Genetic engineering saliva combined lactobacillus and application thereof

By using genetically engineered saliva combined with Lactobacillus CTMT2 to overexpress acetaldehyde dehydrogenase, the problem of insufficient gut-liver axis regulation was solved, achieving efficient acetaldehyde decomposition and significant relief of liver lesions, and improving the progression of alcoholic fatty liver disease and MASH.

CN121320140APending Publication Date: 2026-01-13SHANGHAI SIXTH PEOPLES HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511365694.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-23
Publication Date
2026-01-13

AI Technical Summary

Technical Problem

Existing technologies for the treatment of alcoholic fatty liver disease and metabolic dysfunction-associated steatohepatitis (MASH) have failed to fully utilize the bidirectional regulatory mechanism between gut microbiota and the liver, lack effective ecological regulation methods to restore gut-liver axis function, and drug treatment suffers from insufficient long-term safety evidence, limited response rates, and high costs.

Method used

This invention provides a genetically engineered *Ligilactobacillus salivarius* CTMT2 strain that, through overexpression of acetaldehyde dehydrogenase, significantly increases the enzyme activity of acetaldehyde dehydrogenase, rapidly decomposes acetaldehyde, reduces the concentration of acetaldehyde in the liver and feces, alleviates alcoholic fatty liver disease, and improves the progression of MASH.

Benefits of technology

It significantly reduces acetaldehyde levels in the liver and feces, alleviates symptoms of alcoholic fatty liver, improves liver fibrosis, and downregulates the expression of related inflammatory factors and lipid metabolism genes, demonstrating superior therapeutic effects compared to existing probiotics.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121320140A_ABST
    Figure CN121320140A_ABST
Patent Text Reader

Abstract

The invention relates to genetic engineering combined lactobacillus salivarius and application of the genetic engineering combined lactobacillus salivarius. The strain is classified and named as combined lactobacillus salivarius CTMT2, and the preservation number of the strain is CCTCC (China Center for Type Culture Collection) M 2025547. After an NIAAA model is injected into the stomach of an alcoholic liver mouse, the acetaldehyde level of the liver of the mouse is obviously reduced, and the alcoholic fatty liver symptom of the mouse is obviously relieved; after long-term intragastric administration of a high-glucose and high-fat modeling mouse, the acetaldehyde level in excrement of the mouse can be obviously reduced, the progress of liver fibrosis is improved, and good application prospects are achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of treatment technology for alcoholic and metabolic-related fatty liver disease, and specifically relates to a genetically engineered saliva-associated lactobacillus and its application. Background Technology

[0002] Metabolic diseases are a group of illnesses caused by disturbances in the body's biochemical metabolism. They mainly include lipid metabolism disorders (such as alcoholic fatty liver disease, metabolic dysfunction-related fatty liver disease, and hyperlipidemia) and glucose metabolism disorders (such as type 1 and type 2 diabetes, and gestational diabetes). These diseases are often associated with genetic defects, endocrine imbalances, or unhealthy lifestyles, and can lead to multi-system damage and significantly increase the risk of complications such as cardiovascular disease, cirrhosis, and cancer.

[0003] Alcoholic fatty liver disease is characterized by lipid accumulation and gradually progresses to hepatitis, cirrhosis, and even liver cancer, severely shortening patients' life expectancy. Its core pathogenesis involves the NADH / NAD ratio increase in hepatocytes due to ethanol metabolism. + An increased proportion of these substances inhibits fatty acid β-oxidation and promotes synthesis, thereby causing lipid deposition. Simultaneously, alcohol and its metabolites (such as acetaldehyde) jointly drive disease progression by inducing oxidative stress, activating inflammatory pathways, and disrupting the gut microbiota.

