Aptamer for specifically recognizing spanishneedles cyclic peptide, screening method and application

Abstract

The invention provides an aptamer for specifically recognizing spanishneedles cyclic peptide, a screening method and application, and relates to the technical field of biological detection. According to the invention, a Capture-SELEX (systematic evolution of ligands by exponential enrichment) technology is combined with a structured single-stranded DNA (deoxyribonucleic acid) library, the obtained candidate aptamers are analyzed from multiple angles of thermodynamics, affinity, specificity and the like, the nucleic acid aptamer Apt-PHD with high affinity and high specificity to the spanishneedles cyclic peptide is successfully screened, and the nucleotide sequence is as shown in SEQ ID NO.1. The nucleic acid aptamer Apt-PHD has high affinity and high specificity to the spanishneedles cyclic peptide. The aptamer has the characteristics of high specificity, high affinity, stable structure, easiness in synthesis and low cost, can be used for rapidly detecting the sticktight cyclic peptide in a sample, provides a reliable molecular recognition tool for preparation of a sticktight cyclic peptide detection product, and lays a foundation for subsequent development of a multi-mode detection platform.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological detection, in particular to an aptamer specifically recognizing phalloidin, a screening method and application thereof. BACKGROUND

[0002] Mushroom poisoning is an important public health problem worldwide, posing a serious threat to food safety and human health. Phalloidin (PHD) is a cyclic heptapeptide mycotoxin produced by the deadly mushroom Amanita phalloides, with strong hepatotoxicity and cholestasis. PHD can irreversibly bind to F-actin, disrupting the integrity of the cytoskeleton and damaging cell function, and can cause liver hemorrhage and hypovolemic shock in severe cases. Oral ingestion usually causes mild acute toxicity, while intravenous injection has a very high lethality (LD 50 1.2-2.1 mg / kg) in rodents. Currently, there is no maximum residue limit (MRL) established for PHD, indicating a significant gap in food safety regulation.

[0003] Existing analytical methods mainly include chromatographic techniques (HPLC, LC-MS) and immunological detection. Chromatographic methods can achieve accurate quantification, but are expensive, complex to operate and time-consuming, making them unsuitable for rapid on-site detection. Immunological methods use antigen-antibody specific binding to achieve a certain degree of sensitivity, but antibody preparation is time-consuming and costly, and is susceptible to cross-reactions and batch differences. In particular, there is a lack of commercial antibodies for PHD, and its low molecular weight and rigid ring structure further increase the difficulty of molecular recognition.

[0004] To address these issues, aptamers, as single-stranded oligonucleotide fragments, have become effective alternative molecular recognition elements to antibodies by folding into target-specific three-dimensional structures. Aptamers have high affinity, good chemical stability, easy chemical modification and repeated use, making them particularly suitable for detecting small molecule toxins in complex food matrices. Traditional SELEX (Systematic Evolution of Ligands by Exponential enrichment) technology is widely used to screen aptamers for mycotoxins, veterinary drug residues and pesticides, but has the problems of long screening period, low enrichment efficiency and bias. Capture-SELEX effectively separates bound and unbound sequences by immobilizing the target on a solid support (such as magnetic beads), reducing non-specific interference and enhancing the enrichment efficiency of high-affinity aptamers. The introduction of structured ssDNA libraries can further improve sequence diversity and binding performance. SUMMARY

[0005] To solve the above technical problems, the application uses the Capture-SELEX technology in combination with a structured single-stranded DNA library to analyze the obtained candidate aptamer from the aspects of thermodynamics, affinity and specificity, and successfully screens the nucleic acid aptamer Apt-PHD with high affinity and high specificity to the phalloidin.

[0006] The first object of the application is to provide an aptamer specifically recognizing phalloidin, and the nucleotide sequence of the aptamer is shown as SEQ ID NO. 1.

