Maize flowering period related regulatory gene, expression product thereof, haplotype and application
By using multi-environmental localization and molecular marker-assisted selection, genes regulating the tasseling, pollen shedding, and silking stages of maize were screened, solving the problem of maize flowering period regulation and achieving precise regulation of flowering period and improved yield stability.
Patent Information
- Application Number
- CN202511892541.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-16
- Publication Date
- 2026-06-26
- Estimated Expiration
- 2045-12-16
AI Technical Summary
Existing technologies are insufficient to precisely control the flowering period of maize, leading to abnormal flowering periods in the Huang-Huai-Hai region, which affects yield stability and ecological adaptability. There is a lack of effective genetic and molecular markers for cross-ecological breeding.
By using multi-environmental localization to identify genes ZmZP1, ZmHSP70-10, and ZmMHF1 and their expression products that regulate the tasseling, pollen shedding, and silking stages of maize, and combining this with marker-assisted selection, superior haplotypes can be screened to achieve precise regulation of the flowering period.
It improves the selection efficiency of maize flowering period-oriented breeding, optimizes the flowering period, increases the number of tassel branches, pollen quantity and the synchronicity of male and female flowering periods, ensures maize pollination efficiency and yield stability, and adapts to extreme climates in different ecological zones.
Smart Images

Figure CN121320382B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering breeding technology, specifically to genes that regulate the flowering period of maize, including the gene ZmZP1 that regulates the tasseling period, the gene ZmHSP70-10 that regulates the pollen shedding period, the gene ZmMHF1 that regulates the silking period, the gene expression products, superior haplotypes, and their application in maize genetic breeding, especially in the regulation of the tasseling period in the Huang-Huai-Hai region. Background Technology
[0002] The tasseling date (DTT) of maize (Zea mays L.) is a core trait determining the ecological adaptability of varieties. The tasseling date is the critical growth period during which the maize tassel emerges from the leaf sheath, directly determining the quality of tassel development and pollen viability. High-latitude spring maize regions (such as Northeast China) require early tasseling varieties to avoid frost damage; the Huang-Huai-Hai summer maize region requires tasseling date matching with subsequent crop rotation; and tropical germplasm introduced to temperate zones often suffers from delayed tasseling, leading to maturation difficulties. Current methods for improving maize tasseling date rely on traditional phenotypic selection, which is time-consuming, inefficient, and lacks core genes and molecular markers for precise regulation of tasseling date, making it difficult to meet the differentiated needs of different ecological regions. Therefore, identifying genes regulating tasseling date and screening for superior haplotypes are crucial for breeding maize varieties adapted across ecological regions.
[0003] The pollen shedding period (DTP) is a core trait of maize reproductive growth, directly determining the plant's pollination efficiency, seed setting rate, and ecological adaptability. A suitable pollen shedding period can optimize light energy utilization efficiency, expand the planting range of varieties, and mitigate the damage to the reproductive process caused by extreme weather (such as high temperatures and frost). Currently, the Huang-Huai-Hai region, as my country's main maize-producing area, is affected by global warming, with frequent extreme high temperatures and droughts, leading to mismatch between male and female flowers during the flowering period, a decline in seed setting rate, and a serious threat to yield stability.
[0004] The synchronicity (ASI) between the Days to Silking (DTS) and silking stages in maize is crucial for seed setting rate. Delayed or asynchronous silking (prolonged ASI) can lead to pollination failure, decreased seed setting rate, and severely threaten yield stability. The Huang-Huai-Hai region, a major maize-producing area in my country, is affected by global warming, experiencing frequent extreme high temperatures (≥35℃) and droughts in July and August. This results in an average delay in the silking stage, prolonged ASI, and abnormal silking, causing yield losses.
[0005] Therefore, multi-environmental mapping is key to identifying flowering period regulating genes and superior haplotypes with cross-environmental stability, which is crucial for solving abnormal flowering period of maize in the Huang-Huai-Hai region and improving the ecological adaptability of varieties. Multi-environmental mapping can integrate phenotypic data from different geographical environments to screen genes that are stably associated in all environments, ensuring that they can accurately regulate flowering period in different subregions of the Huang-Huai-Hai region, and providing core gene resources for breeding maize varieties that can be promoted across regions. Summary of the Invention
[0006] To optimize the tasseling period of maize, ensure the adaptability of varieties to maturity, and improve ecological adaptability, thereby laying the foundation for regionalized maize planting and stable yield, this invention provides a method for identifying and screening candidate genes regulating the tasseling period of maize based on multi-environmental phenotypic data. Furthermore, this invention also relates to the maize tasseling period regulating gene ZmZP1, the pollen shedding period regulating gene ZmHSP70-10, and the silking period regulating gene ZmMHF1, their expression products, haplotypes, and their applications in maize breeding. The method for applying the maize tasseling period regulating gene ZmZP1, the pollen shedding period regulating gene ZmHSP70-10, and the silking period regulating gene ZmMHF1 to maize tasseling period improvement breeding practices can be extended to the breeding applications of other flowering period-related regulatory genes.
