Rapid detection kit and detection method for vibrio parahaemolyticus based on one-tube method RPA-CRISPR / Cas12a

Abstract

The invention relates to a rapid vibrio parahaemolyticus detection kit based on a one-tube method RPA-CRISPR / Cas12a and a detection method of the rapid vibrio parahaemolyticus detection kit. A specific RPA (recombinase polymerase amplification) primer and CRISPR crRNA (clustered regularly interspaced short palindromic repeats) are designed by taking a ToxR gene of vibrio parahaemolyticus as According to the established one-tube method RPA-CRISPR / Cas12a detection system, the risk of aerosol pollution caused by a cover opening process is effectively avoided. The method disclosed by the invention is high in specificity, and has no cross reaction with related vibrios such as vibrio vulnificus, vibrio alginolyticus, vibrio cholerae, vibrio harveyi and vibrio anguillarum, and other aquatic pathogenic bacteria such as pseudomonas aeruginosa and pseudomonas plecoglossicida; the sensitivity is high, and the lowest detection limit of genome DNA is as low as 1 pg / mu L; the detection is rapid, and the whole process of nucleic acid amplification and fluorescence detection only needs about 30 minutes. The kit and the method do not need complex instruments and equipment, are simple to operate, are suitable for on-site rapid detection of aquatic product samples in a base layer, and have important application values in early screening, epidemiological investigation and comprehensive prevention and control of vibrio parahaemolyticus.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and more particularly relates to a rapid detection kit and method for Vibrio parahaemolyticus based on a tube method RPA-CRISPR / Cas12a. BACKGROUND

[0002] Vibrio parahaemolyticus is a common halophilic gram-negative pathogenic bacterium, widely exists in various aquatic products, including fish, shellfish and shrimp, and is one of the main pathogenic bacteria causing bacterial food poisoning related to aquatic products. As an important foodborne pathogenic bacterium, Vibrio parahaemolyticus infection can cause gastrointestinal diseases such as diarrhea, nausea, vomiting, abdominal cramps and headache in humans, and can cause septicemia and even fatal diseases in severe cases, posing a serious threat to human health. In aquaculture, Vibrio parahaemolyticus can also cause acute or severe gastrointestinal infection in aquatic animals, causing huge economic losses. Therefore, developing rapid and sensitive detection technology for Vibrio parahaemolyticus is of great importance to realize early diagnosis and effective prevention and control of the pathogen and protect the quality and safety of aquatic products.

[0003] At present, the detection methods for Vibrio parahaemolyticus mainly include traditional microbial culture method and conventional molecular biology method. Among them, the traditional culture and biochemical identification method is considered as the "gold standard" for detecting Vibrio parahaemolyticus, but the operation is complicated, time-consuming and laborious, and usually takes several days to obtain results, which cannot meet the needs of on-site rapid detection. The molecular detection method based on nucleic acid amplification such as polymerase chain reaction (PCR) and its derivative technology (such as real-time fluorescent quantitative PCR) has high sensitivity and specificity, and has been widely used as an alternative method for detecting Vibrio parahaemolyticus. However, this method needs to rely on expensive instruments and equipment, and the detection process usually takes about 1.5-2 hours, which is difficult to popularize in on-site detection in aquaculture. In order to break through the above limitations, constant temperature amplification technologies such as loop-mediated isothermal amplification (LAMP) and recombinase assisted amplification (RAA / RPA) have emerged. These technologies are very suitable for on-site rapid detection due to low instrument dependence and convenient operation, and have been widely used in the screening of various pathogenic bacteria. However, existing studies have shown that the sensitivity of these methods in detecting Vibrio parahaemolyticus still needs to be further optimized and improved.

[0004] In recent years, clustered regularly interspaced short palindromic repeats (CRISPR) and its associated protein (such as Cas12a), referred to as CRISPR-Cas system, as a new nucleic acid isothermal amplification technology, provides a feasible solution for on-site rapid detection. The technology of CRISPR / Cas12a system combined with RAA / RPA has shown advantages such as high sensitivity and strong specificity in nucleic acid rapid detection, and has broad application prospects. At present, this technology has been successfully applied to the detection of various foodborne pathogens, such as Vibrio harveyi, Vibrio vulnificus, Salmonella, Aeromonas hydrophila, Shigella, etc. Most of the existing detection methods based on RAA / RPA and CRISPR / Cas12a still need a "two-step method", that is, first complete the isothermal amplification of RAA / RPA, and then open the cover to transfer the amplification product for CRISPR / Cas12a signal detection. This operation process significantly increases the risk of aerosol pollution, which is easy to cause false positive results, and also increases the complexity of the detection procedure. In order to solve the above problems, physical separation strategies have been used to separate the CRISPR system and the isothermal amplification reaction in space through the "one-pot method", including using the density difference of sucrose concentration, hydrophobic oil phase, and prepositioning Cas12a reagents in the tube cover or sterile syringe. However, the application of "one-pot method" RPA-CRISPR / Cas12a technology in rapid detection of Vibrio parahaemolyticus has not been reported.

