Rice endosperm development gene OsPRS4 as well as encoding protein and application thereof
By cloning and regulating the rice endosperm development gene OsPRS4, the problem of abnormal rice endosperm development was solved, and transgenic rice plants with normal development were cultivated, thus improving rice yield and quality.
Patent Information
- Application Number
- CN202511660901.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-13
- Publication Date
- 2026-01-16
AI Technical Summary
The molecular mechanisms of rice endosperm development are unclear in existing technologies, which leads to abnormal endosperm development that affects nutrient accumulation and rice yield. There is a lack of effective gene regulation methods.
The rice endosperm development-related gene OsPRS4 and its encoded protein were cloned and identified. By constructing recombinant expression vectors and interference vectors, the rice endosperm development process was regulated to achieve the conversion between normal and abnormal development.
By regulating the expression of the OsPRS4 gene, rice plants with normal endosperm development can be cultivated, increasing rice yield, solving the problem of abnormal endosperm development, and meeting the requirements for food security and quality.
Smart Images
Figure CN121342945A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering, specifically relating to a gene for rice endosperm development. OsPRS4 Its encoded proteins and applications. Background Technology
[0002] Rice is one of the world's major food crops, primarily grown in Asia, Southern Europe, and parts of tropical America and Africa, feeding more than half the world's population. A rice grain consists of an embryo and endosperm. The endosperm, which stores abundant nutrients such as starch, protein, and lipids, is the most important source of food for humans and animal feed. With continuous technological advancements and rising living standards, people's demands for food have diversified from simply satisfying hunger to focusing on health, functionality, and taste. Ensuring nutritional health and meeting personalized needs through high-quality breeding is an inevitable trend in future agricultural development. Therefore, researching and refining the development process of the rice endosperm is of great significance for rice quality and food security.
[0003] Rice endosperm development involves several stages, including free nuclear division, endosperm cellularization, aleurone and starch differentiation, and the accumulation of storage products. Multiple hormones, transcription factors, and cyclins work together to regulate each stage; disruption at any stage can lead to inhibited starch synthesis, resulting in a mealy endosperm. Currently, the molecular mechanisms underlying endosperm development are unclear; therefore, identifying new genes to elucidate the regulatory processes of rice endosperm development is crucial for improving rice quality.
[0004] Abnormal endosperm development in rice leads to impaired nutrient accumulation and abnormal grain filling. Screening for mutants with abnormal endosperm development is a crucial method for identifying new key factors in rice endosperm development. With the rapid development of molecular biology, molecular genetics, and cell biology methods and techniques, some genes regulating rice endosperm development have been precisely located and cloned. However, their regulatory mechanisms remain unclear. This necessitates locating and cloning more related genes to further elucidate the mechanisms of rice endosperm development. Simultaneously, identifying genes related to rice endosperm development is beneficial for addressing abnormal endosperm development, increasing rice yield, and playing a vital role in plant genetic improvement. Summary of the Invention
[0005] To address the aforementioned technical problems in the existing technology, this invention provides a rice endosperm development gene OsPRS4, its encoded protein, and its applications.
[0006] The technical solution of this invention is as follows: Rice OsPRS4 protein, wherein the OsPRS4 protein is selected from either (a) or (b): (a) A protein consisting of the amino acid sequence shown in SEQ ID NO.3; (b) A protein derived from SEQ ID NO.3 with one or more amino acid residues substituted and / or deleted and / or added, and which is associated with starch synthesis.
[0007] The OsPRS4 gene encoding the aforementioned rice OsPRS4 protein is a DNA molecule as shown in 1), 2), 3), or 4) below: 1) The DNA molecule shown in SEQ ID NO.1; 2) The DNA molecule shown in SEQ ID NO.2; 3) A DNA molecule that hybridizes under stringent conditions to the DNA sequence defined in 1) or 2) and encodes the protein described in SEQ ID NO. 3; 4) DNA molecules that have more than 90% homology with the DNA sequence defined in 1), 2), or 3) and encode proteins related to endosperm development.
[0008] Recombinant expression vectors, expression cassettes, transgenic cell lines, or recombinant bacteria containing the aforementioned genes.
[0009] Furthermore, the recombinant expression vector is located at the multiple cloning site of the pCAMBIA1390 vector. Hind III and BamH The OsPRS4 gene was inserted between I to obtain it.
[0010] Primer pairs for amplifying the full length of the aforementioned gene or any fragment thereof, or primers for localizing the aforementioned gene.
[0011] Furthermore, the amplification primers are: primer1: 5' CGCCGTTCTTTTCGGAGATT 3' (SEQ ID NO.4); primer2: 5'TGTTTATGAAGACGTCAGGCC 3' (SEQ ID NO.5); or primer3: 5' CCGGCGCGCCAAGCTTTAATGATGATGGAAAACAAC 3' (SEQ ID NO.6); primer4: 5' GAATTCCCGGGGATCCTAGAATAAAACATGAGTTTT 3' (SEQ ID NO. 7).
[0012] The primers used in the fine mapping of this gene are shown in Table 1. The InDel primers were designed by the author for this experiment and are also within the scope of protection of this invention.
[0013] The application of the aforementioned rice OsPRS4 protein, or the aforementioned OsPRS4 gene, or the aforementioned recombinant expression vector, expression cassette, transgenic cell line, or recombinant bacteria, or the aforementioned primers in regulating rice endosperm development.
[0014] Furthermore, by increasing the expression level of rice OsPRS4 protein in rice plants with abnormal endosperm development due to OsPRS4 gene deficiency, or by increasing the expression amount of rice OsPRS4 gene in rice plants with abnormal endosperm development due to OsPRS4 gene deficiency, or by introducing recombinant expression vectors, expression cassettes, transgenic cell lines, or recombinant bacteria into the plants, transgenic plants with normal endosperm development can be obtained.