[0007] This invention provides genes related to the flowering period of maize, including ZmZP1, a gene regulating the tasseling stage, ZmHSP70-10, a gene regulating the pollen shedding stage, and ZmMHF1, a gene regulating the silking stage. The nucleotide sequence of the gene ZmZP1 is shown in SEQ ID NO.1, the nucleotide sequence of the gene ZmHSP70-10 is shown in SEQ ID NO.3, and the nucleotide sequence of the gene ZmMHF1 is shown in SEQ ID NO.5.
[0008] Furthermore, the expression products of the genes ZmZP1, ZmHSP70-10, and ZmMHF1, namely the proteins encoded by the genes ZmZP1, ZmHSP70-10, and ZmMHF1, have amino acid sequences as shown in SEQ ID NO.2, SEQ ID NO.4, and SEQ ID NO.6, respectively.
[0009] This invention also provides haplotypes of the gene ZmZP1, which regulates emasculation, and occurs on chromosome 2. These haplotypes include six types, with nucleotide sequences shown in SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, and SEQ ID NO.12. Materials carrying the Hap2 haplotype can significantly delay emasculation.
[0010] This invention also provides haplotypes of the gene ZmHSP70-10 that regulates pollen shedding time, located on chromosome 5, including two types, with nucleotide sequences shown in SEQ ID NO.13 and SEQ ID NO.14. Materials carrying the Hap1 (TT, T) haplotype can significantly advance pollen shedding time, while materials carrying the Hap2 (GT, K) haplotype can significantly delay pollen shedding time.
[0011] This invention also provides haplotypes of the gene ZmMHF1, which regulates the silking stage, occurring on chromosome 2. Five haplotypes are included, with nucleotide sequences shown in SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, and SEQ ID NO.19. The haplotype sequences contain degenerate base codes, the specific base combinations of which refer to the degenerate base codes (e.g., R represents A / G, Y represents C / T, K represents G / T, S represents G / C, M represents A / C, and O represents heterozygous indel). Materials carrying haplotypes Hap2 and Hap5 can significantly advance the silking time, while materials carrying haplotypes Hap1, Hap3, and Hap4 can significantly delay the silking time.
[0012] This invention also provides the application of the expression products or haplotypes of the genes ZmZP1 (regulating the tasseling stage), ZmHSP70-10 (regulating the pollen shedding stage), and ZmMHF1 (regulating the silking stage) in maize genetic breeding.
[0013] Furthermore, the expression products or haplotypes of the gene ZmZP1 that regulates the tasseling stage, the gene ZmHSP70-10 that regulates the pollen shedding stage, and the gene ZmMHF1 that regulates the silking stage are applied in the regulation of the tasseling, pollen shedding, or silking stages of maize in the Huang-Huai-Hai region.
[0014] A method for regulating maize flowering time involves screening maize germplasm with a target flowering time by detecting the haplotypes of the ZmZP1, ZmHSP70-10, and ZmMHF1 genes in maize materials.
[0015] A maize breeding method that utilizes the aforementioned haplotypes for marker-assisted selection to cultivate maize varieties with suitable flowering periods.
[0016] A molecular marker ensemble for detecting haplotypes related to maize flowering time includes SNPs or InDel markers associated with haplotypes of the ZmZP1, ZmHSP70-10, and ZmMHF1 genes.
[0017] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0018] 1. The gene ZmZP1 that regulates the tasseling period, the gene ZmHSP70-10 that regulates the pollen shedding period, and the gene ZmMHF1 that regulates the silking period of this invention are all applicable to the identification of maize germplasm resources with suitable flowering periods. They can be used to distinguish maize hybrids with different flowering characteristics (such as early tasseling type suitable for summer sowing in the Huang-Huai-Hai Plain and timely tasseling type suitable for spring sowing in Northeast China), improve the selection efficiency in the process of directional breeding of maize flowering periods, and have high practical value. They provide key reference for breeding new maize varieties with suitable flowering periods that are adapted to the ecological conditions of core production areas such as the Huang-Huai-Hai Plain and resistant to extreme climates.