[0004] The prevention and treatment of alcoholic fatty liver disease, including absolute abstinence from alcohol, nutritional support, and drug therapy, suffers from limited effectiveness and a lack of options. In recent years, probiotic therapy has gained increasing attention in the prevention and treatment of alcoholic liver disease due to its multi-dimensional and comprehensive protective effects through regulation of the gut-liver axis. Currently developed probiotics include: *Dubosiella newyorkensis*, which improves lipid metabolism and hepatocyte oxidative damage in alcoholic liver disease and protects intestinal structure; *Lactobacillus rhamnosus* WKA55 (CCTCC NO: M2022191), which has strong free radical scavenging and intestinal epithelial cell adhesion capabilities; *Lactobacillus paracasei* JN-8 (CGMCC No. 22746), which produces antioxidants to combat oxidative stress caused by alcoholic liver damage; and *Lactobacillus helveticus*. Helveticus L551 (CGMCC NO. 15604) can inhibit the elevation of serum alanine aminotransferase (ALT), aspartate aminotransferase (AST), and malondialdehyde, restore hepatic glutathione levels and superoxide dismutase activity, and inhibit serum endotoxins and hepatic inflammatory factors. These probiotics play a positive role in the prevention and treatment of alcoholic liver disease. However, food-grade probiotics that directly target acetaldehyde, a metabolite of ethanol in the body, are currently rare, and efficacy verification in NIAAA (National Institute on Alcohol Abuse and Alcoholism) mouse models of alcoholic liver disease is almost non-existent.

[0005] Metabolic dysfunction-associated steatohepatitis (MASH) is a progressive form of metabolic dysfunction-associated fatty liver disease (MASLD), characterized primarily by marked hepatocellular steatosis, lobular inflammation, and liver fibrosis. Among lifestyle factors, dietary nutrition, particularly carbohydrate intake, has been reported to be associated with the initiation of MASLD, but the molecular mechanisms remain unclear. Alterations in gut microbiota balance and changes in microbial metabolites are also key factors in the progression of MASLD. The complexity of the disease etiology presents significant challenges to clinical diagnosis and treatment.

[0006] The first drug for treating MASH was resmetirom, approved by the U.S. Food and Drug Administration. This drug is a thyroid hormone receptor beta-selective agonist that effectively reduces the degree of hepatic steatosis and fibrosis. In addition, several investigational drugs have shown potential efficacy: the glucagon-like peptide-1 receptor agonist semaglutide achieved a 62.9% MASH symptom remission rate in a phase III clinical trial, and the PPAR pan-agonist sitagliptin (Symbolic) reduced liver fat content by 39.5% in a phase II study. Combination therapy strategies have also made some progress; for example, the combination of the DGAT2 / ACC dual inhibitor Ervogastat and Clesacostat achieved a 66% MASH remission rate in a phase II trial, but this regimen may cause elevated blood lipid levels. Currently, drug treatment for MASH still faces several challenges, including a lack of long-term safety evidence, limited response rates of some drugs, and high treatment costs. Summary of the Invention

[0007] The technical problem this invention aims to solve is to provide a genetically engineered saliva-based lactobacillus and its application, focusing on addressing a key technical deficiency in current treatment strategies for alcoholic fatty liver disease and MASH: the failure to fully utilize the bidirectional regulatory mechanism between gut microbiota and the liver. Existing clinical approaches mostly focus on directly intervening in liver metabolism and inflammatory pathways, while insufficient attention is paid to the crucial driving role of gut microbiota dysbiosis in the progression of alcoholic fatty liver disease and MASH, and there is a lack of effective ways to restore gut-liver axis function through ecological regulation.

[0008] This invention provides a genetically engineered Lactobacillus salivarius strain, classified as Ligilactobacillus salivarius CTMT2, with accession number CCTCC M 2025547, and deposited on March 20, 2025 at the China Center for Type Culture Collection, Wuhan University, No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0009] The present invention also provides the application of genetically engineered saliva combined with Lactobacillus in the preparation of drugs to improve alcoholic and metabolic-related fatty liver disease.

[0010] Furthermore, the drug increases the activity level of acetaldehyde dehydrogenase.

[0011] Furthermore, the drug degrades acetaldehyde.

[0012] Furthermore, the drug alleviates alcoholic fatty liver disease.

[0013] Furthermore, the drug improves the progression of MASLD to MASH.

[0014] Furthermore, the drug also contains pharmaceutically acceptable carriers and / or excipients.

[0015] Furthermore, the pharmaceutically acceptable carrier and / or excipient includes at least one of diluents, binders, surfactants, humectants, adsorbents, lubricants, fillers, and disintegrants.