[0005] Therefore, in order to improve the detection convenience and break through the limitations of the existing Vibrio parahaemolyticus detection technology, a one-pot RPA-CRISPR / Cas12a-based Vibrio parahaemolyticus rapid detection technology is developed, which has high sensitivity, high specificity and simple operation, which is the key to realize early warning, precise prevention and control of the pathogen and reduce the economic loss of aquaculture industry, and is also the technical problem to be solved in the field at present. SUMMARY

[0006] In view of the above technical problems, the present application provides a one-pot RPA-CRISPR / Cas12a-based Vibrio parahaemolyticus rapid detection kit and detection method, which aims to take a specific gene of Vibrio parahaemolyticus as a target, design highly conserved and specific primers, construct RPA amplification system and CRISPR detection system, and integrate them in the same reaction tube to realize one-step amplification and detection. The kit can quickly start the CRISPR / Cas12a reaction, thereby realizing rapid, sensitive and highly specific detection of Vibrio parahaemolyticus in aquatic products, and avoiding aerosol pollution.

[0007] To achieve the above object, in a first aspect, the present application provides a primer pair for detecting Vibrio parahaemolyticus, the primer pair being a pair of primers for specifically amplifying a specific region of a Vibrio parahaemolyticus ToxR gene, the nucleotide sequence of the specific region of the Vibrio parahaemolyticus ToxR gene being shown as SEQ ID No. 1.

[0008] The nucleotide sequence of the specific region of the Vibrio parahaemolyticus ToxR gene is:

[0009] 5'-AATGAGGTAGAAACAATCGTAGAGCCGTCTTTAGCGACGACTTCTGACGCAATCGTTGAACCAGAAGCGCCAGTAGTACCTGAAAAAGCACCTGTGGCTTCTGCTGTGAATCCTTGGATTCCACGCGTTAT-3' (SEQ ID No. 1).

[0010] The present application takes the highly conserved ToxR gene of Vibrio parahaemolyticus as a detection target to establish a "one-pot" RPA-CRISPR / Cas12a rapid detection technology. The target sequence is selected from a highly conserved and specific region as a marker sequence by ClustalW and other bioinformatics tools for multiple sequence alignment of the published Vibrio parahaemolyticus ToxR gene and the homologous sequences of a variety of common Vibrio, so as to realize efficient and specific amplification of the DNA target gene of the sample, and to provide a key technical basis for the establishment of a rapid and accurate detection method.

[0011] Further, the design and screening process of the present application includes: first, based on the specific marker sequence selected, a plurality of RPA primers are designed; then, the amplification efficiency and specificity thereof are evaluated by a gel electrophoresis system, and the optimal primer pair is selected. The primer pair is composed of an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer being shown as SEQ ID No. 2, and the nucleotide sequence of the downstream primer being shown as SEQ ID No. 3:

[0012] Specifically, the nucleotide sequence of the upstream primer is: 5'- AATGAGGTAGAAACAATCGTAGAGCCGTCT -3' (SEQ ID No. 2);

[0013] The nucleotide sequence of the downstream primer is: 5'-ATAACGCGTGGAATCCAAGGATTCACAGCAGA-3' (SEQ ID No. 3).

[0014] In a second aspect, the present application provides a composition for detecting Vibrio parahaemolyticus, which comprises the primer pair of the first aspect of the present application and a crRNA, wherein the nucleotide sequence of the crRNA is shown as SEQ ID No. 4. Within the target sequence amplified by the primer pair, a PAM recognition site of the CRISPR-Cas12a system is combined with a specific crRNA, thereby constructing an efficient and stable primer and crRNA combined detection system.

[0015] The nucleotide sequence of the crRNA is 5'-UAAUUUCUACUAAGUGUAGAUGCGACGACUUCUGACGCAAUCGU-3' (SEQ ID No. 4).

[0016] Preferably, the composition further comprises a Cas12a protein and a single-stranded DNA reporter molecule.

[0017] More preferably, the Cas12a protein is a subtype LbaCas12a, and the single-stranded DNA reporter molecule is a fluorescent probe 6-FAM-TTTATT-BHQ1.

[0018] In a third aspect, the present application further provides a kit for detecting Vibrio parahaemolyticus by a tube method, which comprises the primer pair of the first aspect of the present application and / or the composition of the second aspect of the present application, and the primer pair or the composition are arranged in the same reaction tube.

[0019] In a fourth aspect, the present application further provides the use of the primer pair of the first aspect of the present application, the composition of the second aspect of the present application and / or the kit of the third aspect of the present application in any one of the following:

[0020] In the preparation of a product for detecting Vibrio parahaemolyticus;

[0021] In the preparation of a product for diagnosing or assisting in diagnosing a disease caused by Vibrio parahaemolyticus infection;

[0022] In the preparation of a product for screening a disease caused by Vibrio parahaemolyticus infection, wherein the primer pair or the composition are arranged in the same reaction tube.

[0023] In a fifth aspect, the present application further provides a method for detecting Vibrio parahaemolyticus, which comprises detecting a sample to be tested by using the primer pair of the first aspect of the present application, the composition of any one of the second aspect of the present application and / or the kit of the third aspect of the present application, and determining whether the sample to be tested contains Vibrio parahaemolyticus or the sample to be tested is Vibrio parahaemolyticus according to the detection result, wherein the purpose of the method is non-disease diagnosis.

[0024] Furthermore, the method includes the following steps:

[0025] S1 extracts DNA from the sample to be tested;

[0026] S2 uses the DNA of the sample to be tested as a template and performs RPA amplification using the primer pair described in the first aspect of the present invention to obtain RPA amplification products;

[0027] S3 Detects the RPA amplification products in the same reaction tube using a CRISPR / Cas12a detection system;

[0028] The RPA amplification system is pre-installed at the bottom of the reaction tube, and the CRISPR / Cas12a detection system is pre-installed inside the reaction tube cap. The CRISPR / Cas12a detection system includes crRNA, Cas12a protein, and single-stranded DNA reporter molecule as described in the second aspect of this invention.

