiotic detection. However, its complex operation and high operator skill requirements limit its application in field testing. With the development of synthetic biology, the construction of biosensors based on microorganisms (TFs) that can respond to antibiotic contamination has garnered attention. Among them, TF-based cell biosensors have become one of the effective tools for in situ detection of antibiotics due to their high sensitivity and strong multifunctionality. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides a cell-free biosensor based on transcription factors and its application in the detection of antibiotics in aquatic environments.

[0005] The technical solution adopted in this invention is: a cell-free biosensor based on transcription factors, including a DNA template, transcription factors TetR or MphR, RNA polymerase and a fluorescent probe, wherein the DNA template includes a reporter gene that can bind to the fluorescent probe, and an operon corresponding to the transcription factor TetR or MphR is provided upstream of the reporter gene.

[0006] Preferably, it also includes rNTPs, a thermostable inorganic pyrophosphatase, and a 5× transcription buffer (200 mM Tris-HCl, 30 mM MgCl2, 50 mM DTT, 50 mM NaCl, and 10 mM spermidine), wherein the transcription buffer contains MgCl2. 2+ .

[0007] Preferably, when the DNA template is 25 nM, the rNTP concentration is 11.4 mM, and the Mg... 2+ The concentration was 14 mM;

[0008] Preferably, the TetR / DNA concentration ratio is 25:1, and the MphR / DNA concentration ratio is 30:1.

[0009] Preferably, the DNA template also includes a T7 promoter and a T7 terminator, the reporter gene is 3WJdB, and the fluorescent probe is DFHBI-1T.

[0010] Preferably, the DNA template also includes a spacer sequence between the T7 promoter and the operator, the spacer sequence being 4 bp.

[0011] Preferably, 50 mM sucrose and 250 mM mannitol are used as freeze-drying protectants and added to the cell-free biosensor for freeze-drying preservation.

[0012] Application of cell-free biosensors based on transcription factors in antibiotic detection.

[0013] Preferably, the TetR-based biosensor is used to detect tetracycline antibiotics; or the MphR-based biosensor is used to detect macrolide antibiotics.

[0014] Preferably, the tetracycline antibiotics are one or more of tetracycline, doxycycline, and tigecycline; the macrolide antibiotics are one or more of erythromycin, azithromycin, and roxithromycin.

[0015] Preferably, the limit of detection (LOD) for tetracycline is 0.5 μM; the LOD for doxycycline and tigecycline is 1 μM; the LOD for erythromycin is 0.5 μM; the LOD for azithromycin is 10 μM; and the LOD for roxithromycin is 5 μM.

[0016] Preferably, the test sample is added to a cell-free biosensor that does not contain T7 RNA polymerase, incubated at 37°C for 10-20 min, and then T7 RNA polymerase is added; the fluorescence intensity of the reaction system is observed, and the presence or absence of fluorescence indicates whether the test sample contains antibiotics.

[0017] Preferably, the antibiotic content is determined based on the fluorescence intensity;

[0018] Preferably, the fluorescence intensity is detected by an enzyme-linked immunosorbent assay (ELISA) reader. The ELISA reader is set to detect the fluorescence intensity of the system at 37°C, with an excitation wavelength of 472 nm and an emission wavelength of 507 nm.

[0019] Preferably, the sample to be tested is a natural water body with pH 7-9, ionic strength 0-25mM, and humic substance concentration 0-0.5mg L-1.

[0020] The advantages and positive effects of this invention are: it provides a cell-free biosensor with high sensitivity and stability, capable of specifically detecting tetracycline antibiotics or macrolide antibiotics; the biosensor can achieve efficient detection under different water conditions, demonstrating strong environmental adaptability.

[0021] Antibiotic content can be measured by changes in fluorescence intensity in a cell-free biosensor system, thereby enabling rapid and convenient detection of tetracycline and macrolide antibiotics in environmental water. Attached Figure Description

[0022] Figure 1 The principle of using cell-free biosensors regulated by transcription factors for antibiotic detection.

[0023] Figure 2 Maps of TetR and MphR protein expression plasmids.

[0024] Figure 3 SDS-PAGE images of purified TetR and MphR proteins.

[0025] Figure 4 Cell-free sensor detection of tetracycline / erythromycin. a. TetR and MphR inhibited the fluorescence response of the teto and mpho sensors, respectively; b. Tetracycline / erythromycin (10 μM) activated the transcription of the TetR / MphR cell-free system to produce 3 WJ dB. Error bars, SD, n = 3.

[0026] Figure 5 Cell-free system optimization and the interaction between DNA and TFs. a) Changes in fluorescence intensity (2h) and the relationship between promoter-operon spacer sequence; b) Different concentrations of Mg 2+ The effects of adding different concentrations of rNTPs to the reaction system on RNA fluorescence signal yield; c. The effects of different TetR / DNA ratios on RNA fluorescence signal yield; d. The effects of different MphR / DNA ratios on RNA fluorescence signal yield. The dashed line represents a fluorescence value of 300, which is the lowest fluorescence intensity visible to the naked eye under ultraviolet light. Error bars, SD, n=3.

