Hydroxyl cholesterol 27HC and application thereof

Abstract

The invention provides an application of 27-hydroxycholesterol or pharmaceutically acceptable salt or ester thereof in preparation of a medicine for preventing and / or treating and / or relieving diseases and / or symptoms caused by enterovirus infection, and application of 27-hydroxycholesterol or pharmaceutically acceptable salt or ester thereof in preparation of a medicine for preventing and / or treating and / or relieving diseases and / or symptoms caused by enterovirus infection. And a method for non-therapeutic purposes of inhibiting enteroviruses in cells with at least one of 27-hydroxycholesterol or a pharmaceutically acceptable salt or ester thereof; the invention also provides an administration route and dosage form suitable for the medicament, other active ingredients which can be contained in the medicament, and a combination of the medicament and other medicaments.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology and chemistry, in particular, the present application relates to the use of hydroxycholesterol 27HC for the preparation of a drug against enterovirus. BACKGROUND

[0002] Enterovirus is classified in the family Picornaviridae, which is a group of single-stranded positive-sense RNA viruses with similar biological characteristics, no envelope, and a genome of about 7.2-8.4 kb. Enterovirus invades the upper respiratory tract, throat, and intestine as the portal of entry, initially proliferates in the local mucosa and pharynx, tonsil, and intestinal lymph nodes, and then is released into the blood to form the first viremia, spreads to the target tissues with receptors, and proliferates again to cause the second viremia and clinical symptoms. The receptors of most enteroviruses are widely distributed in tissues and cells, including the nervous system, heart, lung, pancreas, mucosa, skin, and other systems, so their disease range is wide.

[0003] Human enterovirus includes poliovirus, coxsackievirus, ECHO virus, and new enterovirus, with at least 72 serotypes. Among them, enterovirus type 71 (Enterovirus A71, EV71) is one of the main pathogens of hand-foot-mouth disease. The main population of hand-foot-mouth disease is infants under the age of 5, and the clinical manifestations are fever, sore throat, small red spots, blisters, and even ulcers on the skin and mucosa of the hands, feet, mouth, and other parts, and severe EV71 infection patients usually have digestive system symptoms such as nausea, vomiting, abdominal pain, and diarrhea, accompanied by central nervous system complications, including acute flaccid myelitis, encephalitis, meningitis, brainstem encephalitis, myelitis, poliomyelitis-like syndrome, aseptic meningitis, and various neurological diseases and complications such as neurogenic pulmonary edema, pulmonary hemorrhage, respiratory tract infection, cardiovascular damage, myocarditis, a small number of EV71 infection patients also have intestinal bleeding caused by central nervous system disorders, mild liver function abnormalities related to autonomic nervous disorders and inflammatory reactions, and multiple organ failure.

[0004] EV71 poses a great threat to human health, especially to infants and young children. To date, the pathogenic mechanism of EV71 is not fully understood, and effective prevention and control measures are still limited. Recently, the world's first EV71 inactivated vaccine (human diploid cells) has been approved for production. This vaccine was independently developed by the Institute of Medical Biology, Chinese Academy of Medical Sciences (see Chinese patent CN 101402944 B). Clinical trial results show that the protection rate of this vaccine against hand, foot and mouth disease caused by EV71 can reach 97.3%, which is of great significance for effectively reducing the incidence of hand, foot and mouth disease in children in China, especially reducing the severe and fatal cases of the disease, and protecting the life and health of children. However, the next question is whether the control of hand, foot and mouth disease can be achieved solely by relying on vaccines. For example, the history of polio prevention and control, before 2000, the global eradication of polio was achieved through large-scale vaccination, but in recent years, polio is still prevalent in many countries and regions. Therefore, the control of enterovirus not only requires effective vaccines, but also the assistance of antiviral drugs is crucial.

[0005] Currently, broad-spectrum antiviral drugs and Chinese herbal medicines and traditional Chinese medicines with heat-clearing and detoxifying effects are commonly used in clinical treatment of hand, foot and mouth disease, and there is still a lack of more targeted drugs for enterovirus, especially EV71 virus.

