STR molecular marker for identifying rapid growth type litopenaeus vannamei and application of STR molecular marker

Abstract

The invention provides an STR molecular marker for identifying rapid growth type litopenaeus vannamei and application of the STR molecular marker. A nucleotide sequence of the STR molecular marker is shown as SEQ ID No.1, and the STR molecular marker is located in a 287126 region of a litopenaeus vannamei genome NW020870315.1; the hybrid genotype litopenaeus vannamei with the AGAT unit repeated for 6 times and the AGAT repeated for 7 times of the STR molecular marker is the rapid growth type litopenaeus vannamei. The STR molecular marker is obviously associated with the growth traits of the litopenaeus vannamei, and the repetition times of the STR molecular marker are obviously and positively associated with the growth phenotype of the litopenaeus vannamei, that is, the growth of the litopenaeus vannamei with a high copy number is faster, and the STR molecular marker [AGAT] n can be used for selecting individuals growing rapidly from the molecular level, so that the breeding efficiency of the litopenaeus vannamei is improved, and the breeding cost of the litopenaeus vannamei is reduced. The method is not limited by the growth stage, and can be used for early selection, so that the selection accuracy and efficiency are improved, and the breeding process of the growth speed is accelerated.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular markers of aquatic animals, and particularly relates to a STR molecular marker for identifying fast-growing Litopenaeus vannamei and application thereof. BACKGROUND

[0002] Litopenaeus vannamei is the highest economic value of aquaculture species in the world. China's shrimp farming industry still relies heavily on imports in terms of seed supply, and more than 70% of seed shrimp relies on international companies such as Thailand Charoen Pokphand and Top Peak. International companies such as Charoen Pokphand control the seed source of fast-growing "fast" breeds, especially the "BOLT" strain launched by Charoen Pokphand, which has a daily weight gain of 0.4 grams. In comparison, domestic newly bred varieties are usually 0.2-0.3 grams per day. Therefore, the selection of growth traits has become the key economic trait that is most concerned in the genetic improvement of Litopenaeus vannamei.

[0003] Selection breeding technology centered on large-scale family selection and quantitative genetics has been widely used in Litopenaeus vannamei breeding. Through this technology, the growth performance of fast-growing strains has been significantly improved. However, compared with livestock species and crops, the genetic improvement of shrimp still faces challenges such as slow selection progress and low efficiency. One of the key reasons is that traditional breeding mainly relies on phenotypes and family data, and the selection accuracy and reliability of this method still need to be further improved. By combining high-throughput genomic information, screening molecular markers significantly associated with growth traits, and accurately locating key genes and biological pathways, the application of molecular marker-assisted selection (MAS) technology can significantly improve the accuracy and efficiency of breeding, thereby accelerating the genetic improvement process.

[0004] Currently, molecular markers have been applied in the identification of genetic relationships and population genetic background analysis, but their potential in actual breeding has not been fully explored. A more efficient way is to screen molecular markers closely associated with target traits and use these markers to genotype breeding populations, and to achieve precise selection of superior individuals through screening of target alleles or genotypes. Although some studies have screened SNP sites that may be associated with Litopenaeus vannamei body weight through genome-wide association analysis (GWAS), the selected markers are relatively limited in effect and quantity, and the understanding of growth trait-related mutations is still insufficient.

[0005] Litopenaeus vannamei is one of the species with the highest content of short tandem repeats (STR), which accounts for about 26% of the total length of the genome. In recent years, STR has also shown importance in analyzing complex traits such as human growth, and it has been proved that the number of copies of the relevant markers is directly related to human height traits. Therefore, screening high-quality STR molecular markers that can be used for fast growth selection of Litopenaeus vannamei is of great significance for improving breeding efficiency and promoting genetic improvement of the species. SUMMARY

[0006] The purpose of the present application is to provide a STR molecular marker for identifying fast-growing Litopenaeus vannamei and its application, which is used for efficient assisted selection of fast-growing traits of Litopenaeus vannamei.

[0007] To achieve the above-mentioned purpose of the application, the following technical solutions are adopted:

[0008] The present application provides a STR molecular marker for identifying fast-growing Litopenaeus vannamei, and the nucleotide sequence of the STR molecular marker is shown as SEQ ID No. 1.

[0009] Further, the starting position of the STR molecular marker is located at the physical position of 287126 of Litopenaeus vannamei genome NW_020870315.1.

[0010] Further, the nucleotide sequence of the STR molecular marker starts to repeat at position 101, and the repeat unit is AGAT.

[0011] Further, the genotype of the repeat unit is (AGAT)6 / (AGAT)7.

[0012] Further, the genotype of the repeat unit is a heterozygous genotype.

[0013] The present application also provides the application of the STR molecular marker in screening fast-growing Litopenaeus vannamei varieties.