[0016] Beneficial effects

[0017] This invention provides a genetically engineered *Ligilactobacillus salivarius* CTMT2 strain overexpressing acetaldehyde dehydrogenase, which can rapidly decompose acetaldehyde in vitro at a rate 34.9 times faster than the standard salivary lactobacillus *Ligilactobacillus salivarius* ATCC 11741. In NIAAA-induced alcoholic liver disease mice, it significantly reduced liver acetaldehyde levels and significantly alleviated symptoms of alcoholic fatty liver disease. In mice with a long-term high-glucose, high-fat diet, it significantly reduced fecal acetaldehyde levels and significantly improved the occurrence of liver fibrosis. Attached Figure Description

[0018] Figure 1 The DNA sequence of the AdhE-pMG36e recombinant plasmid is shown.

[0019] Figure 2 This is a photograph of a culture plate of Lactobacillus CTMT2 in salivary fluid, as described in this invention.

[0020] Figure 3 The image shows a bar chart of in vitro enzyme activity of *Lactobacillus salivae*. * indicates p < 0.05 compared to *Lactobacillus salivae* ATCC.

[0021] Figure 4 Bar charts showing ALT and AST levels in different groups of mice with alcoholic liver disease. * indicates p < 0.05 compared to the model group.

[0022] Figure 5 H&E stained sections of mice from different groups with alcoholic liver disease.

[0023] Figure 6 The bar chart shows the serum acetaldehyde levels in mice with different groups of alcoholic liver disease. * indicates p<0.05 compared to the model group. Figure 7 Bar graphs of liver inflammation and fibrinogen levels in different groups of mice with alcoholic liver disease modeling using real-time quantitative PCR. * indicates p<0.05 compared to the modeling group.

[0024] Figure 8 Bar charts showing ALT and AST levels in different groups of mice with high-sugar and high-fat diets.

[0025] Figure 9Liver images of mice in different groups with high glucose and high fat intake models. * indicates p < 0.05 compared to the model group.

[0026] Figure 10 Images of Sirius red and H&E stained sections of livers from different groups of mice with high glucose and high fat modeling.

[0027] Figure 11 Bar charts showing fecal and liver acetaldehyde levels in mice with high glucose and high fat intake models from different groups. * indicates p < 0.05 compared to the model group.

[0028] Figure 12 Bar graphs of liver inflammation and fibrinogen levels in different groups of high-sugar, high-fat mice underwent real-time quantitative PCR. * indicates p < 0.05 compared to the model group. Detailed Implementation

[0029] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, it should be understood that after reading the teachings of this invention, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined by the appended claims.

[0030] Example 1

[0031] Based on *Ligilactobacillus salivarius* CTMT1 (accession number CCTCC M 2025546, deposited on March 20, 2025 at the China Center for Type Culture Collection, Wuhan University, 299 Bayi Road, Wuchang District, Wuhan, Hubei Province), a genetically engineered *Ligilactobacillus salivarius* strain overexpressing acetaldehyde dehydrogenase was constructed. An enzyme activity reaction system was established, and the acetaldehyde metabolism capacity of the cultured bacteria was measured, yielding a genetically engineered *Ligilactobacillus salivarius* strain with strong acetaldehyde metabolism. 16S sequencing identified it as *Ligilactobacillus salivarius*, and it was named *Ligilactobacillus salivarius* CTMT2, deposited at the China Center for Type Culture Collection, Wuhan University, accession number CCTCC M 2025547.

[0032] 1) Construction of genetically engineered saliva combined with Lactobacillus CTMT2

[0033] Based on the DNA coding sequence of the acetaldehyde dehydrogenase gene (AdhE) of *Lactobacillus saliva-associated* CTMT1, primers F: ATGGTTAACAAGACAAACAACA and R: CTAGAATTGATCGATCAACAAT were designed to amplify the AdhE gene. The AdhE gene fragment was ligated into the *Lactobacillus* pMG36e vector, and the ligated DNA fragment was electroporated into *E. coli* DH5α competent cells. The cells were plated on LB agar plates containing 250 μg / ml erythromycin, and single-clone PCR was performed for identification. Positive clones were sequenced to obtain the successfully constructed AdhE-pMG36e plasmid. Figure 1 The DNA sequence of the recombinant plasmid was determined (as shown in SEQ NO.3). After extracting the AdhE-pMG36e plasmid, it was transformed into Lactobacillus salivarius CTMT1 electrotransformed competent cells and plated on MRS plates containing 1.5 μg / ml erythromycin to obtain genetically engineered Lactobacillus salivarius containing the AdhE-pMG36e plasmid, which was named Lactobacillus salivarius CTMT2.