[0019] 2. The nucleotide sequences (CDS fragments) of the gene ZmZP1 regulating the tasseling period, the gene ZmHSP70-10 regulating the pollen shedding period, and the gene ZmMHF1 regulating the silking period obtained by the present invention are shown in SEQ ID NO.1, SEQ ID NO.3, and SEQ ID NO.5, and their encoded protein sequences are shown in SEQ ID NO.2, SEQ ID NO.4, and SEQ ID NO.6. The ZmZP1, ZmHSP70-10, and ZmMHF1 genes can be effectively applied to maize genetic breeding, and have positive effects on optimizing maize flowering time, increasing the number of tassel branches and pollen quantity, and improving tasseling stability across ecological zones; optimizing maize pollen shedding period and improving the synchronicity of male and female flowering periods; optimizing maize silking period and improving the synchronicity of male and female flowering periods (shortening ASI); and avoiding drought. They provide genetic resource support for ensuring maize pollination efficiency, seed setting rate, and yield stability. Attached Figure Description
[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0021] Figure 1 Results of multi-environmental location studies for the tasseling stage of maize hybrids.
[0022] Figure A shows the Manhattan plot generated by genome-wide association analysis of maize hybrids at the tasseling stage using the Farm CPU model; Figure B shows the multi-environmental colocalization distribution map of associated loci; and Figure C shows the multi-environmental colocalization UpSet plot of QTLs.
[0023] Figure 2 Results of multi-environmental location studies for the pollen shedding period of maize hybrids.
[0024] Figure A shows the Manhattan plot generated by genome-wide association analysis of maize hybrids at the tasseling stage using the Farm CPU model; Figure B shows the multi-environmental colocalization distribution map of associated loci; and Figure C shows the multi-environmental colocalization UpSet plot of QTLs.
[0025] Figure 3 Results of multi-environmental location studies for the silking stage of maize hybrids.
[0026] Figure A shows the Manhattan plot generated by genome-wide association analysis of maize hybrids at the tasseling stage using the Farm CPU model; Figure B shows the multi-environmental colocalization distribution map of associated loci; and Figure C shows the multi-environmental colocalization UpSet plot of QTLs.
[0027] Figure 4 The results of GO (GeneOntology) enrichment analysis of genes expressed during the tasseling stage of maize, which were screened using genome-wide association analysis.
[0028] Figure 5 The results of GO (GeneOntology) enrichment analysis of genes expressed during the pollination stage of maize, which were screened using genome-wide association analysis.
[0029] Figure 6 The results of GO (GeneOntology) enrichment analysis of genes expressed during the silking stage of maize, which were screened using genome-wide association analysis.
[0030] Figure 7 To analyze the differences between different haplotypes of the gene ZmZP1 that regulates the emasculation period and to determine haplotype combinations, the horizontal axis represents different haplotypes, with Hap1, Hap2, Hap3, Hap4, Hap5, and Hap6.
[0031] Figure 8 To analyze the differences between different haplotypes of the gene ZmHSP70-10 that regulates the pollen shedding period and to determine haplotype combinations, the horizontal axis Hap1 and Hap2 represent different haplotypes.
[0032] Figure 9 To analyze the differences between different haplotypes of the gene ZmMHF1 that regulates the silking stage and to determine haplotype combinations, the horizontal axis Hap1, Hap2, Hap3, Hap4, and Hap5 represent different haplotypes. Detailed Implementation
[0033] The technical solution and effects of the present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the scope of protection of the present invention is not limited thereto.
[0034] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.
[0035] Example 1
[0036] This embodiment describes the identification process of the gene ZmZP1, which regulates the male ejaculation stage, the gene ZmHSP70-10, which regulates the pollen shedding stage, and the gene ZmMHF1, which regulates the silk spinning stage.
[0037] I. Experimental Data
[0038] 1. The test materials consisted of 368 maize hybrids that are the main varieties promoted in the Huang-Huai-Hai region, including key varieties such as Zhengdan 958, Xianyu 335, and MY73. Genotypic data of these materials were obtained by combining the Maize48K BeadChip with DNBSEQ-T7 high-throughput sequencing. After quality control (MAF≥5%), 361,140 high-quality SNPs and 76,269 high-quality InDels were retained and mapped to the B73 RefGen_V4 reference genome.
[0039] II. Experimental Methods
[0040] (1) From 2023 to 2024, 368 materials were planted in 6 environments (Yuanyang, Zhengzhou, Suiping, and Hebi in Henan Province, Shijiazhuang in Hebei Province, and Fuyang in Anhui Province). The phenotypic dynamics of each row of materials were observed and recorded at fixed points every day. When the proportion of stamens in each row reached 50% or more, the date was recorded as the stamening period. The number of days from which 50% of the plants began to shed pollen was observed and recorded as the pollen shedding period. When the proportion of silking plants in each row reached 50% or more, the date was recorded as the silking period. The BLUP (Best Linear Unbiased Prediction) value of the stamening period in each environment was calculated using the lem4 package in R language software.