[0027] Figure 6 Optimization and stability of lyophilized biosensors. a. Effect of mannitol as a lyophilization protectant on lyophilized biosensors; b. Effect of different sucrose to mannitol concentration ratios on the lyophilization system when the mannitol concentration is fixed at 250 mg / mL; c. Fluorescence intensity of the lyophilized biosensor and rehydration with different concentrations of tetracycline; d. Stable fluorescence response of the lyophilized sensor over 27 days; error bar, SD, n = 3.

[0028] Figure 7Sensitivity and quantitative analysis of tetracycline antibiotics based on the TetR biosensor; ac represents the fluorescence response of the biosensor to different concentrations of tetracycline, doxycycline, and tigecycline within 2 hours at 37°C; de represents the linear relationship between fluorescence intensity at 60 minutes and tetracycline antibiotic concentration. The dashed line represents a fluorescence value of 300, which is the lowest fluorescence intensity visible to the naked eye under ultraviolet light. Error bars, SD, n=3.

[0029] Figure 8 Fluorescence intensity under UV light after adding different concentrations of tetracycline to the sensor and reacting for 60 minutes.

[0030] Figure 9 Sensitivity and quantification of macrolide antibiotics based on the MphR biosensor; ac represents the fluorescence response of the biosensor to different concentrations of erythromycin, azithromycin, and roxithromycin within 2 hours at 37°C; de represents the linear relationship between fluorescence intensity at 60 minutes and macrolide antibiotic concentration. The dashed line represents a fluorescence value of 300, which is the lowest fluorescence intensity visible to the naked eye under ultraviolet light. Error bars, SD, n=3.

[0031] Figure 10 The biosensor detected the fluorescence intensity of different tetracycline or macrolide antibiotics at 60 min; a) tetracycline, b) doxycycline, c) tigecycline, d) erythromycin, e) azithromycin, and f) roxithromycin; the dashed line represents the fluorescence value of 300, which is the lowest fluorescence intensity visible to the naked eye under ultraviolet light; error bar, SD, n=3.

[0032] Figure 11 Biosensor specificity study; a) fluorescence response intensity of other antibiotics based on TetR biosensor; b) fluorescence response intensity of other antibiotics based on MphR biosensor; the fluorescence value at the dashed line is 300, which is the lowest fluorescence intensity visible to the naked eye under ultraviolet light; error bar, SD, n=3.

[0033] Figure 12 The effects of different pH values, ionic strengths, and humic water conditions on the performance of a biosensor in detecting tetracycline. a) Effect of pH on sensor fluorescence signal output; b) Effect of ionic strength on sensor performance; c) Effect of NAFA concentration on fluorescence signal; d) Effect of PPHA concentration on fluorescence signal. Error bars, SD, n=3. Detailed Implementation

[0034] The embodiments of the present invention will now be described with reference to the accompanying drawings.

[0035] This invention relates to a cell-free biosensor based on transcription factors and its application in the detection of antibiotics in aquatic environments. First, a cell-free biosensor containing TetR or MphR is constructed, capable of responding to tetracycline or macrolide antibiotics. Furthermore, the antibiotic content can be measured by changes in fluorescence intensity within the cell-free biosensor system, thereby enabling rapid and convenient detection of tetracyclines and macrolide antibiotics in environmental water.

[0036] Transcription factors are obtained through in vitro protein purification and mixed with other necessary components to form an in vitro transcription system, constructing a cell-free biosensor system for tetracycline or macrolide antibiotics. Cell-free biosensors based on transcription factors (TFs) have become one of the effective tools for in situ antibiotic detection due to their high sensitivity and multifunctionality. The cell-free biosensor includes a DNA template, transcription factors TetR or MphR, RNA polymerase, a fluorescent probe, and also rNTPs, a thermostable inorganic pyrophosphatase, and a transcription buffer. The DNA template includes a reporter gene capable of binding to the fluorescent probe, a binding site for the transcription factor, a promoter, and a terminator. An operon corresponding to the transcription factor is located upstream of the reporter gene. In some embodiments of this invention, a spacer sequence is also located upstream of the operon in the DNA template. The binding sites for the transcription factors TetR or MphR are teto or mpho, respectively. The promoter and terminator can be T7 promoter and T7 terminator, the reporter gene can be a 3-way junction dimeric Broccoli (3WJdB), and the fluorescent probe can be DFHBI-1T.

[0037] like Figure 1 As shown, aTF can recognize and bind to homologous operon sequences on the DNA template, preventing T7 RNA polymerase-driven transcription and thus inhibiting the generation of 3WJdB. The presence of the analyte causes a structural change in the transcription factor, leading to its dissociation from the DNA template and enabling successful transcription of 3WJdB by T7 RNA polymerase. 3WJdB binds to DFHBI-1T in the system, and fluorescence values ​​are read at an excitation wavelength of 472 nm and an emission wavelength of 507 nm, thus confirming the presence of the analyte.

[0038] Experiments have shown that the length of the spacer sequence and Mg... 2+ Both the concentration and the amount of TFs (transcription factors) added affect the sensitivity and detection accuracy of the cell-free biosensor. The preferred number of spacer sequences between the promoter and operator in the DNA template is 4 bp. When the DNA template is 25 nM, the preferred rNTP concentration is 11.4 mM, and the Mg... 2+At a concentration of 14 mM, the optimal concentrations for TetR and MphR are 0.625 μM and 0.75 μM, respectively. Additionally, the pH, ionic strength, and humic content of the sample also affect detection accuracy. Biosensors are most effective at moderate pH (pH 7-9), low to medium ionic strength (0-25 mM), and low humic concentration (0-0.5 mg / L). -1 It exhibits optimal detection performance in natural water bodies. In complex water conditions, pretreatment methods such as filtration are necessary to remove suspended solids and humic substances to ensure the accuracy of the test results.