[0006] 27-hydroxycholesterol (27HC), with a chemical formula of C 27 H 46 O2, a molecular weight of 402.65, a CAS number of 20380-11-4, and a structural formula of:

[0007]

[0008] 27HC is a selective estrogen receptor modulator and a liver X receptor agonist. Sterol 27-hydroxylase encoded by the CYP27A1 gene can catalyze the generation of 27-hydroxycholesterol from cholesterol. In the field of viral biology, it has been reported that 27HC can inhibit the replication and transmission of Marek's disease virus (MDV); 27HC interferes with the circulation of cholesterol between the endoplasmic reticulum and the late endosome, thereby inhibiting the replication of human rotavirus (HRV); 27HC can also inhibit the replication of non-enveloped viruses such as human papillomavirus-16 (HPV-16) and human rhinovirus (HRV). However, there is currently no report on the use of 27-hydroxycholesterol to resist enterovirus, especially EV71. SUMMARY

[0009] The inventors have found that 27-hydroxycholesterol can effectively inhibit the replication of EV71. Meanwhile, the inventors have also proved that 27-hydroxycholesterol can also inhibit the replication of other members of Enterovirus genus (such as CVB2, PV and EV68). The inventors have disclosed that 27-hydroxycholesterol is expected to be used for preparing a new type of anti-Enterovirus drug.

[0010] The present application provides the use of 27-hydroxycholesterol or a pharmaceutically acceptable salt or ester thereof in the preparation of a medicament for preventing and / or treating and / or alleviating the diseases and / or symptoms caused by Enterovirus infection.

[0011] The present application also provides a non-therapeutic purpose method for inhibiting Enterovirus in cells by using at least one of 27-hydroxycholesterol or a pharmaceutically acceptable salt or ester thereof.

[0012] In addition, the present application also provides the administration route, dosage form suitable for the medicament, other active ingredients that can be contained in the medicament, and the combination of the medicament with other drugs. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 1 The results of the influence of different concentrations of 27HC on the replication of EV71 virus are shown. Figure 1 A shows the transcription level of EV71 mRNA detected by fluorescent quantitative PCR under different concentrations of 27HC. Figure 1 B shows the expression of EV71 structural protein detected by western blot under different concentrations of 27HC.

[0014] Figure 2 The results of the influence of different concentrations of 27HC on the replication of CVB2, PV and EV68 virus are shown. Figure 2 A shows the transcription level of CVB2 mRNA detected by fluorescent quantitative PCR under different concentrations of 27HC. Figure 2 B shows the transcription level of PV mRNA detected by fluorescent quantitative PCR under different concentrations of 27HC. Figure 2 C shows the transcription level of EV68 mRNA detected by fluorescent quantitative PCR under different concentrations of 27HC. DETAILED DESCRIPTION

[0015] The present application provides the use of 27-hydroxycholesterol or a pharmaceutically acceptable salt or ester thereof in the preparation of a medicament for preventing and / or treating and / or alleviating the diseases and / or symptoms caused by Enterovirus infection.

[0016] In the present application, "pharmaceutically acceptable salt" refers to the relatively non-toxic salt of 27-hydroxycholesterol, which includes all possible pharmaceutically acceptable salts of 27-hydroxycholesterol.

[0017] In a particular embodiment of the application, the pharmaceutically acceptable salt comprises a single salt of 27-hydroxycholesterol, or any mixture of said salts in any proportion.

[0018] In a particular embodiment of the application, the pharmaceutically acceptable salt comprises, but is not limited to: an alkali metal salt of 27-hydroxycholesterol, such as a sodium or potassium salt; an alkaline earth metal salt, such as a calcium or magnesium salt; an ammonium salt or a salt with an organic base that provides a physiologically acceptable cation, such as a salt with glucosamine, N-methyl-glucosamine, dimethyl-glucosamine, ethyl-glucosamine, hexamethylene diamine, ethanolamine, sarcosine, lysine, tris-hydroxymethylaminomethane, amino-dipropylol; or a quaternary ammonium salt, for example a salt with tetramethylammonium, tetraethylammonium.

[0019] In the present application, the term "pharmaceutically acceptable ester" means all possible pharmaceutically acceptable esters of 27-hydroxycholesterol which are hydrolyzed in the human or animal body.

[0020] In a particular embodiment of the application, the pharmaceutically acceptable ester comprises a single ester of 27-hydroxycholesterol, or any mixture of said esters in any proportion.

[0021] In a particular embodiment of the application, the pharmaceutically acceptable ester comprises, but is not limited to: an ester of 27-hydroxycholesterol with a carboxylic acid, for example formic acid, acetic acid, tert-butyl acid, palmitic acid, stearic acid, benzoic acid, phenylacetic acid; with a sulfonic acid, for example methanesulfonic acid, ethanesulfonic acid, ethanedisulfonic acid, benzenesulfonic acid; with an amino acid, for example valine, leucine, isoleucine; and with an inorganic acid, for example phosphoric acid, sulfuric acid, sulfurous acid.