[0007] Specifically, the nucleotide sequence of the aptamer is CCTCTCTATGGGCAGTCGGTGATTGGGATGGCTTTTTGTCTCTCTGTGTCTTTTGCTTATCGACTAAGGCACAGGGAGAATGAGGAACCCAGTGCAG.

[0008] Further, the 3' or 5' end of the aptamer is modified by a functional group or molecule.

[0009] Further, the functional group or molecule is fluorescein, enzyme label, biotin, phosphate group, radioisotope or nanoluminescent material.

[0010] The second object of the application is to provide a single-stranded DNA library for screening an aptamer specifically recognizing phalloidin, and the single-stranded DNA library is 5'-CCTCTCTATGGGCAGTCGGTGAT-N10-TTTTGTCTCTCTGTGTCTTTT-N20-GGAGAATGAGGAACCCAGTGCAG-3', wherein N10 is a sequence connected by 10 arbitrary bases, and N20 is a sequence connected by 20 arbitrary bases.

[0011] The third object of the application is to provide the application of the above single-stranded DNA library in screening an aptamer specifically recognizing phalloidin.

[0012] Further, the method comprises the following steps:

[0013] Step S1, adding phalloidin to a random single-stranded DNA library, mixing and incubating to make the random single-stranded DNA library fully combine with the phalloidin to form an incubation mixture; mixing streptavidin-coated magnetic beads with the incubation mixture, separating the solid and liquid after incubation to obtain the supernatant, and obtaining the ssDNA combined with the target;

[0014] Step S2, using the obtained ssDNA as a template to perform PCR amplification, preparing the amplification product into a single-stranded DNA to obtain a library for the next round of screening;

[0015] Step S3, replace the random single-stranded DNA library of step S1 with the next round of screening library in step S2, repeat the screening according to step S1, and increase the screening pressure in the process;

[0016] Step S4, after the screening is completed, the screening library obtained in the last round of screening in step S3 is subjected to high-throughput sequencing, the affinity and specificity of the obtained sequence to the phalloidin are detected, and the aptamer for specifically recognizing the phalloidin is obtained.

[0017] Further, in step S3, the method for increasing the screening pressure is to reduce the library concentration.

[0018] A fourth object of the present application is to provide a composition comprising the aptamer for specifically recognizing the phalloidin as described above.

[0019] A fifth object of the present application is to provide a kit comprising the aptamer for specifically recognizing the phalloidin according to any one of claims 1-3.

[0020] A sixth object of the present application is to provide the use of the aptamer for specifically recognizing the phalloidin as described above, the composition as described above, or the kit as described above in the detection of the phalloidin.

[0021] The present application has the following beneficial effects:

[0022] The present application obtains the aptamer through in vitro screening technology, and the process is faster and more efficient. The chemical synthesis is simple and easy to mark various functional groups or reporter molecules according to the needs. In addition, the aptamer also shows excellent stability and is suitable for long-term preservation. The introduction of high-throughput sequencing technology greatly improves the screening efficiency of the aptamer, saves time and cost. The present application successfully screens the aptamer Apt-PHD for the phalloidin, and the aptamer has high affinity and high specificity. The detection limit of the phalloidin based on the obtained high-affinity aptamer is as low as 18.0 pg / mL. Based on the obtained high-affinity aptamer, a portable detection device can be further developed. Such a device is suitable for rapid detection in the field or on site, and provides an effective technical means for preventing poisoning of edible fungi and strengthening food safety monitoring and early warning. BRIEF DESCRIPTION OF DRAWINGS

[0023] In order to make the content of the present application more easily understood, the present application will be further described in detail below according to specific embodiments of the present application and in conjunction with the drawings, in which:

[0024] Figure 1 A schematic diagram of the screening process of the aptamer for specifically recognizing the phalloidin of the present application;

[0025] Figure 2 A phylogenetic tree of the candidate sequences obtained by high-throughput sequencing in the embodiments of the present application;

[0026] Figure 3 These are the secondary structure prediction results of candidate aptamers in this embodiment of the invention, where AE corresponds to PHD-1, PHD-2, PHD-3, PHD-4, PHD-8 and PHD-9, respectively.