[0029] Furthermore, in the CRISPR / Cas12a detection system, the concentration ratio of the Cas12a protein to the crRNA is 0.5:1 to 2.5:1, preferably 0.5:1, and the concentration ratio of the single-stranded DNA reporter molecule to the Cas12a protein is 1.6:1 to 2.4:1, preferably 2.2:1.

[0030] Unlike existing technologies, the above-mentioned technical solutions provide the following key advantages for the detection primers, compositions, kits, and methods for Vibrio parahaemolyticus:

[0031] (1) High specificity: Using the ToxR gene as the target and combining the dual recognition mechanism of RPA primers and CRISPR crRNA, it has no cross-reaction with common Vibrio species, including Vibrio vulnificus, Vibrio alginolyticus, Vibrio cholerae, Vibrio harveyi, and Vibrio anguillarum, effectively avoiding cross-reaction with other microorganisms.

[0032] (2) High sensitivity: RPA is used for efficient nucleic acid amplification, and the signal is cascaded and amplified by the trans-cleavage activity of CRISPR / Cas12a. The detection limit of bacterial genomic DNA can reach 1 pg / µL.

[0033] (3) Fast and simple: The operation process is extremely simplified. The entire detection process can be completed within 1 hour (generally no more than 30 minutes). The entire process of nucleic acid amplification and detection is completed through a single sealed "one tube method". The operation steps are greatly simplified and the risk of aerosol contamination caused by opening the lid is effectively avoided. No complicated instruments are required, making it particularly suitable for rapid on-site detection.

[0034] (4) Stable and reliable: The key reaction components and concentration ratios have been optimized to ensure the high efficiency and stability of the detection system. The kit format makes it easier to promote and apply.

[0035] In summary, the method of the present invention can rapidly, sensitively, and specifically detect Vibrio parahaemolyticus in aquatic products, which is of great significance for the early diagnosis and effective control of this pathogen.

[0036] The above description of the invention is merely an overview of the technical solution of this application. In order to enable those skilled in the art to better understand the technical solution of this application and to implement it based on the description and drawings, and to make the above-mentioned objectives and other objectives, features and advantages of this application easier to understand, the following description is provided in conjunction with the specific embodiments and drawings of this application. Attached Figure Description

[0037] The accompanying drawings are only used to illustrate the principles, implementation methods, applications, features, and effects of specific embodiments of this application and other related content, and should not be considered as limitations on this application.

[0038] In the accompanying drawings of the instruction manual:

[0039] Figure 1 This is a gene comparison diagram of Vibrio parahaemolyticus and its similar species in Example 1 of the present invention;

[0040] Figure 2 This is an RPA screening electrophoresis image of different primer pairs in Example 1 of the present invention; wherein lane M is DL 2000 DNA marker; 1-6 are, in order: Vibrio parahaemolyticus DNA, Vibrio alginolyticus DNA, Vibrio cholerae DNA, Vibrio anguillarum DNA, Vibrio vulnificus DNA, Vibrio harveyi DNA; 7 is negative control;

[0041] Figure 3 The figure shows the feasibility analysis results of the one-tube RPA-CRISPR / Cas 12a detection method in Embodiment 2 of the present invention; the left side shows the observation results under blue light; the right side shows the observation results under ultraviolet light.

[0042] Figure 4 This is a graph showing the results of crRNA concentration optimization in Example 2 of the present invention; where 1-5 represent crRNA concentrations of 100, 150, 200, 250 and 300 nmol / L, respectively; 6-10 represent the negative controls corresponding to the 5 concentrations, respectively.

[0043] Figure 5This is a graph showing the optimization results of the Cas 12a / crRNA concentration ratio in Example 2 of the present invention; where 1-5 represent five concentration ratios: 0.5:1, 1.0:1, 1.5:1, 2.0:1, and 2.5:1, respectively; and 6-10 represent the negative controls corresponding to the five concentration ratios, respectively.

[0044] Figure 6 This is a graph showing the optimized concentration ratio of FQ probe / Cas 12a in Example 2 of the present invention; where 1-5 represent five concentration ratios: 1.6:1, 1.8:1, 2.0:1, 2.2:1, and 2.4:1, respectively; and 6-10 represent the negative controls corresponding to the five concentration ratios, respectively.

[0045] Figure 7 This is a sensitivity evaluation result diagram from Embodiment 3 of the present invention; where 1-6 represent: 10 1 10 0 10 -1 10 -2 10 -3 and 10 -4 ng / μL of Vibrio parahaemolyticus genomic DNA; 7 is the negative control;

[0046] Figure 8 This is a diagram showing the specificity evaluation results in Example 4 of the present invention; where 1-10 are, in order: genomic DNA of Vibrio parahaemolyticus (ATCC17802), Vibrio parahaemolyticus (HD01), Vibrio alginolyticus (ATCC17749), Vibrio cholerae (BB31), Vibrio anguillarum (ATCC43308), Vibrio vulnificus (ATCC27562), Vibrio harveyi (ATCC14126), Pseudomonas aeruginosa (ATCC27853), Pseudomonas aeruginosa (DGZ5), and Staphylococcus aureus (ATCC25923); 11 is the negative control;

[0047] Figure 9 The graph shows the performance evaluation results of the detection method established in Example 5 of this invention in practical applications; the left side shows the RPA-CRISPR / Cas 12a detection results, and the right side shows the qPCR detection results. Detailed Implementation

[0048] To illustrate the possible application scenarios, technical principles, implementable specific solutions, and achievable objectives and effects of this application in detail, the following description, in conjunction with the listed specific embodiments and accompanying drawings, provides a detailed explanation. The embodiments described herein are merely illustrative of the technical solutions of this application and are therefore intended to limit the scope of protection of this application.