[0022] Furthermore, the present application comprises all possible prodrugs of 27-hydroxycholesterol.

[0023] In the present application, the term "prodrug" comprises pharmaceutically acceptable derivatives of 27-hydroxycholesterol which can be biologically active or biologically inactive themselves, but which are converted (for example by metabolism or hydrolysis) into 27-hydroxycholesterol during their residence in the body. An example of a prodrug is an ester or phosphate of 27-hydroxycholesterol. In the present application, the term "prodrug" also comprises covalently bound forms of the active ingredient with any carrier which release the active ingredient in the body.

[0024] Furthermore, the present application also comprises all possible metabolites of 27-hydroxycholesterol.

[0025] It is understood that one skilled in the art can make numerous modifications to the structure of 27-hydroxycholesterol during or after synthesis without affecting its antiviral activity against enterovirus, for example, substituting one or more hydrogen atoms on 27-hydroxycholesterol with the same or different halogen, C1-C6-alkyl, C1-C6-alkoxy, C1-C6-alkylthio, C1-C6-alkylsulfinyl, C1-C6-alkylsulfonyl, C1-C6-alkylamino, C1-C6-dialkylamino, C1-C6-alkylcarbonyl, C1-C6-alkoxycarbonyl, C1-C6-alkylaminocarbonyl, C1-C6-dialkylaminocarbonyl, C1-C6-alkylsulfonyl, C1-C6-alkylsulfinyl, cycloalkyl, hydroxyl, ester, amino, acyl, sulfonyl, sulfinyl, and the like, and further, conjugating 27-hydroxycholesterol with substances commonly used in the art for conjugation to improve the stability, half-life, and the like of the compound. It is contemplated that all modifications that do not significantly affect the antiviral activity of 27-hydroxycholesterol against enterovirus will fall within the scope of the present application. 3-8 - cycloalkyl, hydroxyl, ester, amino, acyl, sulfonyl, sulfinyl, and the like, and further, conjugating 27-hydroxycholesterol with substances commonly used in the art for conjugation to improve the stability, half-life, and the like of the compound. It is contemplated that all modifications that do not significantly affect the antiviral activity of 27-hydroxycholesterol against enterovirus will fall within the scope of the present application.

[0026] In the present application, the term "halogen" refers to fluorine, chlorine, bromine, or iodine.

[0027] In the present application, the term "C1-C6-alkyl" refers to straight chain or branched alkyl groups having 1-6 carbon atoms, including but not limited to: methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, t-butyl, pentyl, isopentyl, hexyl, 2-methylbutyl, 1-methylbutyl, 1-ethylpropyl, 1,2-dimethylpropyl, neopentyl, 1,1-dimethylpropyl, 4-methylpentyl, 3-methylpentyl, 2-methylpentyl, 1-methylpentyl, 2-ethylbutyl, 1-ethylbutyl, 3,3-dimethylbutyl, 2,2-dimethylbutyl, 1,1-dimethylbutyl, 2,3-dimethylbutyl, 1,3-dimethylbutyl, or 1,2-dimethylbutyl.

[0028] In the present application, the term "C 3-8 - cycloalkyl" refers to cycloalkyl groups having 3-8 carbon atoms, including but not limited to cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and cycloheptyl.

[0029] In one specific embodiment of the present application, the disease includes but is not limited to hand, foot and mouth disease, acute flaccid myelitis, encephalitis, meningitis, brainstem encephalitis, myelencephalitis, poliomyelitis-like syndrome, aseptic meningitis.

[0030] In one preferred embodiment, the disease is hand, foot and mouth disease.

[0031] In one specific embodiment of the present application, the symptoms include but are not limited to fever, sore throat, small red spots, blisters and / or ulcers on the skin and / or mucous membranes of the hands, feet and / or mouth, and digestive system symptoms including nausea, vomiting, abdominal pain, diarrhea, and neurogenic pulmonary edema, pulmonary hemorrhage, respiratory tract infection, cardiovascular injury, myocarditis, intestinal hemorrhage, liver dysfunction, and multiple organ failure.

[0032] In a preferred embodiment, the symptoms include, but are not limited to, fever, sore throat, small red spots, blisters and / or ulcers on the skin and / or mucous membranes of the hands, feet and / or oral cavity.