[0027] Figure 4 These are the affinity analysis results of the SGI fluorescence displacement experiment of the candidate aptamers in the embodiments of the present invention;

[0028] Figure 5 These are the thermodynamic analysis results of the isothermal titration calorimetric experiments of candidate aptamers PHD-3 and PHD-4 in the embodiments of the present invention;

[0029] Figure 6 This is the specificity analysis result of comparing the fluorescence response of candidate aptamers PHD-3 and PHD-4 with different interfering toxins in the embodiments of the present invention;

[0030] Figure 7 This is a circular dichroism spectrum diagram showing the changes in the circular dichroism spectral density before and after the binding of candidate aptamers PHD-3 and PHD-4 in an embodiment of the present invention.

[0031] Figure 8 The results of the docking simulation between aptamer PHD-3 and PHD molecules in this embodiment of the invention;

[0032] Figure 9 This represents the linear relationship between the binding sensitivity of different concentrations of phalloidin to the nucleic acid aptamer Apt-PHD in the embodiments of the present invention. Detailed Implementation

[0033] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0034] Example

[0035] I. Randomized Library, Primer and Capture Probe Design

[0036] The structured ssDNA library (97 nt) was constructed with the sequence of 5'-CCTCTCTATGGGCAGTCGGTGAT-N10-TTTTGTCTCTCTGTGTCTTTT-N20-GGAGAATGAGGAACCCAGTGCAG-3' (N10 represents a sequence of 10 arbitrary bases, and N20 represents a sequence of 20 arbitrary bases). The PCR amplification primers were derived from the library sequence, with a forward primer of 5'-FAM-CCTCTCTATGGGCAGTCGGTGAT-3' and a reverse primer of 5'-phosphate-CCTCTTACTCCTTGGGTCACGTC-3'. The capture probe was biotin-modified at the 5' end and immobilized on the surface of magnetic beads through streptavidin, and the capture probe was specifically 5'-AAAAGACACAGAGAGACAAAA-biotin-3'.

[0037] II. Preparation of streptavidin magnetic nanoparticles, library immobilization, and Capture-SELEX screening

[0038] (1) Preparation of avidin-labeled magnetic nanoparticles: Anhydrous sodium acetate, ferric chloride hexahydrate, and 1,6-hexanediamine were added to ethylene glycol, and a uniform colloidal solution was formed by heating and stirring. Fe3O4 amino magnetic nanoparticles were prepared by high-temperature reaction at 198°C for 6 hours. The particles were ultrasonically dispersed, magnetically separated, washed, dried, and ground to obtain amino Fe3O4 magnetic powder. 10 mg of magnetic powder was dissolved in 5 mL of 10 mmol / L PBS, and after ultrasonic dispersion, glutaraldehyde was added to react with avidin. After washing, a 2 mg / mL avidin-coupled magnetic bead solution was prepared.

[0039] (2) ssDNA library immobilization: The ssDNA library was hybridized with the biotinylated capture probe at a molar ratio of 1:1.5 in the binding buffer. After gradient cooling, the hybridization product was fixed with avidin-functionalized magnetic beads (Am-MBs@avidin) at 37°C for 2 hours. Through biotin-avidin interaction, the library was stably immobilized on the magnetic beads, and non-specific adsorbed sequences were removed by PBS washing.

[0040] (3) PHD aptamer directional screening: The total amount of the first round of screening system was 400 μL, 100 μM PHD was added to the immobilized ssDNA library, and incubated at 37°C and 130 rpm for 2 hours. Free PHD competitively binds, and specifically bound aptamers are dissociated and form PHD / ssDNA complexes, which remain in the supernatant. The magnetic beads were removed by separation, and the supernatant was used as the PCR template.