[0049] In this document, the term "embodiment" means that a specific feature, structure, or characteristic described in connection with an embodiment may be included in at least one embodiment of this application. The term "embodiment" appearing in various places throughout the specification does not necessarily refer to the same embodiment, nor does it specifically limit its independence or connection with other embodiments. In principle, in this application, as long as there are no technical contradictions or conflicts, the technical features mentioned in each embodiment can be combined in any way to form corresponding implementable technical solutions.

[0050] Unless otherwise defined, the technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains; the use of related terms herein is merely for the purpose of describing particular embodiments and is not intended to limit this application.

[0051] In the description of this application, the term "and / or" is used to describe the logical relationship between objects, indicating that three relationships can exist. For example, A and / or B means: A exists, B exists, and A and B exist simultaneously. Additionally, the character " / " in this document generally indicates that the preceding and following objects have an "or" logical relationship.

[0052] In this application, terms such as “first” and “second” are used only to distinguish one entity or operation from another, and do not necessarily require or imply any actual quantity, hierarchy or order relationship between these entities or operations.

[0053] Unless otherwise specified, the use of terms such as “comprising,” “including,” “having,” or other similar expressions in this application is intended to cover non-exclusive inclusion, which does not exclude the presence of additional elements in a process, method, or product that includes the stated elements, such that a process, method, or product that includes a list of elements may include not only those defined elements but also other elements not expressly listed, or elements inherent to such a process, method, or product.

[0054] As understood in the Examination Guidelines, in this application, expressions such as "greater than," "less than," and "exceeding" are understood to exclude the stated number; expressions such as "above," "below," and "within" are understood to include the stated number. Furthermore, in the description of the embodiments in this application, "multiple" means two or more (including two), and similar expressions related to "multiple" are also understood in this way, such as "multiple groups" and "multiple times," unless otherwise explicitly specified.

[0055] In the description of the embodiments of this application, the space-related expressions used, such as "center," "longitudinal," "lateral," "length," "width," "thickness," "upper," "lower," "front," "rear," "left," "right," "vertical," "horizontal," "vertical," "top," "bottom," "inner," "outer," "clockwise," "counterclockwise," "axial," "radial," and "circumferential," indicate the orientation or positional relationship based on the orientation or positional relationship shown in the specific embodiments or drawings. They are only for the purpose of describing the specific embodiments of this application or for the reader's understanding, and do not indicate or imply that the device or component referred to must have a specific position, a specific orientation, or be constructed or operated in a specific orientation. Therefore, they should not be construed as limitations on the embodiments of this application.

[0056] Unless otherwise expressly specified or limited, the terms "installation," "connection," "linking," "fixing," and "setting," as used in the description of the embodiments of this application, should be interpreted broadly. For example, "connection" can be a fixed connection, a detachable connection, or an integral setting; it can be a mechanical connection, an electrical connection, or a communication connection; it can be a direct connection or an indirect connection through an intermediate medium; it can be the internal connection of two components or the interaction between two components. For those skilled in the art to which this application pertains, the specific meaning of the above terms in the embodiments of this application can be understood according to the specific circumstances.

[0057] This invention discloses a rapid detection kit and method for Vibrio parahaemolyticus based on a one-tube RPA-CRISPR / Cas12a method. Those skilled in the art can refer to the content of this application and appropriately modify the process parameters to achieve the same result. It should be noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included within the scope of this invention. The method of this invention has been described through optimized embodiments, and those skilled in the art can obviously make modifications or appropriate changes and combinations to the methods described herein without departing from the content, spirit, and scope of this invention to implement and apply the technology of this invention.

[0058] Unless otherwise specified, all materials and reagents used in the specific embodiments of this invention are commercially available. Among them, the bacterial genomic DNA extraction kit (product of Tiangen Biotech (Beijing) Co., Ltd.); the basic DNA isothermal rapid amplification kit (product of Lesun Biotechnology (Wuxi) Co., Ltd.); and the RPA amplification primer pairs, crRNA, and fluorescent probes (synthesized by Sangon Biotech Co., Ltd. (Shanghai)).

[0059] The experimental strains used were Vibrio parahaemolyticus (ATCC17802, HD01), Vibrio vulnificus (ATCC27562), Pseudomonas aeruginosa (ATCC27853), Pseudomonas aeruginosa (DGZ5), and Staphylococcus aureus (ATCC25923), which were provided by the Institute of Agricultural Quality Standards and Testing Technology, Fujian Academy of Agricultural Sciences; Vibrio alginolyticus (ATCC17749), Vibrio cholerae (BB31), Vibrio harveyi (ATCC14126), and Vibrio anguillarum (ATCC43308), which were kindly donated by the Key Laboratory of Aquatic Germplasm Resources Discovery and Utilization, Ministry of Education, Shanghai Ocean University.

[0060] Example 1: Design and screening of primers, crRNA, and fluorescent probes

[0061] 1. Determination of target genes for Vibrio parahaemolyticus detection

[0062] This invention establishes a rapid RPA-CRISPR / Cas12a detection method targeting the highly conserved ToxR gene of Vibrio parahaemolyticus. To ensure high specificity and sensitivity, the target sequence underwent rigorous bioinformatics analysis and screening.