[0014] Further, the application specifically includes the following steps:

[0015] (1) Extracting the genomic DNA of the Litopenaeus vannamei to be tested;

[0016] (2) Detecting the STR molecular marker site of the Litopenaeus vannamei genome to be tested to obtain the copy number genotype of the site in each individual;

[0017] (3) Based on the copy number genotype, the copy number alleles of the STR molecular marker of the white shrimp are screened as the heterozygous genotype of AGAT repeating 6 times and AGAT repeating 7 times, that is, the fast-growing white shrimp.

[0018] Further, the step of detecting in the step (2) comprises:

[0019] S1: align the sequencing data of the white shrimp to be tested with the reference genome to generate a BAM file;

[0020] S2: analyze the short tandem repeat marker site using HipSTR software to generate a genotyping VCF file containing the relative copy number of each sample short tandem repeat marker;

[0021] S3: locate the molecular marker in the VCF file according to the genomic coordinates NW_020870315.1:287126 to obtain the copy number genotype of the AGAT repeat unit in the STR molecular marker at each individual with NW_020870315.1:287126 as the starting position.

[0022] Further, the genotype detection utilizes the Huada T7 platform to obtain white shrimp genome resequencing data, and BWA-mem software is used to align the genome sequencing data, and then HipSTR software is used to detect and identify the short tandem repeat marker.

[0023] The application also provides the use of the STR molecular marker in genetic improvement and kinship identification of white shrimp.

[0024] Compared with the prior art, the application has the following advantages and technical effects:

[0025] 1. The application provides an STR molecular marker, wherein the starting position of the STR molecular marker is located at the physical position 287126 of the white shrimp genome NW_020870315.1, the nucleotide sequence of the STR molecular marker is shown as SEQ ID No. 1, there is an AGAT tandem repeat site at the 101st base, and AGAT is the repeat unit. The STR molecular marker is not only significantly associated with the growth trait of white shrimp, but also significantly positively correlated with the growth phenotype of white shrimp, that is, the growth of the shrimp with high copy number of the STR molecular marker is faster. Therefore, the STR molecular marker can be used to select fast-growing individuals at the molecular level, which is not limited by the growth stage, can be selected at an early stage, improves the accuracy and efficiency of selection, speeds up the breeding process of growth speed, and has a wide market application prospect.

[0026] 2. The STR molecular marker provided by the application can be used for early prediction of fast-growing individual white shrimp Litopenaeus vannamei, and can also be used for identification of fast-growing trait white shrimp Litopenaeus vannamei strain and genetic improvement of white shrimp Litopenaeus vannamei.

[0027] 3. The application of the STR molecular marker in screening fast-growing white shrimp Litopenaeus vannamei, by the method of high-throughput sequencing, genome alignment and short tandem repeat marker identification, detecting whether the molecular marker at the physical position of 287126 of NW_020870315.1 of the white shrimp Litopenaeus vannamei genome has polymorphism and detecting the genotype, based on the detected genotype, screening the white shrimp Litopenaeus vannamei with heterozygous genotype of AGAT unit repeat 6 times and AGAT repeat 7 times in the copy number of the STR molecular marker, i.e. fast-growing white shrimp Litopenaeus vannamei. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 The Manhattan plot is for GWAS analysis of the STR molecular marker.

[0029] Figure 2 The violin plot is for the STR molecular marker in the correction of body weight of individuals with different copy number genotypes in the cross-population verification population.

[0030] Figure 3 The violin plot is for the STR molecular marker in the correction of body weight of individuals with different copy number genotypes in the cross-population verification population. DETAILED DESCRIPTION

[0031] The technical solutions of the application are further explained in detail in combination with the drawings and specific embodiments.

[0032] Example 1: Screening of short tandem repeat sequences associated with growth traits

[0033] 1. Construction of marker screening population and trait test

[0034] The family materials used in the application are from Shandong Weifang Bangpu Aquaculture Technology Co., Ltd. A total of 1,440 white shrimp Litopenaeus vannamei from 40 families were collected, all hatched in May 2022. Each family was independently raised before marking, individual identification was performed using visible implant elastomer tags (VIE) at the time of marking, and the initial body weight was recorded. 36 shrimps of each family were evenly divided into three groups (12 shrimps in each group), and then randomly allocated to 40 net cages (60 cm x 80 cm; 0.17 cubic meters of water body per cage). This design ensures that each net cage contains shrimps from three different families, and any two families coexist only once in all net cages. The harvest body weight was measured 55 days after marking.

[0035] 2. High-throughput sequencing and identification of short tandem repeat markers

[0036] From the above 40 families, 9 individuals were randomly retained from each family, a total of 360 shrimps were obtained for genome resequencing, and the samples were evenly distributed in gender. The muscle tissue of the first abdominal segment of each individual was collected for DNA extraction. Library construction and sequencing were performed on the BGI T7 platform according to the official guidelines. The obtained sequencing data were subjected to quality control using TrimGalore software, and high-quality data were obtained.