[0033] In the present application, the term "enterovirus" refers to a virus belonging to the genus Enterovirus of the family Picornaviridae.

[0034] In a particular embodiment of the present application, the enterovirus includes the group A, B, C, D enterovirus.

[0035] In a preferred embodiment, the enterovirus includes the enterovirus type 68 (EV 68), the enterovirus type 71 (EV 71), the coxsackievirus B group 2 type (CVB2), the poliovirus (PV).

[0036] In a more preferred embodiment, the enterovirus includes the enterovirus type 68 (EV 68), the enterovirus type 71 (EV 71).

[0037] In a further preferred embodiment, the enterovirus is the enterovirus type 71.

[0038] In a particular embodiment of the present application, the medicament is for the treatment of mammals and avians.

[0039] In a preferred embodiment, the medicament is for the treatment of humans, bovines and swines.

[0040] In a more preferred embodiment, the medicament is for the treatment of humans.

[0041] In a particularly preferred embodiment, the medicament is for the treatment of children under 16 years of age.

[0042] In a very particularly preferred embodiment, the medicament is for the treatment of children under 5 years of age.

[0043] In another very particularly preferred embodiment, the medicament is for the treatment of infants under 3 years of age.

[0044] In a particular embodiment of the present application, the medicament comprises at least one of 27-hydroxycholesterol or a salt or ester thereof as active ingredient.

[0045] In a preferred embodiment, the medicament comprises a therapeutically effective amount of active ingredient.

[0046] In the present application, the term "therapeutically effective amount" refers to the amount of the active ingredient contained which is effective to achieve the desired therapeutic response and is not toxic to the subject being treated. For example, "therapeutically effective amount" refers to the amount sufficient to prevent and / or treat and / or alleviate the disease and / or disorder caused by enterovirus in the subject, without causing substantial cytotoxicity in the subject. The therapeutically effective amount of the active ingredient depends on the physical condition of the particular subject, the severity of the disease and / or the symptoms, the interaction with the concurrent treatment, and the like.

[0047] In a specific embodiment of the present application, the medicament further comprises other active ingredients.

[0048] In a preferred embodiment, the other active ingredients are selected from one or more of the following: antiviral agents, antibacterial agents, analgesics, antipyretics, anti-inflammatory agents, anesthetics, and the like.

[0049] In a preferred embodiment, the medicament comprises a therapeutically effective amount of the active ingredients.

[0050] In a preferred embodiment, the active ingredients of the medicament are or are not chemically bound, fused, conjugated, or fused.

[0051] In a specific embodiment of the present application, the medicament further comprises inert, non-toxic pharmaceutically acceptable excipients.

[0052] In the present application, "pharmaceutically acceptable excipients" refer to excipients that are relatively non-toxic and harmless, and any side effects caused by the excipients do not impair the beneficial effects of the active ingredients. The excipients are combined with the active ingredients to convert the active ingredients into the desired dosage form by means known in the art.

[0053] In a specific embodiment of the present application, the medicament is formulated as immediate-release, sustained-release, and time-release dosage forms.

[0054] In a specific embodiment of the present application, the medicament is administered orally, parenterally, topically, ophthalmically, buccally, sublingually, or rectally, and the like.

[0055] According to the desired route of administration, the medicament can be formulated into a suitable dosage form according to methods known in the art.

[0056] In a preferred embodiment, the medicament is administered orally, and is formulated as a solid or liquid preparation such as a capsule, a pill, a tablet, a lozenge, a troche, a melt, a powder, a solution, a suspension, or an emulsion.

[0057] In another preferred embodiment, the medicament is administered parenterally as an injection dosage form via a subcutaneous, intravenous, intraocular, intra-synovial, intramuscular, or intraperitoneal route.

[0058] In another preferred embodiment, the controlled release formulation for parenteral administration includes liposomes, polymeric microspheres and polymeric gel formulations known in the art.

[0059] In another preferred embodiment, the medicament is formulated as an ointment, transdermal patch or inhalant for topical administration.