[0063] First, multiple ToxR gene sequences of Vibrio parahaemolyticus were downloaded from the NCBI database, and conserved fragments of the ToxR gene sequences were analyzed using bioinformatics software such as ClustalW. Subsequently, multiple sequence alignment analysis was performed on the ToxR gene of the target Vibrio parahaemolyticus and homologous genes of other non-target Vibrio species (such as Vibrio harveyi, Vibrio anguillarum, and Vibrio alginolyticus).

[0064] By comparison, a highly specific region that is highly conserved in Vibrio parahaemolyticus but significantly different from other non-target Vibrio sequences was identified (see [link]). Figure 1 This region was ultimately identified as the amplification marker sequence for this invention. Its selection aimed to achieve simple, efficient, and specific amplification of the target gene in the DNA of the sample to be tested, providing a reliable basis for the subsequent design of high-performance primers and probes. Figure 1 It is evident that in the comparison of multiple Vibrio sequences, there exists a "hypervariate region" with a significant length and distinct sequence. The target bacterium, Vibrio parahaemolyticus, exhibits a continuous and specific base arrangement in this region, while the corresponding region of non-target Vibrio bacteria, such as Vibrio alginolyticus, shows a large number of base deletions, insertions, or mismatches, resulting in extremely low sequence consistency between the two.

[0065] The key primer design strategy of this invention lies in achieving specific recognition of Vibrio parahaemolyticus by precisely locating the significantly different hypervariable region in the ToxR gene. Three pairs of primers were designed to differentiate between different Vibrio species by comparing their ToxR genes, actively screening for specific primer sites. This design fully utilizes the sequence divergence between target and non-target Vibrio species in this region. Because the primers directly target these discriminative sequences, they can efficiently bind to the unique variations of Vibrio parahaemolyticus while effectively avoiding cross-reactions with the genomes of non-target Vibrio species, thus ensuring the high specificity of the detection method. This design ensures that the amplification product completely covers the core differential region. The target sequence of the crRNA (SEQ ID No. 4) designed in this invention is precisely located in or covers the aforementioned core differential region. This means that the crRNA is completely complementary to the RPA amplification product of the target Vibrio parahaemolyticus, thereby efficiently activating the Cas12a protein; however, for the amplification product of non-target Vibrio, such as Vibrio alginolyticus, due to the large number of sequence mismatches, it cannot effectively guide Cas12a to recognize and cleave.

[0066] 2. Design and synthesis of primers, crRNA, and fluorescent probes

[0067] Specific primers were designed using Primer Premier 5.5 software within the selected specific conserved regions, including three pairs of candidate RPA primers (RPA-F / R) and one pair of qPCR primers (QF / R). The crRNA was designed using the online tool CRISPRRGEN Tools (http: / / www.rgenome.net / ), and its sequence includes a 20-24 bp target-dependent spacer sequence downstream of the PAM motif (5′-TTTN-3′), and an intrinsic scaffold sequence to assist its binding to the Cas protein. The fluorescent probe FQ is a short single-stranded DNA molecule labeled with a FAM fluorescent group at its 5' end and a BHQ1 quencher group at its 3' end. All primers, crRNAs, and probes were synthesized by Sangon Biotech Co., Ltd. (Shanghai). Preferred primer and probe sequences for this invention are shown in Table 1.

[0068] Table 1 Primer, crRNA, and fluorescent probe sequences

[0069] 3. Screening of RPA reaction primers

[0070] To select the optimal primer pair from three candidate RPA pairs, this example uses a basic DNA isothermal amplification kit for RPA detection. The total RPA amplification volume was 50 µL: 25 µL reaction buffer, 2 µL upstream and downstream primers (10 μmol / L), 2 µL template DNA, and 16 µL nuclease-free water. Finally, 3 µL magnesium acetate solution (initiator) was added, and the mixture was thoroughly mixed and incubated at 37°C for 20 min. After the reaction, the amplification products were purified by phenol-chloroform extraction with an equal volume. The supernatant was then subjected to 1.5% gel electrophoresis to screen for the primer pair with the highest amplification efficiency and best specificity.

[0071] The results are as follows Figure 2 As shown, all three designed RPA primer pairs could amplify the target fragment, but their amplification efficiency and specificity differed significantly. While primer pairs RPA-F1 / R1 and RPA-F2 / R2 amplified bands with high brightness, non-specific amplification occurred in both *Vibrio alginolyticus* and *Vibrio cholerae*, indicating insufficient specificity and unsuitability for subsequent method construction. Primer pair RPA-F3 / R3 not only amplified a clear and bright single target band at 131 bp but also effectively amplified only in *Vibrio parahaemolyticus*, showing no non-specific amplification in other Vibrio species. These results demonstrate that primer pair RPA-F3 / R3 possesses good amplification efficiency and high specificity, thus identifying it as the optimal RPA primer pair for *Vibrio parahaemolyticus* detection in this invention.

[0072] Example 2: Establishment and optimization of a one-tube RPA-CRISPR / Cas 12a detection method

[0073] 1. Establishment and validation of the RPA-CRISPR / Cas 12a reaction system

[0074] This embodiment aims to establish and validate a complete and feasible one-tube RPA-CRISPR / Cas 12a reaction system. The system uses the optimal primer pair RPA-F3 / R3 and the crRNA designed for it, as selected in Example 1.