[0037] Based on the obtained high-quality sequencing data, the high-throughput short tandem repeat marker identification process has the following brief steps: based on the reference genome of Litopenaeus vannamei, first, the short tandem repeat marker coordinate file is established. Then the filtered sequencing data are aligned to the reference genome using bwa software to generate a BAM file. Subsequently, HipSTR is used to analyze the short tandem repeat marker sites, and the parameters include: --bams specifies the input BAM file, --fasta specifies the reference genome file, --regions corresponds to the short tandem repeat marker coordinate file, and --str-vcf generates the output VCF file. This method realizes the analysis of target short tandem repeat marker sites, and finally generates a genotyping VCF file containing the relative copy number of each sample short tandem repeat marker.

[0038] Subsequently, the identified short tandem repeat markers were filtered, and the filtering conditions were as follows: i) posterior probability less than 90%; ii) more than 15% of reads with flank indels; iii) more than 15% of reads with stutter artifacts. Finally, 360 individuals with complete phenotypes and 37,366 short tandem repeat marker sites with minimum allele frequency greater than 0.05 and site deletion rate less than 5% were screened out for downstream GWAS analysis.

[0039] 3. GWAS association analysis

[0040] The R package rMVP was used for whole-genome short tandem repeat marker-based association analysis. The mixed linear model is as follows:

[0041]

[0042] wherein, is the corrected harvest weight vector of the th individual, is the genotype dosage of the individual at the marker site , is its corresponding effect size, and and represent the th covariate (including the intercept term and the first three principal components) and its fixed effect coefficient, respectively. representing individuals of random polygenic effects, subject to multivariate normal distribution wherein is the additive genetic variance, is the kinship matrix representing genetic correlation between individuals, and the residual term is independently subject to normal distribution .

[0043] 4. Screening of short tandem repeat sequence loci associated with growth traits

[0044] According to the P value of GWAS analysis, a locus NW_020870315.1:287126 significantly associated with individual body weight was finally screened out, the starting locus of which is located at position 287126 on NW_020870315.1, and the repeat unit is AGAT unit repeat starting from the 101st position of the starting position, and the significance P value of which with body weight at the whole genome level is 4.92E-04.

[0045] The nucleotide sequence of the STR molecular marker associated with the growth rapidity trait is specifically shown in SEQ ID No. 1, and the starting position is located at position 287126 on NW_020870315.1. The Manhattan plot of GWAS analysis is shown in Figure 1 , that is, there is a tandem repeat locus of AGAT starting from the 101st base of the STR molecular marker sequence, the repeat unit is AGAT, and the genotype of the repeat unit is (AGAT)6 / (AGAT)7.

[0046] Example 2: Identification of the screened short tandem repeat sequence STR molecular marker

[0047] 1. Verification of individual selection and short tandem repeat marker identification

[0048] 297 tails of prawns were selected from the test family for identification of the STR molecular marker, and the test pool, water volume and other rearing conditions were the same as in Example 1. After measuring the body weight traits of all the surviving individuals, the sample was cut into muscle tissue pieces and fixed in 95% ethanol, and stored at -20℃. Sequencing was performed using the DNBSEQ-T7 sequencing platform, followed by detection of the genotype of the NW_020870315.1:287126 locus.

[0049] The specific detection steps are as follows: (1) Align the sequencing data to the reference genome using bwa software to generate a BAM file; (2) Analyze the short tandem repeat marker sites using HipSTR to generate a genotyping VCF file containing the relative copy number of the short tandem repeat markers for each sample; (3) Locate the molecular markers in the VCF file according to the genomic coordinates NW_020870315.1:287126 to obtain the copy number genotype of the repeat units in the STR molecular markers starting from the NW_020870315.1:287126 site in each individual.

[0050] 2. Correlation analysis

[0051] This invention performed Pearson correlation analysis on the NW_020870315.1:287126 locus and the corrected harvest weight. The corrected harvest weight was calculated using the following formula:

[0052]

[0053] in, It is the first Adjusted phenotype of individual weight gain It is the first Estimated breeding value for each individual, It is the first Random effects of individual net cages It is the first The residual values ​​for each individual. These values ​​are obtained through the following model:

[0054]

[0055] in, No. In the gender category The weight gained by each individual; It is the population mean; No. The fixation effect of sex (male or female); It is nested in gender Next Linear covariates of initial body weight (IBW) for each family; It is the first The random additive genetic effects of an individual are subject to... ,in It is a genome relation matrix. It is additive genetic variance; It is a random effect of the k-th net cage, following a distribution. , It is the identity matrix. Variance due to the cage effect; is the random residual effect of the jth individual, with where is the residual variance.