[0041] (4) PCR amplification: The supernatant was used as the template for PCR amplification, and the system included primers, dNTPs, Mg 2+PCR was performed using the following primers: 5'-GATCGGATCCATGGAGTCGACTAGTAC-3' (forward primer) and 5'-GATCGGATCCATGATGTCGACTAGTAC-3' (reverse primer) with Taq polymerase, and the amplification cycle conditions were as follows: 5 min of pre-denaturation at 94 °C, 30 s of denaturation at 94 °C, 30 s of annealing at 61 °C, 30 s of extension at 72 °C, and 2 min of extension at 72 °C after optimization, followed by storage at 4 °C.

[0042] (5) Polyacrylamide gel electrophoresis verification: PCR products were subjected to 8% non-denaturing gel electrophoresis, and the enzyme-digested products were subjected to 8% denaturing gel electrophoresis containing 7 M urea to detect the integrity and molecular weight position of the bands (about 80 bp).

[0043] (6) PCR product purification and enzyme digestion: a purification kit was used to remove impurities, and the concentration was determined using a nanodrop, enzyme digestion buffer and nuclease were added in proportion, and the reaction was carried out at 37 °C until completion, followed by 75 °C enzyme inactivation for 10 min.

[0044] (7) Purification of enzyme-digested products: 1 / 10 volume of 3 M NaAC was added, followed by the addition of 2 volumes of absolute ethanol, mixing, precipitation at -20 °C overnight, centrifugal precipitation, 70% ethanol washing, drying, and dissolution in 1xTE buffer for the next round of screening library.

[0045] As the number of screening rounds increased, the screening pressure was gradually increased to obtain aptamer sequences with high affinity and specificity. The first round of library dosage was 1 nmol, and then gradually reduced to 100 pmol.

[0046] Three, high-throughput sequencing and sequence analysis

[0047] The PCR products obtained in the 14th and 15th rounds of Capture-SELEX were subjected to high-throughput sequencing (HTS) (Sangon Biotechnology Co., Ltd., Shanghai, China). The sequencing data were processed using MEGA 12 software, and the top 50 sequences ranked by enrichment rate were subjected to homology analysis.

[0048] As shown in Figure 2 , multiple sequence alignment and phylogenetic clustering divided these candidate sequences into four independent families. Among these families, six aptamers (PHD-1, PHD-2, PHD-3, PHD-4, PHD-8, and PHD-9) were finally selected as candidate aptamers. Secondary structure prediction by Mfold and NUPACK showed that these aptamers had stable stem-loop structures with negative ΔG values, indicating that their thermodynamic conformation was stable and conducive to binding to target molecules ( Figure 3 ).

[0049] Four, affinity analysis of candidate aptamers

[0050] After high-throughput sequencing (HTS) screening, the binding affinity of candidate aptamers was first screened by SYBR Green I (SGI) fluorescence displacement experiment, and then verified by isothermal titration calorimetry (ITC).

[0051] In the SGI fluorescence experiment, the aptamer was rapidly cooled on ice (10 min) after heat denaturation (95 °C, 10 min) to refold. The aptamer was diluted in a gradient of 10-300 nM in binding buffer, and SGI (final concentration 1x) was added. After incubation at room temperature for 5 min, PHD was added to a final concentration of 1 µM, and incubation was continued for 20 min. The fluorescence spectrum was recorded using a microplate reader (λex = 490 nm, λem = 527 nm). The relative fluorescence change (ΔF = F0-F1, where F0 is the blank signal and F1 is the experimental signal) was used to construct the binding curve. The apparent dissociation constant (Kd) was obtained by fitting a one-site binding non-linear regression model using GraphPad Prism 8.0. All experiments were repeated three times. As shown in Figure 2, PHD-3 and PHD-4 showed the strongest PHD binding affinity compared to other candidate aptamers. Figure 4