[0075] After preparing the RPA amplification system and the CRISPR / Cas12a detection system, respectively, the two systems were distributed in different positions within the same reaction tube: the RPA system was placed at the bottom of the tube, and the CRISPR system was placed inside the cap, with a total reaction volume of 15 μL. The RPA reaction was performed according to the DNA isothermal amplification kit instructions. Each 10 μL RPA reaction system contained: 5.0 μL reaction buffer, 0.2 μL upstream and downstream primers (10 µmol / L), 0.4 μL template DNA, 3.6 μL nuclease-free water, and 0.6 μL magnesium acetate (initiator). The 5 μL CRISPR / Cas12a reaction system contained: 1.5 μL 10×Cas12a Buffer, 0.45 μL crRNA (10 μmol / L), 0.3 μL Cas12a protein (5 μmol / L), 1.5 μL fluorescent probe (10 μmol / L), and 1.25 μL nuclease-free water. After RPA amplification was incubated at 37°C for 20 minutes, the CRISPR system was injected into the tube cap by centrifugation, and the reaction was continued at 37°C for another 30 minutes. After the reaction, the fluorescence signal intensity was read using a real-time PCR instrument, and the fluorescence was observed visually using ultraviolet light or blue light to determine the result.

[0076] The results are as follows Figure 3 The results showed that the one-tube RPA-CRISPR / Cas 12a detection method containing Vibrio parahaemolyticus genomic DNA emitted a visible fluorescence signal under ultraviolet light, and a green fluorescence signal was also observed under a blue light spectrometer. Conversely, the one-tube RPA-CRISPR / Cas 12a detection method without Vibrio parahaemolyticus genomic DNA did not show any fluorescence visible to the naked eye under ultraviolet light, and no green fluorescence signal was observed under a blue light spectrometer. These results demonstrate the feasibility of the one-tube RPA-CRISPR / Cas 12a detection system established in this invention.

[0077] 2. Determination of optimal reaction conditions for RPA-CRISPR / Cas 12a

[0078] Optimization of crRNA concentration: To obtain the best detection results, the crRNA concentration was optimized. Five crRNA concentrations of 100, 150, 200, 250, and 300 nmol / L were used for RPA-CRISPR / Cas 12a reactions. The results are as follows: Figure 4The results showed that the fluorescence signals of all five treatment groups were significantly higher than those of the corresponding control groups (P<0.0001). The fluorescence signal of the control group remained at a low level throughout the amplification process, without a significant upward trend. When the crRNA concentration was 100 nmol / L and 150 nmol / L, the amplification curve rose fastest, producing an amplification curve earlier than other crRNA concentrations. The endpoint fluorescence values ​​of both groups also reached relatively high levels with no significant difference; however, as the crRNA concentration continued to increase, the fluorescence signal decreased. Combined with the blue light spectrometer observation results, the liquids in tubes 1-5 (corresponding to the treatment groups with different crRNA concentrations) all showed visible fluorescence signals with high intensity, indicating that the target DNA was effectively detected; the liquids in tubes 6-10 (corresponding to the negative controls at each concentration) showed no obvious fluorescence signal. Considering both fluorescence intensity and cost factors, 100 nmol / L was selected as the optimal crRNA concentration for this invention.

[0079] Optimization of the Cas 12a / crRNA concentration ratio: To optimize detection performance and cost-effectiveness, the Cas 12a / crRNA concentration ratio was further screened. With the crRNA concentration fixed at 100 nmol / L, five concentration ratios (0.5:1, 1.0:1, 1.5:1, 2.0:1, and 2.5:1) were tested. The results are as follows: Figure 5 The results showed that the fluorescence signal of the system generally weakened with increasing Cas 12a / crRNA ratio, but the differences between ratios were not significant. The highest fluorescence signals were obtained when the ratio was 0.5:1 and 1.5:1. Combined with observations using a blue light analyzer, the liquids in tubes 1-5 all showed visible fluorescence signals, while the liquids in tubes 6-10 showed no obvious fluorescence signal. Considering reagent cost, the optimal Cas 12a / crRNA ratio was determined to be 0.5:1, i.e., a Cas 12a concentration of 50 nmol / L.

[0080] Optimization of the FQ probe / Cas 12a concentration ratio: To comprehensively improve detection performance, the FQ probe / Cas12a concentration ratio was further screened. With a fixed crRNA concentration of 100 nmol / L and a Cas 12a concentration of 50 nmol / L, five concentration ratios (1.6:1, 1.8:1, 2.0:1, 2.2:1, and 2.4:1) were tested. The results are as follows: Figure 6The results showed that the fluorescence signal gradually increased with the increase of the FQ probe / Cas 12a ratio. At ratios of 2.4:1 and 2.2:1, there was no significant difference in fluorescence signal intensity, and both reached saturation within approximately 10 minutes of detection. The entire detection process, including RPA pre-amplification, took no more than 30 minutes. Combined with blue light analysis, the liquids in tubes 1-5 showed visible fluorescence signals, while the liquids in tubes 6-10 showed no obvious fluorescence signal. Considering both fluorescence intensity and reagent conservation, the optimal FQ probe / Cas 12a ratio was ultimately selected as 2.2:1, corresponding to a probe concentration of 110 nmol / L.

[0081] 3. Final optimization conditions

[0082] In summary, the optimal reaction conditions for the one-tube RPA-CRISPR / Cas 12a detection method established in this invention were determined to be: a final crRNA concentration of 100 nmol / L. The Cas 12a / crRNA concentration ratio was 0.5:1, and the FQ probe / Cas12a concentration ratio was 2.2:1.