[0060] One skilled in the art will recognize that in preparing the medicament of the present application, it can be formulated into the desired dosage form using excipients conventionally used in the art, including but not limited to: carriers, excipients, solvents, diluents, surfactants, thickening agents, flavoring agents, preservatives, buffers, dispersing agents, wetting agents, emulsifying agents, suspending agents, disintegrating agents, viscosity increasing agents, adsorbents, coloring agents, antioxidants, oils, fatty acids, fatty acid esters, soaps, detergents, clarifying agents, encapsulating agents, ointment bases, chelating agents, sweeteners, retention agents, aerosol propellants, air displacers, binding materials, penetration enhancers, plasticizers, hardening agents, tablet anti-sticking or polishing agents (see, e.g., Remington's Pharmaceutical Sciences, E. W. Martin, Mack Publishing, Easton, PA, 19th Edition (1995)). th th

[0061] In a particular embodiment of the present application, the medicament is included in a kit.

[0062] In a preferred embodiment, the kit further comprises a label and / or instructions indicating the therapeutic purpose and / or the therapeutic manner of the medicament.

[0063] In a particular embodiment of the present application, the medicament is administered as a single medicament or in combination with other medicaments.

[0064] The combination does not cause unacceptable side effects.

[0065] In a preferred embodiment, the other medicaments include other medicaments capable of preventing and / or treating and / or alleviating the disease or symptoms caused by enterovirus infection.

[0066] In a preferred embodiment, the other medicaments include, but are not limited to, antiviral agents, immunomodulators, anti-infective agents, antipyretic analgesic agents, vaccines, Chinese herbal medicines, Chinese patent medicines, probiotics, vitamins, trace elements, cholesterol-lowering agents.

[0067] In a more preferred embodiment of the present application, the other drugs include, but are not limited to, EV71 inactivated vaccine, EV71 attenuated vaccine, gamma globulin, recombinant human interferon, recombinant human interleukin-2, acyclovir, ganciclovir, ribavirin, chlortetracycline ointment, moroxydine hydrochloride, amoxicillin, acetaminophen, montmorillonite powder, cetirizine lozenge, cod liver oil, isatis root, Bingpeng powder, Shuanghuanglian injection, watermelon cream spray, Qingkailing, Pudilan, vitamin B2, vitamin C.

[0068] In a preferred embodiment of the present application, the combination administration can be simultaneous administration or sequential administration.

[0069] The required administration dose, administration sequence and administration frequency of the drug of the present application when administered alone or in combination with other drugs can be determined by routine therapeutic tests by those skilled in the art.

[0070] The present application also provides a method for non-therapeutic purposes of inhibiting an enterovirus in a cell with at least one of 27-hydroxycholesterol or a pharmaceutically acceptable salt or ester thereof.

[0071] Wherein the provisions for 27-hydroxycholesterol and its pharmaceutically acceptable salts and esters and enterovirus are as described above.

[0072] In a specific embodiment of the present application, the inhibition includes inhibition of replication of the enterovirus or cytopathic effect caused by the enterovirus.

[0073] In a specific embodiment of the present application, the cell is a human cell.

[0074] In a preferred embodiment of the present application, the cell is a human rhabdomyosarcoma cell.

[0075] The present application also provides a set of primer sequences for fluorescent quantitative PCR, the forward primer is as shown in SEQ ID NO: 1, and the reverse primer is as shown in SEQ ID NO: 2.

[0076] It should be understood that the specific, preferred, more preferred, particularly preferred, very particularly preferred groups of embodiments described above can be combined in any combination.

[0077] Hereinafter, the embodiments of the present application are exemplarily described by examples and in conjunction with the accompanying drawings, and the following examples are for explanation, rather than limiting the present application in any way.

[0078] Example

[0079] Unless otherwise specified, the reagents used in the examples are all conventional commercially available reagents, and the detection methods used in the examples are all detection methods known to those skilled in the art.

[0080] Example 1, Effect of 27HC on EV71 virus replication

[0081] RD cells were added with different concentrations (0.12 μΜ, 0.37 μΜ, 1.11 μΜ, 3.33 μΜ and 10 μΜ) of 27HC, cultured at 37°C, 5% CO2 for 1 h, then added with 0.2 MOI (multiplicity of infection) EV71, and continued to culture for 24 h before harvesting the cells, extracting total RNA, and detecting the mRNA level of EV71 by fluorescence quantitative PCR after reverse transcription, and detecting the expression level of the structural protein of EV71 virus by western blot, the specific steps are shown as follows.