[0041] (2) Using the Farm CPU model of the GAPIT package in R language, combined with the phenotypic values and BLUP values of the male ejaculation stage, pollen shedding stage, and silk-spinning stage under various environments, GWAS analysis was performed, and Manhattan plots and QQ plots were drawn. Figure 1 , Figure 2 , Figure 3 Calculate the p-value for each SNP / InDel, with p ≤ 1.0 × 10⁻⁶. -5 As a threshold, SNPs / InDels smaller than this value are defined as significant SNPs / InDels.
[0042] (3) Based on the linkage disequilibrium decay distance of this set of markers being 80 kb, a range of 80 kb upstream and downstream of a significant SNP / InDel was defined as a significant site. All genes within the significant site were screened based on the B73 RefGen_V4 genomic information.
[0043] (4) Based on gene functional annotation and homologous gene information, possible candidate genes within the locus are screened, and genes regulating pathways related to the tasseling, pollen shedding, and silking stages of maize are identified as key genes through GO enrichment analysis. Figure 4 , Figure 5 , Figure 6 ).
[0044] (5) Based on the candidate genes identified by GWAS and the above screening methods, the expression of these potential candidate genes in maize tassel-related tissues was used to finally determine the candidate gene ZmZP1 (gene accession number: Zm00001d002732) regulating the tasseling stage of maize; ZmHSP70-10 (gene accession number: Zm00001d014358) regulating the pollen shedding stage of maize; and ZmMHF1 (gene accession number: Zm00001d003888) regulating the silking stage of maize.
[0045] III. Analysis of Results During the Ejaculation Period
[0046] The nucleotide sequence (CDS fragment) of the ZmZP1 gene is shown in SEQ ID NO.1, and the protein sequence it encodes is shown in SEQ ID NO.2.
[0047] SEQ ID NO.1:
[0048]
[0049] SEQ ID NO.2:
[0050] Met Cys Glu Ser Leu Thr Ser Leu Met Pro Pro Ser Pro Pro Pro Ser ProPro Glu Tyr Lys His Phe Cys Arg Val Cys Asn Lys Gly Phe Thr Cys Gly Ser AlaLeu Gly Gly His Met Arg Ala His Gly Pro Ala Ser Asp Val Asp Gly Phe Gly ValVal Asp Asp Asp Asp Gly Ser Leu Asp Glu Glu Gly Val Thr Arg Cys Pro Gly AlaAsp Glu Trp Asp Asp Ala Val Gly Thr Ser Ala Thr His Ala Tyr Ala Leu Arg AlaAsn Pro Asn Arg Leu Ile Arg Ser Cys Gln Leu Cys Lys Asn Cys Gly Lys Glu PheThr Ser Leu Glu Leu Phe Leu Gln His Ala Arg Cys Ser Arg Ser Glu Asp Glu GlyGly Gly Gly Glu Glu Glu Gln Val Gly Ser Pro Val Pro Ser Ser Ser Ser Pro ProThr Asn Ala Asp Gly Gly Gly Asp Glu Asp Pro Ile Leu Ala Thr Pro Trp Ser LysGly Lys Arg Ser Arg Arg Val Gly Thr Thr Glu Glu Asp Pro Ser Thr Ser Thr ValGly Glu Glu Glu Asp Leu Ala Lys Cys Leu Val Met Leu Ser Ser Ser Lys Ser AsnIle Asn Asp Gln Glu Ala Asn Val Ile Ala Thr Ile Thr Lys Asp Asp His His HisGln Lys Gln Pro Ile Pro Phe Phe Thr Gln Ser Gln Glu Ser Val Val Ala Ala LeuPro Ser Ser Pro Leu Val Val ProGln Tyr Ile Ser Pro Ala