[0039] This biosensor can be used for the detection of tetracyclines and macrolides. Based on the specific recognition function of transcription factors and combined with a T7 RNA polymerase-driven in vitro transcription system, the sensor can directly reflect the concentration of the target antibiotic in the water sample through the generation of fluorescence signals. The biosensor exhibits differences in sensitivity, response time, and selectivity for different generations of antibiotics. Experiments showed that the limit of detection (LOD) of this biosensor for tetracycline is 0.5 μM; the LOD for doxycycline and tigecycline is 1 μM; for macrolides, the LOD for erythromycin is 0.5 μM, and the LODs for azithromycin and roxithromycin are 10 μM and 5 μM, respectively. It also demonstrated high recovery rates in practical applications. Cell-free biosensors based on TetR showed high selectivity for tetracycline detection, and cell-free biosensors based on MphR also showed good selectivity for macrolides.

[0040] Due to the complex and variable nature of natural environmental conditions, the applicability of this sensor under different water conditions was further investigated to ensure the reliability of the detection. By optimizing the freeze-drying protectant (a mixture of sucrose and mannitol), long-term storage and stability of the sensor were achieved, with only a 15% loss of system activity after freeze-drying.

[0041] The present invention will now be described with reference to the accompanying drawings. Experimental methods not specifically described in terms of operation steps are performed in accordance with the corresponding product manuals. Unless otherwise specified, the instruments, reagents, and consumables used in the embodiments can be purchased from commercial companies.

[0042] Example 1: Construction of a lyophilized cell-free biosensor based on transcription factors

[0043] 1.1 Preparation of TetR and MphR proteins

[0044] The TetR and MphR protein expression sequences were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The protein expression plasmids were created by seamlessly cloning the sequences into the pET-28c plasmid backbone, setting up an overexpression recombinant protein plasmid with a His tag at the C-terminus. The sequence structure is as follows: Figure 2As shown in the figure. The assembled plasmid was transformed into DH5α competent cells for amplification, and single colonies were isolated by plating and the plasmid was purified. The constructed plasmid was sequence verified by Sangon Biotech (Shanghai) Co., Ltd.

[0045] The nucleic acid sequence expressing the TetR protein is shown in SEQ ID No. 1; the nucleic acid sequence expressing the MphR protein is shown in SEQ ID No. 2; and the primers used to synthesize the TetR / MphR plasmid are shown in SEQ ID No. 3-6.

[0046] SEQ ID No. 1:

[0047] taatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattttgtttaactttaagaaggagatataccatgtctagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagagaagcaacttaagtgtgaaagtgggtctaagcttgcggccgcactcgagcaccaccaccaccaccactgagatccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttg

[0048] SEQ ID No.2:

[0049] taatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattttgtttaactttaagaaggagatataccatgccgcgtccgaaattaaaatcggatgacgaagttcttgaggcagcgactgtagtattgaaacgctgtggtcccattgagtttacgctttctggggtcgcgaaagaagttggtcttagccgcgcagcgttgatccaacgttttaccaaccgcgacacgctgttggtgcgtatgatggaacgtggcgtggagcaggtgcgtcactacttaaatgcgatccccattggggcgggccctcagggtttatgggagtttcttcaagttttagtgcgtagcatgaatacgcgtaatgacttctctgtaaactacttgatttcgtggtacgagcttcaagtccccgaattgcgcacactggcgattcaacgcaaccgcgcagtagtagaaggtatccgcaagcgtttgcctcctggggcccctgcggcggctgagttgctgctgcatagcgtgattgcgggtgccacgatgcagtgggcggtggacccggacggtgaattagccgatcatgtattagcccagatcgctgcgatcttgtgtttaatgttccccgaacatgatgactttcagttgcttcaaccccatgcgaagcttgcggccgcactcgagcaccaccaccaccaccactgagatccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttg

[0050] SEQ ID No.3 Forward TetR agaaggagatataccatgtctagattagataaaagtaa

[0051] SEQ ID No.4 Reverse TetR cgagtgcggccgcaagcttagacccactttcacacttaa

[0052] SEQ ID No.5 Forward MphR agaaggagatataccatgccgcgtccgaaattaaaatc

[0053] SEQ ID No.6 Reverse MphR cgagtgcggccgcaagcttcgcatggggttgaag

[0054] The validated recombinant protein expression plasmid was transformed into *E. coli* Rosetta 2(DE3)pLysS for protein overexpression. *E. coli* was plated on kanamycin- and chloramphenicol-resistant plates and cultured overnight. Single colonies were then picked and cultured at 37°C for expansion. The expanded culture was mixed with culture medium at a 1:50 ratio in Erlenmeyer flasks and cultured at 37°C and 180 rpm until the exponential growth phase (OD 0.6–0.8). 0.5 mM IPTG was added to the culture, and protein overexpression was induced at 37°C, 180 rpm, for 4 hours. Using an Eppendorf centrifuge, the cells were centrifuged at 9000 rpm for 5 minutes at 4°C. The supernatant was removed, and the bacterial culture was washed twice with PBS. The collected bacteria were stored at -20°C or reselected using cell lysis buffer (20 mM Tris, pH 7.4, 500 mM NCl, 1 mM PMSF, 1% Tris-x100, 2.5 mM β-Me) and subjected to sonication on ice (170 W, 1 s on, 2 s off, 20 min total). The lysed sample was centrifuged at 12000 g for 20 min at 4°C to remove insoluble substances. The lysis supernatant was purified by His-tagged affinity chromatography using a Ni-NTA column. During purification, the cells were washed with 50 mM imidazole and eluted with 200 mM imidazole to obtain highly pure protein. The obtained proteins were concentrated and exchanged using ultrafiltration tubes (Amicon Ultra-0.5, MilliporeSigma) with buffer (25 mM Tris-HCl, 100 mM NaCl, 1 mM TCEP, 50% glycerol, v / v), and then the protein concentration was quantified. SDS-PAGE images of TetR and MphR proteins are shown below. Figure 3 As shown.

[0055] 1.2 Design and preparation of DNA templates

[0056] The DNA template was purchased from the Addgene website. The DNA template was amplified using a high-fidelity PCR amplification kit and verified by 1% agarose gel electrophoresis. The PCR product was purified using PCR purification reagent (QIAquick PCR purification kit, Qiagen, catalog no. 28106), and the DNA template concentration was then quantified using a NanoPhotometer N60 Touch and stored at -20°C.

[0057] The DNA template sequence for detecting tetracycline antibiotics is shown in SEQ ID No. 7; the DNA template sequence for detecting macrolide antibiotics is shown in SEQ ID No. 8; and the primers for preparing the DNA template are shown in SEQ ID No. 9-10.

[0058] SEQ ID No.7 T7 promoter-teto-3WJdB-T7 terminator

[0059] gcggataacaatttcacacaggaaacagctatgaccatgattacgccaagcttgcatgcctgcaggtcgactctagataatacgactcactataggaggtccctatcagtgatagagacccacatactctgatgatccgagacggtcgggtccagata ttcgtatctgtcgagtagagtgtgggctcggatcattcatggcaagagacggtcgggtccagatattcgtatctgtcgagtagagtgtgggctcttgccatgtgtatgtgggtagcataaccccttggggcctctaaacgggtcttgaggggttttttg

[0060] SEQ ID No.8 T7 promoter-mho-3WJdB-T7 terminator

[0061] gcggataacaatttcacacaggaaacagctatgaccatgattacgccaagcttgcatgcctgcaggtcgactctagataatacgactcactataggagggaatataaccgacgtgactgttacatttaggtggcccacatactctgatgatccgagacggtcgggt ccagatattcgtatctgtcgagtagagtgtgggctcggatcattcatggcaagagacggtcgggtccagatattcgtatctgtcgagtagagtgtgggctcttgccatgtgtatgtgggtagcataaccccttggggcctctaaacgggtcttgaggggttttttg

[0062] SEQ ID No.9 Forward T7 promoter-tetO / mho-3WJdB-T7 terminator

[0063] gcggataacaatttcacacaggaaacagc

[0064] SEQ ID No.10 Reverse T7 promoter-tetO / mpho-3WJdB-T7 terminator

[0065] caaaaaacccctcaagacccg

[0066] 1.3 Preparation of Cell-Free Sensor System

[0067] The cell-free biosensor system consisted of the following components added sequentially: transcription buffer (200 mM Tris-HCl, 30 mM MgCl, 50 mM DTT, 50 mM NaCl, 10 mM spermidine), 8 mM MgCl, 11.4 mM rNTPs, and 0.015 U μL. -1 Thermostable inorganic pyrophosphatase, DNA template, fluorescent probe DFHBI-1T, purified transcription factors TetR / MphR, and ddH2O were mixed in a total volume of 10 μL and incubated at 37°C for 15 min. Then, T7 RNA polymerase was added to the mixture.

[0068] Table 1 shows the composition of the cell-free biosensor system.

[0069] Table 1

[0070]

[0071]

[0072] Transfer the prepared cell-free reaction system to a black transparent 384 container for later use.

[0073] When used for detection, add 1 μL of the test solution to a 10 μL cell-free reaction system, mix thoroughly, and incubate at 37°C for 2 h.

[0074] During the detection, the ELISA reader was set to 37℃, with an excitation wavelength of 472nm and an emission wavelength of 507nm to dynamically detect the fluorescence intensity of the system.

[0075] 1.4 Freeze-drying

[0076] Add the lyophilization protectant (50mM sucrose and 250mM mannitol) to the system, seal the PCR tubes with sealing film, and poke multiple holes with a needle to ensure ventilation. Wrap the PCR tubes with aluminum foil. Immediately place the prepared system in a -80℃ freezer for 20 minutes to ensure complete freezing. Then immerse the system in liquid nitrogen and transfer it to a freeze dryer for 4 hours. After lyophilization, place the PCR tubes in a light-proof bag containing desiccant and store them in a -20℃ freezer.