[0082] EV71 virus is Anhui strain (FJ439769.1) isolated and preserved by the laboratory; human rhabdomyosarcoma cell RD (CCL-136) is purchased from ATCC (American type culture collection); BCA protein quantification kit (23225) is purchased from Thermo company (USA); SupRealQ Ultra Hunter SYBR qPCR MasterMix (Q713-02) is purchased from Nanjing Novozyme Bio-tech Co., Ltd.; RNase-free water is purchased from Solabio company (USA); reverse transcriptase HiScript IV All-in-One Ultra RT SuperMix for qPCR (R433-01) is purchased from Nanjing Novozyme Bio-tech Co., Ltd.; mouse anti-EV71 structural protein (MAB979) is purchased from Millipore (USA); mouse anti-β-actin monoclonal antibody (A5441) is purchased from Sigma company (USA); 5x passive lysis buffer is purchased from Promega company (USA).

[0083] 1.1 Amplification of EV71 virus

[0084] Take EV71 virus 30 μl and 2% FBS (fetal bovine serum, Corning, USA, 35-081-CV) DMEM medium (Gibco, USA, C11965500) mixed inoculation in 80%-90% abundance (cell fraction per unit area, that is, the cell stretching density in the culture plate reaches 80-90% of the total culture plate bottom area) RD cells (T75 culture bottle), 37°C, 5% CO2 incubation, daily observation of cytopathic effect. Until 80%-90% of the RD cytopathic effect (cytopathic effect is the intercellular space becomes large, the cell becomes large and round), collect the cytopathic cell precipitate and supernatant, freeze-thaw 3 times at -80°C, 12000 rpm centrifugation for 10 min to remove cell debris, and the supernatant containing virus is divided and stored at -80°C for standby.

[0085] 1.2 27HC treatment of RD cells

[0086] Another 80%-90% abundance of RD cells were added with 0.12 μM, 0.37 μM, 1.11 μM, 3.33 μM and 10 μM of 27HC (prepared with ethanol), respectively, at 37°C for 1h under 5% CO2 culture.

[0087] 1.3 Virus infection method

[0088] Take EV71 virus and 2% FBS DMEM medium mixed inoculation in 1.2 27HC treated 80%-90% abundance of RD cells (virus inoculation amount is 0.2 MOI EV71), 37°C, 5% CO2 incubation for 24h.

[0089] 1.4 Fluorescence quantitative PCR:

[0090] (1) Cell total RNA extraction:

[0091] Discard the culture medium in the culture dish, add 1 ml Trizol (Thermo, USA, 15596018CN), room temperature for 10 min; add 200 μl chloroform, shake vigorously for 15 s, then room temperature for 3 min, and let it separate naturally; 4°C, 12,000g centrifugation for 15 min, carefully transfer the supernatant to a new Eppendorf tube (Axygen, USA, MCT-150-C), add equal volume of isopropanol, mix well, then ice for 10 min; 4°C, 12,000g centrifugation for 10 min, carefully discard the supernatant; add 1 ml 75% ethanol (prepared with RNase-free water) to the RNA precipitate, gently suspend the precipitate; 4°C, 7,500g centrifugation for 5 min, carefully discard the supernatant, and dry the precipitate at room temperature; add 50 μl enzyme-free water (Solebo, R1600) to the precipitate, room temperature for 10 min to dissolve the RNA, and then pass through the American After the concentration was determined by spectrophotometer (model ND-1000), the sample was aliquoted and stored at -80℃ for later use.

[0092] (2) Reverse transcription reaction (RT):

[0093] Take 2 μg of RNA and dilute it with RNase-free ddH2O to a total volume of 15 μL as template RNA, and prepare the following mixture in an RNase-free centrifuge tube:

[0094] 4x All-in-One Ultra qRT SuperMix 5 μL

[0095] Template RNA 2 μg

[0096] RNase-free ddH2O to 20 μl

[0097] Mix gently with a pipette.

[0098] Reaction procedure

[0099] 50℃ 5min

[0100] 85℃ 5sec

[0101] Harvest the cDNA obtained by reverse transcription as the template for the fluorescence quantitative PCR reaction.

[0102] (3) Fluorescence quantitative PCR:

[0103] Prepare the PCR reaction system as follows:

[0104]

[0105] PCR amplification procedure: 95℃ 3min; 95℃ 5s, 55℃ 15s, 60℃ 30s + Plate Read, a total of 45 cycles; 95℃, 10s; melting curve 65℃-95℃, 5s increment + Plate Read.

[0106] Forward primer Primer 1: ACATGCACACGAGTCTATTGAGCT, SEQ ID NO: 1.

[0107] Reverse primer Primer 2: ACACGGACATTTGGGGTAGTTACTTCCGC, SEQ ID NO: 2.