[0034] 2) Morphological observation of Lactobacillus CTMT2 in saliva

[0035] After activating Lactobacillus CTMT2 via salivary sac, the sample was streaked onto MRS agar and incubated upside down at 37°C for 48 hours. Colony morphology was then observed. Figure 3 The strain grew well on MRS agar medium, and the colonies were milky white, raised, smooth and moist, with neat edges and easy to pick up.

[0036] 3) Detection of acetaldehyde metabolism capacity of saliva combined with Lactobacillus CTMT2 in vitro

[0037] The bacterial strain was inoculated into fresh MRS liquid medium at a 2% inoculum rate and cultured at 37°C for 18 hours. After centrifugation at 4,000g for 10 minutes, the bacterial cells were collected, washed twice with 1*PBS, and the supernatant was discarded. The bacterial cells were resuspended in sterile 1*PBS. An in vitro acetaldehyde metabolism assay system was established: 17 mM ethanol + 1 mM acetaldehyde (or 1 mM acetaldehyde), 100 μl bacterial culture medium, 1*PBS, total volume 400 μl, incubated at 37°C for 1 hour. After centrifugation at 16,000g for 20 minutes, the supernatant was collected and analyzed using EnzyChromium... TM Acetaldehyde concentration in the supernatant was detected using the Acetaldehyde Assay Kit (EACT-100) (BioAssay Systems). Separately, 100 μl of bacterial culture was serially diluted to 10⁻⁶ with sterile 1*PBS in a clean bench. -8 Take 10 -6 10 -7 10 -8Three concentration gradients were used, with 100 μl of bacterial culture from each dilution spread onto MRS agar plates and incubated at 37°C for 48 h. The number of clones on the agar plates was calculated (range: 30-300 clones / plate), and the bacterial culture concentration was determined. The acetaldehyde concentration in the supernatant was determined using conventional gas chromatography, and the acetaldehyde metabolic rate was calculated using the bacterial culture concentration. When the reaction solution contained 17 mM ethanol + 1 mM acetaldehyde, the acetaldehyde metabolic rate of *Lactobacillus salivarius* CTMT2 was 34.9 times that of *Lactobacillus salivarius* ATCC; when the reaction solution contained 1 mM acetaldehyde, the acetaldehyde metabolic rate of *Lactobacillus salivarius* CTMT2 was 20.6 times that of *Lactobacillus salivarius* ATCC. Figure 4 ).

[0038] 4) Application of saliva-based Lactobacillus CTMT2 in alleviating alcoholic fatty liver disease

[0039] Inoculate the bacterial strain into fresh MRS liquid medium at a 5% inoculum rate and incubate at 37°C for 10 hours. Then, inoculate the bacterial culture into fresh MRS liquid medium at a 2% inoculum rate and incubate at 37°C for 16 hours. Collect the bacterial cells by centrifugation at 4,000g for 10 minutes, wash twice with sterile 1*PBS, discard the supernatant, resuspend the bacterial cells in sterile 1*PBS, mix well, and prepare 5x10⁻¹⁰ culture medium. 9 A bacterial suspension with clonal forming units (CFU) / ml.

[0040] Animal experiment: Eight-week-old C57BL / 6J mice were acclimatized for 3 days with standard liquid diet (Nanjing Trofi Company) and 6 days with gradient alcohol diet (Nanjing Trofi Company). They were then fed Lieber-DeCarli liquid diet (Nanjing Trofi Company) and randomly divided into three groups: (1) Control group: Mice were administered 200 μL of sterile PBS by gavage daily; (2) Lactobacillus rhamnosus GGATCC group: Literature reports that Lactobacillus rhamnosus GGATCC 53103 has a certain effect in improving alcoholic fatty liver. Mice were administered 200 μL of 5 x 10 μL of PBS by gavage daily. 9 CFU / ml Lactobacillus rhamnosus GGATCC 53103 was used as a control bacterium; (3) Saliva-combined Lactobacillus CTMT2 group: Mice were administered 200 μL of 5 x 10 μL of Lactobacillus rhamnosus by gavage daily. 9 CFU / ml saliva combined with Lactobacillus CTMT2. Administered via gavage for 10 consecutive days. Results showed that saliva combined with Lactobacillus CTMT2 significantly improved liver function and reduced ALT and AST levels. Figure 5 ), improve H&E staining of alcoholic liver ( Figure 6 ), significantly reduced acetaldehyde levels in mouse serum ( Figure 7 It also downregulated the expression of liver inflammatory factors (Tnfa, Il1b) and lipid metabolism-related genes (Srebp-1c, Fasn, Ppara, Nf-kb). Figure 8 It alleviated the lipid accumulation phenotype in mice with alcoholic liver disease, and its effect was significantly better than that of Lactobacillus rhamnosus GGATCC 53103.