[0077] 1.5 Cell-free sensor response to tetracycline / erythromycin

[0078] 10 μM tetracycline or erythromycin solutions were prepared and added to the cell-free sensor system. Tetracycline or erythromycin induced TetR / MphR regulation in the cell-free response system. The target ligand bound to the transcription factor, causing it to dissociate from the operon sequence, activating transcription to produce 3 WJ dB, thereby generating a fluorescent signal. The results are as follows: Figure 4 As shown in figure a, the fluorescence signal of the sensor containing TetR / MphR was effectively suppressed compared to the sensor without TetR / MphR. Upon addition of tetracycline or macrolides, the system rapidly generated a detectable fluorescence signal, such as... Figure 4 As shown in b, the fluorescent signal 3WJdB accumulates rapidly, and a visible fluorescent signal is generated after 30 minutes. This indicates that tetracycline / erythromycin successfully induced the separation of TetR / MphR from the DNA template and activated the transcription of 3WJdB. TetR / MphR, as a regulatory element, can be used to construct cell-free biosensors for detecting tetracycline / macrolides.

[0079] Example 2: Optimization of Cell-Free Sensor System

[0080] The cell-free sensor system was prepared according to step 1.3 of Example 1. The specific components are shown in Table 1, excluding aTF.

[0081] After thorough mixing, incubate at 37°C for 2 hours. Place the 384-well plate in a microplate reader and read the fluorescence values ​​at an excitation wavelength of 472 nm and an emission wavelength of 507 nm.

[0082] 2.1 Optimization of DNA template sequence

[0083] To optimize the transcription process, spacer sequences of different lengths were designed into the DNA template sequence. These spacer sequences, ranging from 0 to 12 base pairs, were designed in seven different lengths, as shown in SEQ ID No. 11-17, and were placed downstream of the T7 promoter.

[0084] SEQ ID No.11 T7 promoter-0bp-tetO-3WJdB-T7 terminator

[0085] gcggataacaatttcacacaggaaacagctatgaccatgattacgccaagcttgcatgcctgcaggtcgactctagataatacgactcactatatccctatcagtgatagagacccacatactctgatgatccgagacggtcgggtccagatattc gtatctgtcgagtagagtgtgggctcggatcattcatggcaagagacggtcgggtccagatattcgtatctgtcgagtagagtgtgggctcttgccatgtgtatgtgggtagcataaccccttggggcctctaaacgggtcttgaggggttttttg

[0086] SEQ ID No.12-17 T7 promoter-2bp / 4bp / 6bp / 8bp / 10bp / 12bp-tetO-3WJdB-T7terminator

[0087] gcggataacaatttcacacaggaaacagctatgaccatgattacgccaagcttgcatgcctgcaggtcgactctagataatacgactcactata spacer tccctatcagtgatagagacccacatactctgatgatccgagacggtcgggtccagatat tcgtatctgtcgagtagagtgtgggctcggatcattcatggcaagagacggtcgggtccagatattcgtatctgtcgagtagagtgtgggctcttgccatgtgtatgtgggtagcataaccccttggggcctctaaacgggtcttgaggggttttttg

[0088] The interval sequence is gg / ggga / gggaga / gggagacc / gggagaccac / gggagaccacaa

[0089] Experiments have shown that shorter spacer sequences have a negative impact on T7 transcription, such as... Figure 5 As shown in Figure a, excessively short spacer sequences do not lead to fluorescence activation regardless of the presence of TetR. When the spacer sequence length is 4–6 bp, strong fluorescence is observed in the absence of TetR, and fluorescence is effectively suppressed upon the addition of TetR. However, when the spacer sequence length exceeds 8 bp, transcription is no longer regulated by TetR, and fluorescence activation occurs even in the presence of TetR. These results indicate that shorter spacer sequences disrupt the base sequence before the transcription start site, negatively impacting the T7 expression system, while spacer sequences longer than 6 bp weaken the regulatory effect of TetR on DNA transcription. A 4 bp spacer was chosen as the optimal spacer.

[0090] 2.2 Mg 2+ Optimization of relative concentration with rNTPs

[0091] T7 RNA polymerase is a Mg 2+ Mg-dependent polymerase, which requires Mg 2+ Mg needs to act as a cofactor to truly perform transcriptional function. 2+ The relative concentration of rNTPs has a significant impact on the RNA synthesis activity of T7 RNA polymerase.

[0092] A cell-free sensor system was prepared according to step 1.3 of Example 1, excluding aTF; the DNA template was fixed at 25 nM, and the Mg content was adjusted at total rNTP concentrations of 7.6, 11.4, and 15.2 mM. 2+ Concentration. Results as follows Figure 5 As shown in b, with Mg 2+ With the increase of Mg, the total fluorescence first rises and then falls, indicating that each rNTP corresponds to an optimal Mg. 2+ Concentration. Mg 2+ It synergistically affects IVT transcriptional activity with rNTPs. Contains 18 mM Mg 2+ The 15.2 mM rNTPs exhibited the highest fluorescence yield, but this was not as high as those containing 14 mM Mg. 2+ The fluorescence yield of 11.4 mM rNTPs was almost identical. Compared to 15.2 mM rNTPs, 11.4 mM rNTPs can minimize the price per sensor. The determination of rNTPs and Mg... 2+ The optimal concentrations are 11.4 mM and 14 mM, respectively, which achieve high transcription efficiency while saving costs.