[0056] 3. Growth association verification of the STR marker

[0057] The STR molecular marker with the starting site of NW_020870315.1:287126 has a range of 6 to 7 in the number of repeat units AGAT in the verification population. The average corrected body weight of the individual with the genotype of (AGAT)6 / (AGAT)6 of the repeat unit is 16.40 g, and the average body weight of the individual with the marker genotype of (AGAT)6 / (AGAT)7 is 17.8 g. The body weight of the population with high copy number is significantly higher than that of the population with low copy number (p < 0.001) (as shown in Figure 2 ).

[0058] Example 3: Application of the STR molecular marker in breeding fast-growing varieties of white shrimp

[0059] The steps of screening fast-growing varieties of white shrimp using the molecular marker are as follows:

[0060] 1. Select 162 white shrimps from aquaculture companies in Zhanjiang, Guangdong, as a cross-population verification population.

[0061] 2. Extract the genomic DNA of the white shrimps to be tested;

[0062] 3. Detect the repeat unit AGAT copy number polymorphism in the STR molecular marker (nucleotide sequence as shown in SEQ ID No. 1) of the white shrimps to be tested with the starting site of NW_020870315.1:287126 physical position.

[0063] SEQ ID No. 1:

[0064] acatctatctgtctatctcctatccacctatctaactatcaatctcccatccatctaaccactttgtttatgtttactcttacacatatcaagaaccaaa[(agat)n]acacagggcgagagagggagggagggagaagcaggcgctgagacacatcaaggaaggcgtatatgaaaatagctaaaattaagaaactttacaaagaaagtttagcctc

[0065] The specific steps are as follows: (1) aligning the sequencing data to the reference genome using bwa software to generate a BAM file; (2) using HipSTR to analyze short tandem repeat marker sites to generate a genotyping VCF file containing the relative copy number of each sample short tandem repeat marker; (3) locating the molecular marker in the VCF file according to the genomic coordinates NW_020870315.1:287126 to obtain the copy number genotype of the repeat unit in the STR molecular marker at each individual with the NW_020870315.1:287126 site as the starting site.

[0066] 4. For the copy number genotype result, the genotype of the repeat unit in the STR molecular marker of the Marsupenaeus vannamei is (AGAT)6 / (AGAT)7, which is a fast-growing Marsupenaeus vannamei (as shown in the figure). Figure 3

[0067] The above examples are only used to illustrate the technical solutions of the present application, but not to limit it; although the present application has been described in detail with reference to the foregoing examples, the technical solutions recorded in the foregoing examples can still be modified or some technical features can be replaced by equivalents for ordinary skilled in the art; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions claimed by the present application.​

Claims

1. A STR molecular marker for identifying fast-growing type of white shrimp Penaeus vannamei, characterized in that, The nucleotide sequence of the STR molecular marker is shown as SEQ ID No.

1.

2. The STR molecular marker of claim 1, wherein, The starting position of the STR molecular marker is located at the physical position of 287126 of the Litopenaeus vannamei genome NW_020870315.

1.

3. The STR molecular marker of claim 1, wherein, The nucleotide sequence of the STR molecular marker starts to repeat at position 101, and the repeat unit is AGAT.

4. The STR molecular marker of claim 3, wherein, The genotype of the repeat unit is (AGAT)6 / (AGAT)7.

5. The STR molecular marker of claim 4, wherein, The genotype of the repeat unit is a heterozygous genotype.

6. The STR molecular marker of any one of claims 1-5 for use in screening fast-growing Litopenaeus vannamei varieties.

7. Use according to claim 6, characterized in that, The application specifically comprises the following steps: (1) extracting the genomic DNA of the Litopenaeus vannamei to be tested; (2) detecting the STR molecular marker site of the Litopenaeus vannamei genome to be tested as claimed in claim 1, obtaining the copy number genotype of the AGAT repeat unit in the STR molecular marker of each individual; (3) based on the copy number genotype, screening the Litopenaeus vannamei with a heterozygous genotype of 6 AGAT units and 7 AGAT repeats of the STR molecular marker, i.e. fast-growing Litopenaeus vannamei.

8. Use according to claim 7, characterized in that, The detection step in step (2) comprises: S1: aligning the sequencing data of the Litopenaeus vannamei to be tested with the reference genome to generate a BAM file; S2: using HipSTR software to analyze the short tandem repeat marker site to generate a genotyping VCF file containing the relative copy number of each sample short tandem repeat marker; S3: locating the molecular marker in the VCF file according to the genomic coordinates NW_020870315.1:287126, obtaining the copy number genotype of the AGAT repeat unit in the STR molecular marker of each individual with the physical position NW_020870315.1:287126 as the starting position.

9. The STR molecular marker of any one of claims 1-5 for use in genetic improvement and kinship identification of Litopenaeus vannamei.

Images