Pro Arg Gly Gly ValPhe Glu Cys Lys Ala Cys Lys Lys Val Phe Thr Ser His Gln Ala Leu Gly Gly HisArg Ala Ser His Lys Lys Val Lys Gly Cys Phe Ala Ala Lys Phe Glu Thr Ser AsnAla Thr Glu Ser Thr Arg His His Gln Val Val Ala Val Asn Ile Ala Lys Asp GlyArg Asn Asn Asp Asn Gly Lys Ala Pro Ala Val Asp Glu Ile Ile Asn Ala Gly AlaSer Ala Ser Ala Ser Ala His Val Pro Gly Gly Phe Ala Thr Thr Ile Val Asp ThrAsn Ile Gly Thr Ser Ser Asp Thr Pro Arg Ser Leu Tyr Ser Ser Met Ala Leu AlaPro Ile Val Glu His Asn Pro Leu Val Glu Thr Thr Leu Ala Val Ala Ala Ala GlnPhe Lys Lys Ser Thr Lys Met His Glu Cys Ser Val Cys His Arg Leu Phe Thr SerGly Gln Ala Leu Gly Gly His Lys Arg Cys His Trp Leu Thr Ser Asn Thr Ser AspPro Cys Asn Thr Val Thr Ala Ser Met Ile Pro Ser Leu Thr Glu Asp Phe Val GlyGly Val Val Lys Gln Gln Phe Asn Leu Gln Pro Gln Pro Met Val Val Asp Val ProPro Pro Val Leu Asp Leu Thr Ile Ala Pro Asn Ala Thr Val Ala His Leu Gln ProLeu Ala Val Ala Ala Pro Ser Asn Val Asn His Gln Lys LysAsp Ala Thr Arg LysLys Tyr Ala Ile Asp Ala Val Met Glu Glu Glu Glu Ala Asp Ser Thr Pro Ala LysArg Ala Lys Ile Ser Asp Leu Lys Asp Met Val Ser Met Asp Gly Glu Pro Thr LysPro Trp Leu Gln Val Gly Ile Gly Ser Ser Ser Ala Pro Gly Asp Asp Ser *
[0051] IV. Analysis of Results During the Powder Dispersion Period
[0052] The nucleotide sequence (CDS fragment) of the ZmHSP70-10 gene is shown in SEQ ID NO.3, and the protein sequence it encodes is shown in SEQ ID NO.4.
[0053] SEQ ID NO.3:
[0054]
[0055] SEQ ID NO.4:
[0056] Met Ser Val Val Gly Phe Asp Val Gly Asn Asp Thr Leu Val Ala Ala AlaAla Arg Gln Arg Gly Ile Asp Val Leu Leu Asn Ala Glu Ser Lys Arg Glu Ser ProAla Ala Ile Ala Phe Ser Arg Asn Ala Arg Leu Ile Gly Cys His Ala Ala Ser AlaSer Ser Ala His Ala Pro Phe Ser Ser Val Lys Arg Leu Leu Met Gly Ala Thr GlyArg His Pro Asp Ser Ser Leu Leu Arg Asp Leu Ser Arg Leu Pro Phe Pro Ala AlaVal Gly Gly Gly Ala Val Val His Ala Asp His Ile Gly Arg Arg Ile Ala Leu SerPro Thr His Leu Leu Ser Met Leu Leu Ala Tyr Leu Lys Gln Leu Ala Glu Ala AspLeu Gly Gly Ala Pro Val Ala Asp Cys Val Ile Ser Val Pro Cys Tyr Phe Thr GlnAla Gln Arg Arg Ala Tyr Leu Asp Ala Ala Ala Ile Ala Gly Leu Arg Pro Leu ArgLeu Met His Asp Leu Ala Ala Thr Ala Leu Gly Tyr Gly Leu Tyr Arg Ser Asp LeuGly Gly Ser Gly Gly Pro Thr Cys Val Ala Phe Val Asp Val Gly Gln Cys Asp ThrGln Val Ala Val Val Ser Phe Asp Met Ser Gly Met Lys Val Leu Ser His Gly PheAsp Ala Leu Asp Gly Arg Asp Phe Asp Glu Val Leu Phe Glu His Phe Ala GluGlu Phe Lys Asp Arg Tyr Met IleAsp Val Thr Gly Asn Val Lys Ala Ser Met ArgLeu Arg Ala Cys Glu Lys Ala Lys Val Leu Ser Ala Asn Ala Glu Ala ValVal Asn Ile Glu Cys Leu Ile Glu Glu Lys Asp Val Arg Gly Val Ile Arg Arg GluAsp Phe Glu Lys Pro Gys Leg Leu Val Leu Val Leu Asu Arg Arg ArgAla Val Thr Asp Ser Arg Ile Gly Leu Glu Arg Leu His Ser Val Glu Leu Val GlySer GlySer GlySer Arg Val Pro Ala Ile Ala Lys Val Leu Lys Glu Phe Arg Lys GluPro Ser Arg Thr Leu Asn Ser Glu Cys