[0093] 2.3 Optimization of the concentration ratio of transcription factors to DNA template

[0094] The concentration ratio of transcription factors to DNA template is also a key factor affecting sensor performance. When fixing the DNA template concentration, if the concentration of transcription factors is too high, the free transcription factors will hinder the expression of reporter genes, reducing the sensitivity of the sensor. If the concentration is too low, transcription may not be completely inhibited, resulting in signal leakage.

[0095] A cell-free sensor system was prepared according to step 1.3 of Example 1, with the DNA template concentration fixed at 25 nM. The final fluorescence values ​​were compared under different aTF / DNA ratios. The results are as follows: Figure 5 c and Figure 5 As shown in Figure d, with increasing TetR and MphR concentrations, the inhibitory effect on the DNA template increased, while the fluorescence intensity generated by transcription gradually decreased. When the TetR / DNA and MphR / DNA ratios reached 25:1 and 30:1, respectively, transcription was completely inhibited, and the fluorescence signal disappeared. Further increasing the ratios did not change the fluorescence intensity. Finally, it was determined that when the DNA template concentration was fixed at 25 nM, the optimal concentrations of TetR and MphR were 0.625 μM and 0.75 μM, respectively.

[0096] 2.4 Optimization of freeze-drying preservation conditions

[0097] The effects of different concentrations of sucrose and mannitol on the transcription system were investigated. Cell-free sensor systems (as shown in Table 1) were constructed and 0.625 μM etR transcription factor was added, along with different concentrations of sucrose and mannitol. To verify the effectiveness of the cell-free sensor, 10 μM tetracycline was added. The results are shown below. Figure 6As shown in a and b, without the addition of mannitol, the activity of the system was severely impaired after lyophilization. However, with the increase of mannitol concentration, the protective effect on the protein was significantly improved, showing the best effect at 250 mM. However, compared with the un-lyophilized system, the fluorescence value of the system after lyophilization was reduced by 44%. With the mannitol concentration fixed at 250 mM, the sucrose concentration was adjusted to vary the molar ratio of sucrose to mannitol between (1:5 and 1:1). The data showed that a sucrose to mannitol concentration ratio of 1:5 exhibited the best lyophilization effect, with only a 15% loss in fluorescence value after lyophilization, a reduction of 29% compared to using mannitol alone. Therefore, 50 mM sucrose and 250 mM mannitol were used as lyophilization protectants for lyophilization.

[0098] The detection performance of the lyophilized biosensor for the analyte was tested. Using a TetR-based biosensor as the research subject, the lyophilized biosensor was rehydrated with water samples containing different concentrations of tetracycline and incubated at 37°C for 2 hours. The results are as follows: Figure 6 As shown in c, the linear range of fluorescence intensity with antibiotic concentration is 0.5–15 μM (red line); the data in blue are not included in this range. The lyophilized system still has good tetracycline detection capability and can rapidly detect tetracycline concentrations greater than 0.5 μM. Furthermore, as... Figure 6 As shown in d, the freeze-dried biosensor can be stored at -20℃ for a long time and maintains a stable fluorescence reaction for 21 days, indicating that the freeze-dried biosensor has good stability.

[0099] Example 3: Quantitative detection of tetracycline and macrolide antibiotics using a biosensor

[0100] Biosensor systems based on TetR and MphR were constructed according to the compositions in Table 1. These systems were used to assess the sensitivity of the biosensors in detecting tetracyclines and macrolide antibiotics.

[0101] Three tetracycline antibiotics at concentration gradients of (0, 0.1, 0.5, 1, 3, 5, 10, and 15 μM) were added to a TetR-based biosensor system. Erythromycin at concentration gradients of (0, 0.1, 0.5, 1, 3, 5, 10, and 15 μM), azithromycin at concentration gradients of (0, 0.5, 1, 5, 10, 30, 50, and 70 μM), and roxithromycin at concentration gradients of (0, 0.5, 1, 3, 5, 10, 15, and 20 μM) were added to an MphR-based biosensor system. Fluorescence intensity was recorded every 3 minutes, and changes in fluorescence intensity over two hours were recorded.

[0102] After thorough mixing, incubate at 37°C for 2 hours. Place the 384-well plate in a microplate reader and read the fluorescence values ​​at an excitation wavelength of 472 nm and an emission wavelength of 507 nm.

[0103] Sensitivity and quantitative analysis results of tetracycline antibiotics based on the TetR biosensor are as follows: Figure 7 As shown, the fluorescence intensity increases with increasing tetracycline concentration, with concentrations above 0.5 μM exhibiting noticeable visible fluorescence. After 60 minutes of detection, the differences in fluorescence intensity caused by different tetracycline concentrations were clearly distinguishable. For the detection of tetracycline (… Figure 7 (a) and (d) This sensor can rapidly detect tetracycline concentrations greater than 0.5 μM, with a detection limit (LOD) of 0.5 μM. Furthermore, under UV light, it is clearly observable that the fluorescence intensity continuously increases with increasing tetracycline concentration. Figure 8 For doxycycline ( Figure 7 b, e) and tigecycline (b, e) Figure 7 The detection methods for c) and f) are similar to those for tetracycline, with a LOD of 1 μM. Regression linearity analysis showed a good linear relationship between the fluorescence value at 60 min and the logarithm of the antibiotic concentration: the concentration range for tetracycline and doxycycline was 0.1 μM to 10 μM, and for tigecycline, it was 0.5 μM to 10 μM. 2 The values ​​are 0.9906, 0.9052, and 0.9941, respectively.