[0083] Example 3 Sensitivity evaluation of the one-tube RPA-CRISPR / Cas 12a detection method

[0084] To evaluate the analytical sensitivity of the RPA-CRISPR / Cas12a method established in this invention, this embodiment uses serially diluted Vibrio parahaemolyticus genomic DNA for sensitivity detection. First, the extracted genomic DNA was accurately quantified using a micro-spectrophotometer, followed by 10-fold serial dilutions to prepare concentrations of 10... 1 10 0 10 -1 10 -2 10 -3 and 10 -4 A series of templates at ng / μL were used. Under the optimal reaction conditions determined in Example 2, sterile ultrapure water was used as a negative control for detection. The results were collected and analyzed using a quantitative real-time PCR instrument and a blue light spectrometer, respectively.

[0085] The results are as follows Figure 7 The display shows a concentration of 10. 1 10 0 10 -1 10 -2 and 10 -3 Genomic DNA samples at concentrations of ng / μL all produced significant fluorescence signals. The fluorescence signal gradually weakened as the genomic DNA concentration decreased. When the genomic DNA concentration dropped to 10 ng / μL... -3At a concentration of ng / μL, fluorescence can still be observed with the naked eye; while at a concentration of 10... -4 The genomic DNA sample containing ng / μL produced a very low fluorescence signal, with no significant difference compared to the negative control. Therefore, the detection sensitivity of the RPA-CRISPR / Cas 12a method established in this invention was determined to be 10. -3 The assay can detect picogram-level trace targets (1 pg / μL) of Vibrio parahaemolyticus nucleic acid. These results demonstrate that the detection method established in this invention possesses excellent detection accuracy and sensitivity at the molecular level, making it suitable for rapid screening of early-stage infections or samples with low pathogen loads, and providing a reliable technical means for the early diagnosis of Vibrio parahaemolyticus.

[0086] Example 4: Specificity evaluation of the one-tube RPA-CRISPR / Cas 12a detection method

[0087] To systematically evaluate the specificity of the detection method established in this invention, this embodiment selected several Vibrio species closely related to Vibrio parahaemolyticus (including Vibrio vulnificus, Vibrio alginolyticus, Vibrio cholerae, Vibrio harveyi, and Vibrio anguillarum) and other common aquatic pathogens (including Pseudomonas aeruginosa and Pseudomonas aeruginosa) as non-target controls, and included Staphylococcus aureus as a representative Gram-positive bacterium. Genomic DNA of the above strains was extracted for cross-reactivity testing, with sterile ultrapure water used as a negative control to comprehensively evaluate the specificity of this method for detecting Vibrio parahaemolyticus. To ensure the accuracy of the comparison, the concentration of all pathogen DNA templates was uniformly calibrated to 10 ng / μL. RPA-CRISPR / Cas 12a detection was performed under the optimal reaction conditions determined in Example 2, with quantitative detection using a real-time PCR instrument and visual interpretation using a blue light analyzer.

[0088] The results are as follows Figure 8 The results showed that, except for two strains of Vibrio parahaemolyticus that exhibited positive amplification curves, the other eight strains did not show amplification curves, and the negative control group also showed no amplification curves. The fluorescence signals of the two Vibrio parahaemolyticus strains were significantly higher than those of the negative control group, while the fluorescence signals of the other eight strains showed no significant difference from the negative control group. Combined with the results of blue light analysis, the liquids in tubes 1 and 2 showed visible fluorescence signals, while the liquids in the other groups showed no obvious fluorescence signals. These results strongly demonstrate that the primer and probe combination designed in this invention can specifically recognize the target genes of Vibrio parahaemolyticus and has no cross-reactivity with the genomic DNA of the selected test strains, indicating that the RPA-CRISPR / Cas 12a method established in this invention has extremely high specificity for the detection of Vibrio parahaemolyticus.

[0089] Example 5 Application Test

[0090] To evaluate the performance of the detection method established in this invention in practical applications, fish samples simulating Vibrio parahaemolyticus infection were used as the subject. The reliability of the detection system was verified by comparing it with conventional qPCR methods. Vibrio parahaemolyticus cultures were serially diluted 10-fold and inoculated onto 3% sodium chloride alkaline peptone water medium, with three plates for each concentration. The plates were incubated at 36±1℃ for 24-48 hours. Colony counting was performed on each concentration plate to determine the original bacterial concentration as 1.5 × 10⁻⁶. 9 CFU / mL.

[0091] Fish samples free of Vibrio parahaemolyticus preserved in our laboratory were used as the additive matrix and pulverized into fish paste. 25 g of the fish paste sample was placed in a sterile homogenizing bag, and 225 mL of sterile 3% sodium chloride alkaline peptone water was added. The mixture was homogenized using a beater for 2 min to prepare a 1:10 fish paste homogenate solution. The original bacterial solution was then serially diluted 10-fold to 1.5 × 10⁻⁶. 3 1.5×10 2 1.5×10 1 1.5×10 0 and 1.5×10 -1 CFU / mL. Mix 1 mL of the bacterial culture at each of the above concentrations with 9 mL of fish paste homogenate. Prepare three parallel samples for each concentration, and then incubate for 5 h for bacterial growth. After bacterial growth, take 1 mL of sample from each concentration gradient and extract total DNA from each sample using a bacterial genomic DNA extraction kit. Store at -20℃ for later use.