[0108] (4) The amplification process and fluorescence signal detection, data storage and analysis are all performed by the fluorescence quantitative PCR instrument (Bio-Rad, USA, CFX TMThe calculation was performed using the Optics Module and its built-in software. The Ct value of each sample's quantitative PCR was subtracted from the corresponding sample's GAPDH Ct value. The fold change in sample amplification was calculated using a 2-1... ^ΔCt Law.

[0109] The results of quantitative real-time PCR detection of EV71 mRNA transcription levels at different concentrations of 27HC are shown in [reference]. Figure 1 A. The results showed that 27HC could effectively inhibit the replication of EV71 virus, and the inhibitory effect on EV71 virus was enhanced with the increase of 27HC concentration.

[0110] 1.5 Western blot

[0111] (1) Cells treated with different concentrations of 27HC in 1.3 were infected with EV71 for 24 h, and then the cells were harvested. Each cell was 1.5 × 10⁻⁶ cells long. 6 Add 100 μl of 1× passive lysis buffer (prepared from 5× passive lysis buffer purchased from Promega, USA: 1 volume of 5× passive lysis buffer plus 4 volumes of water, mix well before use) to each cell, mix gently, and lyse at room temperature for 30 min; centrifuge at 12000g for 10 min, collect the supernatant, and quantify the protein concentration of the cell lysis buffer using the BCA protein quantification method (see BCA protein quantification kit instructions). Adjust the protein concentration of each sample to be consistent (2 μg / μl), add 6× loading buffer (300 mM Tris-HCl (pH 6.8), 600 mM dithiothreitol, 12% (w / v) SDS, 0.6% (w / v) bromophenol blue, 60% (v / v) glycerol) to prepare protein samples, heat at 100℃ for 5 min for denaturation, and then store at -20℃;

[0112] (2) The protein samples were separated by 12% polyacrylamide gel electrophoresis (SDS-PAGE), and then the proteins were transferred to a nitrocellulose (NC) membrane by constant current at 400mA.

[0113] (3) After the transfer was completed, the NC membrane was blocked with 5% skim milk / PBST (PBS 0.1% Tween 20) at room temperature for 2 h, and then incubated overnight at 4°C with mouse anti-EV71 structural protein primary antibody (catalog number MAB979, Millipore, USA) dilution buffer (5% skim milk diluted 1:1000). Then, it was washed three times with 1‰ Tween PBST for 5 min each time, and anti-mouse IgG Dy800 secondary antibody (catalog number 926-32212, Li-COR, USA) dilution buffer (5% skim milk diluted 1:10000) at room temperature in the dark for 30 min. Then, it was washed three times with 1‰ Tween PBST for 10 min each time. Finally, it was scanned and identified using Odyssey (two-color infrared laser imaging system, Li-COR, USA).

[0114] For the expression of EV71 structural proteins detected by Western blot at different concentrations of 27HC, please refer to [reference needed]. Figure 1 B. The results showed that the amounts of EV71 structural proteins VP0 and VP2 gradually decreased with increasing 27HC concentration.

[0115] The results above show that 27HC has an inhibitory effect on EV71.

[0116] Example 2: Effects of different concentrations of 27HC on the replication of CVB2, PV and EV68 viruses

[0117] The effects of different concentrations of 27HC on the replication of CVB2, PV and EV68 viruses were investigated according to the steps in Example 1, with the only difference being that the RD cell infection with 0.2 MOI EV71 in Example 1 was replaced with 0.2 MOI CVB2, 0.1 MOI IPV and 0.5 MOI EV68, respectively.

[0118] The transcriptional levels of CVB2, PV, and EV68 mRNA detected by real-time PCR at different concentrations of 27HC are shown in the figures below. Figure 2 A, 2B, and 2C. The results showed that 27HC could effectively inhibit the replication of CVB2, PV, and EV68 viruses, and the inhibitory effect on CVB2, PV, and EV68 viruses was enhanced with increasing 27HC concentration.

[0119] The results above show that, in addition to EV71, 27HC also has an inhibitory effect on the replication of other members of the Enterovirus genus, CVB2, PV and EV68.

[0120] The above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art will recognize that any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are included within the scope of the present invention.

[0121] Furthermore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In case of any conflict, the definitions included in this specification shall prevail. All publications, patent applications, patents, and other references mentioned herein, and all publications, patent applications, patents, and references cited herein, are incorporated herein by reference in their entirety.