[0104] The sensitivity and quantitative analysis results of the MphR-based biosensor system for macrolide antibiotics are as follows: Figure 9 As shown. Because MphR binds differently to erythromycin, azithromycin, and roxithromycin, the detection limits of the sensor for different antibiotics also differ. Erythromycin ( Figure 9 The detection limits for a and d) can reach 0.5 μM, while azithromycin ( Figure 9 b, e) The detection limit is 10 μM, roxithromycin ( Figure 9 The detection limits for c) and f) were 5 μM. A good linear relationship was observed between fluorescence intensity and antibiotic concentration: erythromycin from 0.1 μM to 15 μM, azithromycin from 5 μM to 70 μM, and roxithromycin from 3 μM to 20 μM. 2 The values ​​are 0.9944, 0.9017, and 0.9882, respectively.

[0105] like Figure 10 As shown, the constructed cell-free biosensor for detecting tetracycline and macrolide antibiotics exhibits a good linear relationship between fluorescence intensity and antibiotic concentration within a specific range, and can be used for the quantitative detection of antibiotics.

[0106] Example 4: Selectivity Study of Biosensors

[0107] Ampicillin, streptomycin, lincomycin, erythromycin, and vancomycin were selected as the selective interfering antibiotics for the tetracycline biosensor. Solutions of each interfering antibiotic were prepared.

[0108] The cell-free sensor system was prepared according to step 1.3 of Example 1, and the specific components are shown in Table 1. aTF was 0.625 μM TetR or 0.75 μM MphR.

[0109] The interfering antibiotic solution was mixed with the cell-free sensor system to achieve a concentration of 10 μM for each interfering antibiotic. After thorough mixing, the mixture was incubated at 37°C for 2 hours. The fluorescence values ​​were then read using a microplate reader at an excitation wavelength of 472 nm and an emission wavelength of 507 nm.

[0110] The results are as follows Figure 11 As shown in Figure a, the sample with added tetracycline induced a strong fluorescence signal, while the sample with added interfering antibiotics showed a fluorescence value below 300 (no fluorescence signal was observed), indicating that the interfering antibiotics failed to induce a sensor response. This demonstrates that the TetR-based cell-free biosensor exhibits high selectivity in tetracycline antibiotic detection, avoiding interference from other antibiotics. Similarly, as... Figure 10 As shown in b, the cell-free biosensor based on MphR also exhibits good selectivity for macrolide antibiotics. This is mainly due to the excellent selectivity of TetR and MphR proteins for tetracyclines and macrolide antibiotics. Therefore, biosensors based on these two proteins demonstrate good selectivity in detecting target antibiotics and are expected to be widely used in the field of environmental monitoring.

[0111] Example 5: Study on the Applicability Scope of Biosensors

[0112] pH, ionic strength, and humic substances are the three most typical aquatic environmental factors in natural water bodies. It has been reported that pH and ionic strength not only significantly affect the activity and stability of RNA polymerase, but also influence the structure and stability of RNA molecules. Common metal ions in natural water bodies include sodium (Na₂O₃). + K + Mg 2+ It also affects the stability of the transcription system, Mg 2+ These are essential factors in efficient transcription. However, the pH, ionic strength, and humic substance concentration in natural water bodies vary considerably due to factors such as environment, geographical location, and water type. Therefore, studying the applicability of biosensors under different water conditions is crucial to ensuring their detection reliability.

[0113] 5.1 Effect of pH value on the output of the sensor fluorescence signal

[0114] The pH value of natural water bodies is typically between 6.5 and 8.5. The sensor's detection capability was verified using water samples with different pH values; the experimental results are as follows. Figure 11 As shown in Figure a, the sensor performs best at pH values ​​of 7–9, maintaining a stable fluorescence signal output, indicating that no cellular response can effectively occur within this range. Figure 12 a) Conversely, at pH 5 and 6, the fluorescence intensity decreased significantly, indicating a reduction in detection performance.

[0115] 5.2 Effect of Ion Strength on Sensor Performance

[0116] By adding Ca 2+ Mg 2+ Na + K + Metal ions were used to simulate the multi-ion environment in natural water bodies to avoid bias caused by a single ion. The ion intensity of natural water bodies is generally between 0.01 and 0.1 mM, so an ion intensity range of 5 to 100 mM was set to explore its effect on fluorescence signal.

[0117] Experimental results are as follows Figure 12 As shown in b, the biosensor exhibits optimal detection performance at low to medium ionic intensities (0 to 25 mM), but its performance is significantly suppressed outside this range. High ionic intensities inhibit the sensor's response, leading to reduced detection sensitivity.

[0118] 5.3 Effects of different concentrations of humic acid and fulvic acid on in vitro transcription

[0119] Humic substances, as widely distributed natural organic matter in water bodies, can inhibit polymerase activity or inhibit the binding of polymerase to DNA, thus preventing amplification. The effects of different concentrations of humic acid and fulvic acid on in vitro transcription were investigated. Figure 12 c. Figure 12 As shown in d, the fluorescence intensity decreases with increasing humic concentration. Within the range of 0–0.5 mg / L... -1 At humus concentrations of 1 mg / L, the biosensor exhibits optimal performance, while above 1 mg / L... -1 The concentration gradually inhibited the detection, with the most significant inhibition at a concentration of 30 mg L⁻¹.