[0041] 5) Application of saliva-associated Lactobacillus CTMT2 in improving the progression of MASLD to MASH

[0042] Inoculate the bacterial strain into fresh MRS liquid medium at a 5% inoculum rate and incubate at 37°C for 10 hours. Then, inoculate the bacterial culture into fresh MRS liquid medium at a 2% inoculum rate and incubate at 37°C for 16 hours. Collect the bacterial cells by centrifugation at 4,000g for 10 minutes, wash twice with sterile 1*PBS, discard the supernatant, resuspend the bacterial cells in sterile 1*PBS, mix well, and prepare 5x10⁻¹⁰ culture medium. 9 A bacterial suspension of one colony forming unit (CFU) / ml.

[0043] Animal experiment: 6-8 week old C57BL / 6J mice were fed a high-sugar, high-fat diet (D09100310, Research Diets) for 16 weeks, and then randomly divided into three groups: (1) Control group: mice were gavaged with 200 μL of sterile PBS every other day; (2) Saliva combined with Lactobacillus ATCC group: mice were gavaged with 200 μL of 5 x 10 μL of PBS every other day. 9 CFU / ml of saliva-associated lactobacillus ATCC 11741; (3) Saliva-associated lactobacillus CTMT2 group: Mice were gavaged with 200 μL of 5 x 10 μL every other day. 9 CFU / ml saliva combined with Lactobacillus CTMT2. Continuous gavage for 6 weeks. Saliva combined with Lactobacillus CTMT2 significantly improved liver function and reduced ALT and AST levels. Figure 9 ), reducing liver enlargement and improving liver stiffness ( Figure 10 This improves the histological characteristics of liver pathological sections, including inflammation, fibrosis, and metabolic-associated fatty liver disease activity score (NAS). Figure 11 (Table 1). Saliva-associated Lactobacillus CTMT2 significantly reduced acetaldehyde concentrations in mouse liver and feces ( Figure 12 ), and downregulate liver inflammatory factors ( Tnfa, Il1b ) and fibrosis genes ( Col1a1, Col3a1, Col4a1, Tgfb, Timp1, Tnfa, II1b The expression of ) significantly improved the MASH progression in mice.

[0044] Table 1. Liver tissue characteristics of mice administered saliva and lactobacillus via gavage.

[0045] NAS value Fibrosis score Collagen percentage (%) Modeling group 6.8±0.75 3±0.5 8.63±2.39 Group 11741 of Lactobacillus saliva 6.5±0.55 3±0 5.59±0.59 Saliva-associated Lactobacillus CTMT2 group 4.2±0.75* 0±0* 1.92±0.47*

[0046] * indicates p < 0.05 compared to the model group.

Claims

1. A genetically engineered Lactobacillus salivarius, characterized in that: The strain is classified and named as Ligilactobacillus salivarius CTMT2, and the preservation number is CCTCC M 2025547.

2. Use of the genetically engineered Ligilactobacillus salivarius according to claim 1 in the preparation of a drug for improving alcoholic and metabolic-related fatty liver disease.

3. Use according to claim 2, characterized in that: The drug increases the activity level of acetaldehyde dehydrogenase.

4. Use according to claim 2, characterized in that: The drug degrades acetaldehyde.

5. Use according to claim 2, characterized in that: The drug relieves alcoholic fatty liver.

6. Use according to claim 2, characterized in that: The drug improves the progression of MASLD to MASH.

7. Use according to claim 2, characterized in that: The drug further comprises a pharmaceutically acceptable carrier and / or adjuvant.

8. Use according to claim 7, characterized in that: The pharmaceutically acceptable carrier and / or adjuvant comprises at least one of a diluent, a binder, a surface active agent, a wetting agent, an adsorption carrier, a lubricant, a filler, a disintegrant.