Claims

1. Use of 27-hydroxycholesterol or a pharmaceutically acceptable salt or ester thereof in the manufacture of a medicament for preventing and / or treating and / or alleviating a disease and / or symptoms caused by an enterovirus infection.

2. The use of claim 1, wherein the disease comprises hand-foot-mouth disease, acute flaccid myelitis, encephalitis, meningitis, brainstem encephalitis, myelencephalitis, poliomyelitis-like syndrome, aseptic meningitis; preferably, the disease is hand-foot-mouth disease.

3. The use of claim 1, wherein the symptoms comprise fever, sore throat, small red spots, blisters and / or ulcers on the skin and / or mucosa of the hands, feet and / or oral cavity, digestive system symptoms including nausea, vomiting, abdominal pain, diarrhea, and neurogenic pulmonary edema, pulmonary hemorrhage, respiratory tract infection, cardiovascular injury, myocarditis, intestinal hemorrhage, liver dysfunction, and multiple organ failure; preferably, the symptoms comprise fever, sore throat, small red spots, blisters and / or ulcers on the skin and / or mucosa of the hands, feet and / or oral cavity.

4. The use of claim 1, wherein the enterovirus comprises enterovirus A, B, C, D groups; preferably, the enterovirus comprises enterovirus type 68, enterovirus type 71, coxsackievirus B group type 2, poliovirus; more preferably, the enterovirus comprises enterovirus type 68 and enterovirus type 71; further preferably, the enterovirus is enterovirus type 71.

5. The use of claim 1, wherein the medicament is for treating mammals and avians; preferably, the medicament is for treating humans, bovines and porcines; more preferably, the medicament is for treating humans; particularly preferably, the medicament is for treating children under 16 years old; very particularly preferably, the medicament is for treating children under 5 years old; or, the medicament is for treating infants under 3 years old.

6. The use of any one of claims 1-5, wherein the medicament comprises at least one of 25-hydroxycholesterol or a salt or ester thereof as an active ingredient; or, the medicament further comprises other active ingredients; preferably, the other active ingredients are selected from one or more of antiviral agents, antibacterial agents, analgesics, antipyretics, anti-inflammatory agents, anesthetics, etc.

7. The use of any one of claims 1-5, wherein the medicament further comprises inert, non-toxic pharmaceutically acceptable excipients.

8. The use of any one of claims 1-5, wherein the medicament is administered orally, parenterally, topically, ophthalmically, buccally, sublingually or rectally, etc.; preferably, the medicament is formulated as a solid or liquid preparation such as a capsule, pill, tablet, lozenge, troche, melt, powder, solution, suspension or emulsion, or an injection, liposome, polymeric microsphere or polymeric gel preparation, ointment, transdermal patch or inhalant.

9. The use according to any one of claims 1 to 5, wherein the medicament is administered as a single medicament or in combination with other medicaments; preferably, the other medicaments comprise other medicaments capable of preventing and / or treating and / or slowing down the disease or symptoms caused by an enterovirus infection; or, the other medicaments comprise: Antiviral drugs, immunomodulators, anti-infective drugs, antipyretic analgesics, vaccines, Chinese herbal medicines, Chinese patent medicines, probiotics, vitamins, trace elements, cholesterol-lowering drugs; preferably, the other drugs include: EV71 inactivated vaccine, EV71 attenuated vaccine, gamma globulin, recombinant human interferon, recombinant human interleukin-2, acyclovir, ganciclovir, ribavirin, chlortetracycline ointment, moroxydine hydrochloride, amoxicillin, acetaminophen, montmorillonite powder, cetirizine lozenge, cod liver oil, isatis root, Bingpao powder, Shuanghuanglian injection, Xiguahuang spray, Qingkailing, Pudilan, vitamin B2, vitamin C.

10. A method of inhibiting an enterovirus in a cell for non-therapeutic purposes with at least one of 27-hydroxycholesterol or a pharmaceutically acceptable salt or ester thereof, the method comprising: The 27-hydroxycholesterol or a pharmaceutically acceptable salt or ester thereof is contacted with the cell before and / or simultaneously with and / or after the contact of the enterovirus with the cell; preferably, the inhibition comprises inhibiting replication of the enterovirus or cytopathic effect caused by the enterovirus; preferably, the cell is a human cell; more preferably, the cell is a human rhabdomyosarcoma cell.

11. A set of primer sequences for fluorescent quantitative PCR, the forward primer being as shown in SEQ ID NO: 1, and the reverse primer being as shown in SEQ ID NO: 2.

Images