[0120] Natural water biosensors operate at optimal pH levels (7–9), low to moderate ionic strength (0–25 mM), and low concentrations of humic substances (0–0.5 mg L⁻¹). In complex water conditions, pretreatment methods such as filtration should be employed to remove suspended solids and humic substances to ensure accurate test results.

[0121] Example 6: Detection of on-site water samples using biosensors

[0122] Laboratory water, municipal water, surface water (from the Haihe River in Tianjin, China), groundwater, and wastewater from a large pharmaceutical factory in Guangzhou were selected as actual water samples. The practicality of the cell-free biosensor was verified by analyzing these five different water samples. Since tetracycline concentrations in actual water bodies are low, tetracycline was added to the actual water samples, and its recovery was used to verify the biosensor's effectiveness. A simple and easy-to-operate pretreatment method was used to ensure the sensor's practicality; a 0.22 μm filter membrane was used for water sample pretreatment to reduce factors that might affect the detection.

[0123] The experimental results are shown in Table 1. The cell-free biosensor based on transcription factors can be used for the on-site detection of tetracyclines and macrolides in actual water samples, with recoveries ranging from 83.67% to 93.50%. Furthermore, stability was tested using six different batches of the biosensor. The relative standard deviation (RSD) was no greater than 9.31%, demonstrating good consistency and stability. The results indicate that this biosensor can detect tetracyclines and macrolides in different water bodies and possesses advantages such as simple pretreatment, convenient and easy-to-operate equipment, and short detection reaction time, showing significant advantages in on-site detection. Table 2 shows the detection of tetracycline / erythromycin in actual water samples based on the TetR / MphR biosensor.

[0124] Table 2

[0125]

[0126] The embodiments of the present invention have been described in detail above, but the content described is only a preferred embodiment of the present invention and should not be considered as limiting the scope of the present invention. All equivalent changes and improvements made within the scope of the present invention should still fall within the patent coverage of the present invention.

Claims

1. A cell-free biosensor based on transcription factors, characterized in that: It includes a DNA template, transcription factor TetR or MphR, RNA polymerase and fluorescent probe, wherein the DNA template includes a reporter gene that can bind to the fluorescent probe, and an operon corresponding to the transcription factor TetR or MphR is located upstream of the reporter gene.

2. The cell-free biosensor based on transcription factors according to claim 1, characterized in that: It also includes rNTPs, thermostable inorganic pyrophosphatase, and transcription buffer, the transcription buffer containing Mg 2+ .

3. The cell-free biosensor based on transcription factors according to claim 2, characterized in that: When the DNA template is 25 nM, the concentration of rNTPs is 11.4 mM, and the Mg... 2+ The concentration was 14 mM; Preferably, the TetR / DNA concentration ratio is 25:1, and the MphR / DNA concentration ratio is 30:

1.

4. The cell-free biosensor based on transcription factors according to claim 1, characterized in that: The DNA template also includes a T7 promoter and a T7 terminator, the reporter gene is 3WJdB, and the fluorescent probe is DFHBI-1T.

5. The cell-free biosensor based on transcription factors according to claim 4, characterized in that: The DNA template also includes a 4bp spacer sequence between the T7 promoter and the operator.

6. The cell-free biosensor based on transcription factors according to any one of claims 1-5, characterized in that: 50 mM sucrose and 250 mM mannitol were used as freeze-drying protectants and added to the cell-free biosensor for freeze-drying preservation.

7. The application of the cell-free biosensor based on transcription factors according to any one of claims 1-6 in antibiotic detection.

8. The application according to claim 7, characterized in that: TetR-based biosensors are used to detect tetracycline antibiotics; or MphR-based biosensors are used to detect macrolide antibiotics; preferably, the tetracycline antibiotics are one or more of tetracycline, doxycycline, and tigecycline; and the macrolide antibiotics are one or more of erythromycin, azithromycin, and roxithromycin. Preferably, the limit of detection (LOD) for tetracycline is 0.5 μM; the LOD for doxycycline and tigecycline is 1 μM; the LOD for erythromycin is 0.5 μM; the LOD for azithromycin is 10 μM; and the LOD for roxithromycin is 5 μM.

9. The application according to claim 7, characterized in that: The test sample is added to a cell-free biosensor without T7 RNA polymerase and incubated at 37°C for 10-20 min. Then, T7 RNA polymerase is added. The fluorescence intensity of the reaction system is observed, and the presence or absence of fluorescence indicates whether the test sample contains antibiotics. Preferably, the antibiotic content is determined based on the fluorescence intensity. Preferably, the fluorescence intensity is detected by an enzyme-linked immunosorbent assay (ELISA) reader. The ELISA reader is set to detect the fluorescence intensity of the system at 37°C, with an excitation wavelength of 472 nm and an emission wavelength of 507 nm.

10. The application according to claim 9, characterized in that: The samples to be tested were natural water bodies with pH 7-9, ionic strength 0-25mM, and humic substance concentration 0-0.5mg L-1.

Images