Val Arg Arg Le Cys Cys Ala Serg Pro Thla Gln Tyr Glu Val His Asp Ala Ile ProAla Ser Ile Gly Phe Tyr Thr Ser Asp Gly Pro Val Ser Thr Leu Ser Asp AlaLeu Phe Arg Gly Leu Pro Phe Pro Ser Val Lys Ile Ile Thr Leu Gln Lys AsnAsp Ser Phe Ser Phe Asp AlaS Tyr Pror Asp Gly Thr Val Asp Ala Gly Ser Phe Gln Ile Gly Pro Phe Gln Ala His Met Glu Ala SerLys Val Lys Val Lys Ile Arg Leu Asn Leu His Gly Leu Val Ser Val Glu Ser AlaAla Leu Ile Asp Tyr Gln Arg Ala Thr Ser Ala AspHis Met Glu Val AspThr Ser Gly Asp Asp Met Gln Gly His Lys Ser Arg Ser Glu Arg Ser Ile Gln ArgGln Glu Leu Pro Ile Thr Glu Tyr Ile Cys Cys Ala Met Ser Lys Gln Glu Leu LeuGlu Ala Gln Glu Gln Glu His Gln Leu Ala Tyr Gln Asp Lys Leu Met Glu Arg ThrLys Asp Arg Lys Asn Ala Leu Glu Ser Tyr Val Tyr Asp Thr Arg Asn Lys Leu SerGlu Arg Tyr Arg Ser Phe Ala Thr Asp Ser Glu Arg Glu Gln Ile Ser Phe Asn LeuGln Gln Thr Glu Asp Trp Leu Tyr Glu Glu Gly Asp Asp Glu Thr Glu Val Val TyrSer Ser Lys Leu Glu Glu Leu Lys Lys Leu Val Asp Pro Ile Glu Asn Arg Cys AsnAsp Asp Glu Val Arg Ala Glu Ile Ala Arg Glu Leu Leu Lys Cys Ile Val Asp HisArg Met Ala Ala Lys Ser Leu Ser Ala Pro Glu Arg Asp Ala Val Asp Asn Glu CysAsn Lys Ala Glu Gln Trp Leu Ser Glu Gly Ser Lys Leu Gln Glu Ser Leu Pro LysAsn Val Asp Pro Val Leu Trp Ser Cys Glu Ile Lys Gly Lys Glu Glu Glu Leu AspMet Phe Cys Arg Asn Ile Thr Arg His Lys Gly Ser Pro Ala Arg Thr Asp Gly SerArg Gly Ser Asp His Met Pro Thr Pro Asp Arg Asp *
[0057] V. Analysis of Results During the Powder Shedding Period
[0058] The nucleotide sequence (CDS fragment) of the ZmMHF1 gene is shown in SEQ ID NO.5, and the protein sequence it encodes is shown in SEQ ID NO.6.
[0059] SEQ ID NO.5:
[0060] ATGGACCCGGACCTGGACCTCGACCTAGACATGGATATGGAGACGCTCGCCGGCGACAGCGGCGGCGAGGCCGAGCGCAACGAAGCCGCCGAGGCCGAGGCTGAGGTGGAGCGGTACGAGGCCGCCGAAGCCGAGGCCGACATCCTCCGCGACCGATTCCGCCTCGCCGTCATCAGCATCGCCACCGCCGAAGGAAAGAAGGCCGGAATGACGGTCGCCGACCCCGTTGTTTCCTGC ATCGCCGACTTGGCGTTCAAGAGCGCAGAGCAGCTAGCAAAGGATGCAGTTGTTTGCACAGCATGCCGGTCGCAAATCCGTCAGGATGGATGATGTCATACTCACAGCTCACAGGAACGAGCATCTTATGGGCCTGCTGCGGACCTTCTCTCAGGAGCTGAAGGGAAAGGAGCCTGCCAGTGAGAGGAAGAGAAAGAAATCGTCCAAGAAGGATGAGACGGTGATCGAGGTCTGA
[0061] SEQ ID NO.6:
[0062] Met Asp Pro Asp Leu Asp Leu Asp Leu Asp Met Asp Met Glu Thr Leu AlaGly Asp Ser Gly Gly Glu Ala Glu Arg Asn Glu Ala Ala Glu Ala Glu Ala Glu ValGlu Arg Tyr Glu Ala Ala Glu Ala Glu Ala Asp Ile Leu Arg Asp Arg Phe Arg LeuAla Val Ile Ser Ile Ala Thr Ala Glu Gly Lys Lys Ala Gly Met Thr Val Ala AspPro Val Val Ser Cys Ile Ala Asp Leu Ala Phe Lys Ser Ala Glu Gln Leu Ala LysAsp Ala Glu Leu Phe Ala Gln His Ala Gly Arg Lys Ser Val Arg Met Asp Asp ValIle Leu Thr Ala His Arg Asn Glu His Leu Met Gly Leu Leu Arg Thr Phe Ser GlnGlu Leu Lys Gly Lys Glu Pro Ala Ser Glu Arg Lys Arg Lys Lys Ser Ser Lys LysAsp Glu Thr Val Ile Glu Val *
[0063] Example 2
[0064] I. This example is a screening of superior haplotypes of the maize tasseling regulation gene ZmZP1.