[0092] The extracted total DNA was analyzed in parallel using both the RPA-CRISPR / Cas 12a method and the qPCR method (conventional methods in the art) of this invention, under their respective optimized reaction conditions. The results are as follows: Figure 9 The results show that the detection limit for Vibrio parahaemolyticus using the RPA-CRISPR / Cas12a method of the present invention is 10. 0 The RPA-CRISPR / Cas12a detection method, with a concentration of 1.5 CFU / mL, can stably detect the pathogen in fish tissue contaminated with Vibrio parahaemolyticus, consistent with the results obtained by the qPCR method. This demonstrates that the RPA-CRISPR / Cas12a detection method established in this invention exhibits excellent sensitivity comparable to traditional qPCR methods in detecting artificially contaminated samples, proving its practical value for rapid screening at the grassroots level.

[0093] In summary, the applicant designed primers and probes based on the highly conserved ToxR gene specific site of Vibrio parahaemolyticus and optimized the detection method, resulting in a simple, rapid, specific, and sensitive one-tube detection system and method for Vibrio parahaemolyticus RPA-CRISPR / Cas12a. Compared to the traditional two-step method, this method completes the entire process of nucleic acid amplification and detection within a single sealed reaction tube, effectively avoiding the risk of aerosol contamination caused by opening the tube, while significantly simplifying the operation process. The detection time is short, with the entire detection process, including RPA pre-amplification, taking no more than 30 minutes; the detection sensitivity is high, with a detection limit of 1 pg / µL for bacterial genomic DNA; and the detection specificity is high, showing no cross-reactivity with common Vibrio species, including Vibrio vulnificus, Vibrio alginolyticus, Vibrio cholerae, Vibrio harveyi, and Vibrio anguillarum.

[0094] Therefore, the method of the present invention can rapidly, sensitively, and specifically detect Vibrio parahaemolyticus in aquatic products, which is of great significance for the early diagnosis and effective prevention and control of this pathogen.

[0095] Finally, it should be noted that although the above embodiments have been described in the text and drawings of this application, this should not limit the scope of patent protection of this application. Any technical solutions that are based on the essential concept of this application and utilize the content described in the text and drawings of this application, resulting in equivalent structural or procedural substitutions or modifications, as well as the direct or indirect application of the technical solutions of the above embodiments to other related technical fields, are all included within the scope of patent protection of this application.

Claims

1. A primer pair for detecting Vibrio parahaemolyticus, characterized in that, The primer pair is a pair of primers that specifically amplify a specific region of the Vibrio parahaemolyticus ToxR gene, and the nucleotide sequence of the specific region of the Vibrio parahaemolyticus ToxR gene is shown in SEQ ID No.

1.

2. The primer pair according to claim 1, characterized in that, The primer pair consists of an upstream primer and a downstream primer, the nucleotide sequence of which is shown in SEQ ID No. 2 and the nucleotide sequence of which is shown in SEQ ID No.

3.

3. A composition for detecting Vibrio parahaemolyticus, characterized in that, The composition comprises the primer pair and crRNA as described in claim 1 or 2, wherein the nucleotide sequence of the crRNA is shown in SEQ ID No.

4.

4. The composition according to claim 3, characterized in that, The composition also includes the Cas12a protein and a single-stranded DNA reporter molecule.

5. The composition according to claim 4, characterized in that, The Cas12a protein is the LbaCas12a subtype, and the single-stranded DNA reporter molecule is the fluorescent probe 6-FAM-TTTATT-BHQ1.

6. A kit for the one-tube method of detecting Vibrio parahaemolyticus, characterized in that, The primer pair comprising the primer pair of claim 1 or 2, and / or the composition comprising any one of claims 3-5, wherein the primer pair or the composition is disposed in the same reaction tube.

7. The use of the primer pair as described in claim 1 or 2, the composition as described in any one of claims 3-5, and / or the kit as described in claim 6 in any of the following: Application in the preparation of products for the detection of Vibrio parahaemolyticus; Application in the preparation of products for the diagnosis or auxiliary diagnosis of diseases caused by Vibrio parahaemolyticus infection; Application in the preparation of products for screening diseases caused by Vibrio parahaemolyticus infection; Its features are, The primer pair or the composition is disposed in the same reaction tube.

8. A method for detecting Vibrio parahaemolyticus, characterized in that, The method includes detecting the sample to be tested using the primer pair of claim 1 or 2, the composition of any one of claims 3-5, and / or the kit of claim 6, and determining whether the sample to be tested contains Vibrio parahaemolyticus or whether the sample to be tested is Vibrio parahaemolyticus based on the detection results.

9. The method according to claim 8, characterized in that, The method includes the following steps: S1 extracts DNA from the sample to be tested; S2 uses the DNA of the sample to be tested as a template and performs RPA amplification using the primer pair described in claim 1 or 2 to obtain the RPA amplification product; S3 Detects the RPA amplification products in the same reaction tube using a CRISPR / Cas12a detection system; The RPA amplification system is pre-installed at the bottom of the reaction tube, and the CRISPR / Cas12a detection system is pre-installed inside the reaction tube cap. The CRISPR / Cas12a detection system includes the crRNA described in claim 3, the Cas12a protein described in claim 4, and a single-stranded DNA reporter molecule.

10. The method according to claim 9, characterized in that, In the CRISPR / Cas12a detection system, the concentration ratio of the Cas12a protein to the crRNA is 0.5:1 to 2.5:1, preferably 0.5:1, and the concentration ratio of the single-stranded DNA reporter molecule to the Cas12a protein is 1.6:1 to 2.4:1, preferably 2.2:1.

Images