[0052] Isothermal titration calorimetry (ITC) experiments were performed on a MicroCal PEAQ-ITC system (Malvern Instruments, UK). The candidate aptamer was dissolved in 10 mM Tris-HCl buffer (pH 7.4). Before analysis, the aptamer was heat denatured at 95 °C for 10 min and then cooled at room temperature for 30 min to facilitate refolding. All solutions were degassed before titration to remove bubbles. The aptamer concentration was 100 µM and the PHD concentration was 10 µM. In the control experiment, the target solution was replaced with an equal volume of buffer to determine the dilution heat. A 13-injection titration scheme was used: an initial delay of 60 s, a first injection of 0.4 µL, followed by a delay of 150 s; then 12 consecutive injections of 4 µL with an interval of 150 s. The data were processed using MicroCal PEAQ-ITC Analysis software to obtain the binding thermodynamic parameters. The results are shown in Figure 3 and Table 1. Figure 5

[0053] Table 1. Affinity results of aptamer PHD-3 and PHD-4

[0054] Name Sequence K d (SGI) nM K d (ITC) µM PHD-3 SEQ ID NO. 1 42.67±6.74 0.292 ± 0.0034 PHD-4 SEQ ID NO. 2 64.62±13.08 0.687 ± 0.0067

[0055] V. Specificity analysis of candidate aptamers

[0056] ​​The specificity of the candidate aptamers was evaluated under the same conditions as the affinity assay, with a fixed aptamer concentration of 100 nM. Potential interferents included T-2 toxin, DON, OTA, AFB1, and a-AMT. Non-specific binding was assessed by comparing the relative fluorescence response to that of PHD, while the blank control contained no target. All experiments were repeated three times. The results are shown in Figure 6 Figure 6, which shows that PHD-3 exhibited the highest specificity, with very low cross- reactivity and non-specific binding. In contrast, PHD-4 exhibited some cross-reactivity and non-specific binding.

[0057] VI. Circular dichroism characterization of the candidate aptamers

[0058] The conformational dynamics of the candidate aptamers and their structural changes upon binding to PHD were analyzed by circular dichroism (CD) spectroscopy using a Chirascan spectropolarimeter (Applied Photophysics, UK). During the experiment, the sample cell was continuously flushed with dry nitrogen (99.99%). The buffer and PHD baselines were subtracted. The aptamer solution (5 µM) was placed in a 1 cm quartz cuvette and scanned from 230 to 320 nm at room temperature. Each spectrum was the average of three accumulations, and all measurements were repeated three times. The results are shown in Figure 7 Figure 7, which shows that PHD-3 exhibited typical B-form DNA spectral characteristics, with a negative band at around 237 nm and a positive band at around 280 nm. Upon binding to PHD, its ellipticity changed significantly, indicating that the binding of interferon induced an increase in helicity and base stacking in the stem-loop structure. In contrast, PHD-4 exhibited only slight spectral shifts, consistent with its lower binding affinity.

[0059] VII. Molecular docking simulation of aptamer PHD-3

[0060] Molecular docking simulation was performed on aptamer PHD-3 to elucidate the interaction mechanism between the selected aptamer and PHD. The crystal structure of PHD was retrieved from the NCBI database (PubChem CID: 92043320; resolution 2.7 Å) and all water molecules were removed before docking. The secondary structure of the aptamer was predicted using Mfold, and its energy-minimized three-dimensional conformation was generated using RNAcomposer, with uracil residues converted to thymine to reflect the DNA sequence. Docking simulation was performed using AutoDock Tools 1.5.6 and AutoDock Vina 1.1.2, with each simulation run independently 100 times. The conformation with the lowest binding energy was selected for analysis. The binding interactions were visualized and mapped in PyMOL 2.3.1. The results are shown in Figure 8The docking results revealed the molecular recognition mechanism of PHD-3. The lowest energy model positioned PHD in the stem-loop junction groove, forming a clear binding pocket through hydrogen bonds, van der Waals forces and hydrophobic interactions, with a docking score of -8.6 kcal / mol.