[0065] Haplotype difference analysis was performed using data on the tasseling date of 368 maize hybrids and their genotype data within the ZmZP1 interval. Figure 7Specifically, firstly, unknown genotypes were eliminated. Then, using the tasseling date of 368 maize hybrids as phenotypic data, haplotypes were classified based on the genotypes of these hybrids within the ZmZP1 region. Haplotypes were removed when the number of hybrids containing a particular haplotype was less than 10. Specifically, firstly, all variation information within ZmZP1 was extracted from all materials. Based on the extraction results, a nucleotide variation was identified within this gene. Referring to the B73RefGen_V4 reference genome, the physical locations of each variation site on chromosome 2 are as follows: 20703484, 20703737, 20703758, 20703809, 20704261, 20704266, 20704273, 20704278, 20704286, 20704326, and 20704481. The existence of this variation was verified by PCR amplification and sequencing. The haplotypes include six types: Hap1, Hap2, Hap3, Hap4, Hap5, and Hap6, with nucleotide sequences shown in SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, and SEQ ID NO.12. The haplotype sequences contain degenerate base codes, and their specific base combinations refer to the degenerate base codes (e.g., R represents A / G, Y represents C / T, K represents G / T, 0 represents heterozygous indel, and - represents deletion). Phenotypic data revealed that materials carrying the Hap1 (TT, T) haplotype significantly advanced tasseling time, while materials carrying the Hap2 (SEQ ID NO.4) haplotype significantly delayed tasseling time, providing a basis for identifying whether maize flowers prematurely.
[0066] SEQ ID NO.7: YRKYT-KRRYR
[0067] SEQ ID NO.8: YRKYY0KRGTA
[0068] SEQ ID NO.9: CATTY0TGRYR
[0069] SEQ ID NO.10: YAKTT-KRRYG
[0070] SEQ ID NO.11: YAKTC0TRGTR
[0071] SEQ ID NO.12: CATTT-TGACG
[0072] II. This example is a screening of haplotypes of the gene ZmHSP70-10 that regulates the pollen shedding period in maize.
[0073] A haplotype difference significance analysis was performed using phenotypic data of pollen shedding period from 368 hybrid accessions and their genotypic data within ZmHSP70-10 to identify different haplotypes affecting pollen shedding period. Figure 8 Specifically, firstly, all variation information within ZmHSP70-10 was extracted from all materials. Based on the extraction results, a nucleotide variation was identified within this gene, specifically located at 42,620,638 bp on chromosome 5, which was verified by PCR amplification and sequencing. This site was identified as primarily a mutation from the TT type to the GT type, which can be divided into two haplotypes, with their nucleotide sequences shown in SEQ ID NO.13 and SEQ ID NO.14. Combined with phenotypic data, it was found that materials carrying the Hap1 (TT, T) haplotype significantly advanced pollen shedding time, while materials carrying the Hap2 (GT, K) haplotype significantly delayed pollen shedding time, providing a basis for identifying whether maize flowers early.
[0074] SEQ ID NO.13: TT
[0075] SEQ ID NO.14: GT
[0076] III. This example is a screening of superior haplotypes of the maize silking stage regulatory gene ZmMHF1.
[0077] Screening of haplotypes of ZmMHF1, a gene regulating the silking stage of maize.
[0078] Haplotype difference analysis was performed using silking time data from 368 maize hybrids and their genotype data within the ZmMHF1 interval. Figure 3Specifically, firstly, unknown genotypes were eliminated. Then, using the silking date of 368 maize hybrids as phenotypic data, haplotypes were classified based on the genotypes of these hybrids within the ZmMHF1 region. Haplotypes were removed when the number of hybrids containing a particular haplotype was less than 10. Specifically, firstly, all variation information within ZmMHF1 was extracted from all materials. Based on the extraction results, a nucleotide variation was identified within this gene. Referring to the B73RefGen_V4 reference genome, the physical locations of each variation site on chromosome 2 are as follows: 65275993, 65276000, 65276001, 65276014, 65276019, 65276021, 65276046, 65276081, and 65276150. The existence of this variation was verified by PCR amplification and sequencing. The haplotypes include five types, with nucleotide sequences shown in SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, and SEQ ID NO.19. The haplotype sequences contain degenerate base codes, and their specific base combinations refer to the degenerate base codes (e.g., R represents A / G, Y represents C / T, K represents G / T, S represents G / C, M represents A / C, and O represents a heterozygous indel). Phenotypic data revealed that materials carrying haplotypes Hap2 and Hap5 significantly advanced silking time, while materials carrying haplotypes Hap1, Hap3, and Hap4 significantly delayed silking time. This provides a basis for identifying whether maize flowers early.
[0079] SEQ ID NO.15: AYSGRATGR
[0080] SEQ ID NO.16: MYGKGR0KA
[0081] SEQ ID NO.17: ATGGGATGA
[0082] SEQ ID NO.18: MCSKRR0KG
[0083] SEQ ID NO.19: ACCGAATGG
[0084] Example 3
[0085] I. Application of ZmZP1 gene regulating maize tasseling stage in breeding
[0086] To verify the application value of the maize tasseling regulation gene ZmZP1 in actual production, SNPs located in the ZmZP1 gene were screened based on the genotype data used in Example 1 and the typing method shown in Example 2. Based on the SNPs in the ZmZP1 gene, 368 maize varieties were divided into 6 haplotype combinations. Among them, maize hybrids carrying the Hap2 haplotype containing the SEQ ID NO. 8 sequence and other haplotypes are shown in Table 1. These superior maize hybrids can provide excellent germplasm resources for the breeding of new maize varieties with different tasseling periods and have high practical value in the development of the specialty maize industry.
[0087] Table 1. Maize hybrids carrying the Hap2 haplotype containing the SEQ ID NO. 8 sequence and other haplotypes.
[0088]
[0089] II. This example demonstrates the application of the gene ZmHSP70-10, which regulates the pollen shedding period of maize, in breeding practice.
[0090] To verify the application value of the gene ZmHSP70-10, which regulates the pollen shedding period of maize, in actual production, 368 maize varieties were divided into two haplotype combinations based on the genotype data used in Example 1 and the typing method shown in Example 2. Maize varieties carrying Hap1 and Hap2 are listed in Table 2. These superior maize varieties can provide excellent germplasm resources for breeding new maize varieties with different pollen shedding periods, and have high practical value in the development of the specialty maize industry. Specifically, breeders who want to breed varieties with earlier pollen shedding can selectively choose materials carrying the Hap1 (TT, T) haplotype for combination. Conversely, by selecting materials carrying the Hap2 (GT, K) haplotype, referring to the B73 RefGen_V4 reference genome, i.e., materials with TT and GG at 42620638bp on chromosome 5 respectively, varieties with later pollen shedding periods can be bred.
[0091] Table 2. Maize varieties carrying Hap1 and Hap2
[0092]
[0093] III. Application of the maize silking stage regulatory gene ZmMHF1 in breeding
[0094] To verify the application value of the maize silking period regulating gene ZmMHF1 in actual production, SNPs located within the ZmMHF1 gene were screened based on the genotype data used in Example 1. Based on the SNPs within the ZmMHF1 gene, 368 maize hybrids were divided into five haplotype combinations: Hap1, Hap2, Hap3, Hap4, and Hap5. Among them, haplotypes carrying the sequence SEQ ID NO.16 (Hap2) and SEQ ID NO.19 (Hap5) exhibit earlier silking periods. The maize hybrids carrying these haplotypes are shown in Table 3. Maize hybrids containing different haplotypes are of significant importance in shortening the silking-pollen interval in actual production. These superior maize hybrids can provide excellent germplasm resources for the breeding of new maize varieties with different silking periods, and have high practical value in the development of the specialty maize industry.
[0095] Table 3. Maize hybrids carrying haplotypes
[0096]
[0097] In summary, the nucleotide sequences (CDS fragments) of the ZmZP1, ZmHSP70-10, and ZmMHF1 genes screened by this invention are shown in SEQ ID NO.1, SEQ ID NO.3, and SEQ ID NO.5, and their encoded protein sequences are shown in SEQ ID NO.2, SEQ ID NO.4, and SEQ ID NO.6. A batch of superior maize germplasm with different tasseling stages was screened through haplotype analysis of ZmZP1, ZmHSP70-10, and ZmMHF1. This invention has significant implications for the breeding and production of specialty maize.
[0098] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.
[0099] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.
Claims
1. Genes regulating pollen shedding period during maize flowering stage ZmHSP70-10 The application of SNPs in maize genetic breeding is characterized by, Referring to the B73RefGen_V4 genome, the SNP specifically occurs at 42620638bp on chromosome 5. This site has two haplotypes, ranging from TT to GT. Materials carrying the TT haplotype can shorten the pollen shedding time, while materials carrying the GT haplotype can prolong the pollen shedding time.
2. The application according to claim 1, characterized in that, Used for regulating the pollen shedding period of corn in the Huang-Huai-Hai region.