[0061] In summary, the above results show that PHD-3 exhibits the strongest affinity for PHD, and is therefore named Apt-PHD as the specific recognition element of the present application.

[0062] Eight, application of aptamer Apt-PHD in preparation of a phalloidin colorimetric kit

[0063] The performance of the colorimetric aptasensor based on the aggregation of gold nanoparticles in sodium chloride solution for detecting Apt-PHD was evaluated. In the absence of PHD, the adsorbed aptamer keeps the gold nanoparticles stable, with a plasmon resonance peak at about 520 nm. The binding of PHD leads to the desorption of the aptamer, which in turn causes the aggregation of gold nanoparticles under the action of sodium chloride, resulting in a shift of the absorption peak to about 620 nm. The absorbance ratio shows a linear response in the concentration range of 0.01-100 ng / mL (y=3.73x + 0.69, R 2 = 0.99517), with a detection limit of 18.0 pg / mL, indicating that the sensor has high sensitivity and clear visual detection capability (R Figure 9 ).

[0064] Obviously, the above examples are merely examples for clarity and do not limit the embodiments. For those skilled in the art, other different forms of changes or variations can be made on the basis of the above description. It is not necessary or possible to exhaust all embodiments. The obvious changes or variations derived therefrom are still within the protection scope of the present application.

Claims

1. An aptamer that specifically recognizes phalloidin, characterized in that: The nucleotide sequence of the aptamer is shown in SEQ ID NO.

1.

2. The aptamer according to claim 1, characterized in that: The 3' or 5' end of the aptamer is modified with a functional group or molecule.

3. The aptamer according to claim 2, characterized in that: The functional groups or molecules are fluorescein, enzyme labeling, biotin, phosphate groups, radioactive isotopes, or nanoluminescent materials.

4. A single-stranded DNA library for screening aptamers that specifically recognize phalloidin, characterized in that: The single-stranded DNA library is 5'-CCTCTCTATGGGCAGTCGGTGAT-N10-TTTTGTCTCTCTGTGTCTTTT-N20-GGAGAATGAGGAACCCAGTGCAG-3', where N10 is a sequence composed of 10 arbitrary bases and N20 is a sequence composed of 20 arbitrary bases.

5. The use of the single-stranded DNA library of claim 4 in screening aptamers that specifically recognize phalloidin.

6. The application according to claim 5, characterized in that, Includes the following steps: Step S1: Add phalloidin to the random single-stranded DNA library, mix and incubate to allow the random single-stranded DNA library and phalloidin to fully bind and form an incubation mixture; mix streptavidin-coated magnetic beads with the incubation mixture, and after incubation, separate the solid and liquid phases and take the supernatant to obtain ssDNA that binds to the target. Step S2: Use the obtained ssDNA as a template for PCR amplification, and prepare the amplification product into single-stranded DNA to obtain the next round of screening library; Step S3: Replace the random single-stranded DNA library from step S1 with the next round of screening library described in step S2, and repeat multiple rounds of screening according to step S1, increasing the screening pressure during the process; After step S4, the screening library obtained in the last round of screening in step S3 is subjected to high-throughput sequencing to detect the affinity and specificity of the obtained sequence with phalloidin, and to obtain aptamers for specific recognition of phalloidin.

7. The application according to claim 6, characterized in that: In step S3, the method of increasing the screening pressure is to reduce the library concentration.

8. A composition, characterized in that: The composition comprises an aptamer that specifically recognizes phalloidin as described in any one of claims 1-3.

9. A reagent kit, characterized in that: The kit contains an aptamer that specifically recognizes phalloidin as described in any one of claims 1-3.

10. The use of the aptamer for specifically recognizing phalloidin according to any one of claims 1-3, the composition according to claim 8, or the kit according to claim 9 in the detection of phalloidin.

Images