[0015] Furthermore, the total DNA of rice plants was amplified using the aforementioned primers, and the expression level of the OsPRS4 gene was detected on the amplification product. If the OsPRS4 gene could not be amplified, or the expression level of the OsPRS4 gene was reduced, then the plant was an endosperm developmental abnormality plant with OsPRS4 gene defect.
[0016] Furthermore, by reducing the expression level of OsPRS4 protein in rice plants with normal endosperm development, or by reducing the expression level of the OsPRS4 gene in rice plants with normal endosperm development, transgenic plants with abnormal endosperm development were obtained. Beneficial effects
[0017] This invention is the first to discover, locate, and clone a gene for a novel plant endosperm development-related protein. OsPRS4 The plant endosperm mealy protein of this invention affects the endosperm development process of plants. Inhibiting the expression of the gene encoding this protein can lead to abnormal endosperm development in plant seeds, thereby enabling the cultivation of transgenic plants with endosperm development variations. Introducing the gene encoding this protein into plants with abnormal endosperm development can cultivate plants with normal endosperm development, preventing chalkiness in rice and increasing rice yield. The protein and its encoding gene can be applied to plant genetic improvement. Attached Figure Description
[0018] Figure 1 Wild-type NJ6 and mutant prs4 The grain phenotype.
[0019] Figure 2 Wild-type NJ6 and mutant prs4 Thousand-grain weight determination.
[0020] Figure 3 Wild-type NJ6 and mutant prs4 Grain observation using scanning electron microscopy.
[0021] Figure 4 Wild-type NJ6 and mutant prs4Observation of early endosperm paraffin sections.
[0022] Figure 5 This shows the fine location of the mutated gene on chromosome 2.
[0023] Figure 6 for prs4 Forwarded from pCAMBIA1390- OsPRS4 The T1 grain phenotype of the T0 generation plants.
[0024] Figure 7 For wild-type NJ6 transRNAi- OsPRS4 The T1 grain phenotype of the T0 generation plants. Detailed Implementation
[0025] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores.
[0026] Example 1: Discovery of rice endosperm development-related loci and their encoding genes I. Rice endosperm mealy mutant prs4 Starch content distribution analysis and genetic analysis Among the NJ6 mutants generated by EMS chemical mutagenesis, an endosperm-based mutant was screened out and named... prs4 .
[0027] Compared to NJ6, prs4 The main characteristic is that the seeds have a powdery, opaque phenotype (see...). Figure 1 Furthermore, the thousand-seed weight decreased significantly (see...). Figure 2 ). Figure 1 NJ6 shows that it has a transparent endosperm. prs4 The endosperm exhibits a powdery, opaque phenotype. This indicates that the gene mutation affected nutrient accumulation, impacting starch accumulation and resulting in differences in the endosperm's appearance.
[0028] For wild type and mutant prs4 The cross-section of the seed was observed using scanning electron microscopy (see [link]). Figure 3 The starch lamellar structure in the cross-section of wild-type seeds is more regular and orderly, while that in mutants is more loose. Paraffin sections of the endosperm in early development were observed (see...). Figure 4 The endosperm cellularization process of wild-type NJ6 was found to be normal. In the mutant... prs4 In the study, it can be seen that the endosperm cellularization process was inhibited. Therefore, it can be inferred that the incomplete endosperm cellularization may lead to the endosperm exhibiting a mealy phenotype in the mutant.
[0029] II. Map-based cloning of mutant gene sites 1. Location of the mutated gene First, the mutant was prepared. prs4 F1, a hybrid of F1 and another wild-type N22, was self-crossed to obtain F2 seeds. The F2 seeds were dehulled, and 10 extreme individuals were selected based on phenotypic opacity for linkage, and the target gene was located on the second chromosome of rice.
[0030] F2 seeds with the same phenotype as the mutant were selected for seedling cultivation, resulting in leaves from 743 recessive extreme individuals. Using common primers and self-designed primers, the target gene was ultimately located between markers P5 and P6, with a region size of 200 kb. Figure 5 ).
[0031] The method for SSR marker analysis described above is as follows: (1) Extract the total DNA from the selected single plants as a template. The specific method is as follows: ① Take about 0.2 grams of tender rice leaves and place them in a 2.0 mL Eppendorf tube. Place a steel ball in the tube and freeze the Eppendorf tube containing the sample in liquid nitrogen for 5 min. Then, place the sample in a multi-sample tissue grinder (Shanghai Jingxin) and grind the sample for 1 min.
[0032] ② Add 600 mL of CTAB extraction solution (a solution containing 100 mM Tris-HCl (pH 8.0), 20 mM EDTA (pH 8.0), 1.4 M NaCl, and 0.2 g / mL CTAB) and vortex vigorously to mix.
[0033] ③ Incubate at 65℃ for 30 minutes, gently inverting the container every two minutes to mix thoroughly.
[0034] ④ Add 600 mL of chloroform:isoamyl alcohol (24:1), mix gently, and let stand for 10 min.
[0035] ⑥ Centrifuge at 12000 rpm for 5 min.
[0036] ⑦ Transfer 400 mL of the supernatant to a 1.5 mL Eppendorf tube, add 280 mL of isopropanol, and mix well. ⑦ Freeze at -20℃ for 2 hours, then centrifuge at 12000 rpm for 5 min.
[0037] ⑧ Discard the supernatant, rinse the precipitate once with 70% (volume percentage) ethanol, and let it air dry at room temperature.
[0038] ⑨ Add 200 mL of deionized water to dissolve the DNA.
[0039] ⑩ Take 2 mL of the DNA for electrophoresis to detect its quality, and determine its concentration using a NanoRDrop Onec ultra-micro UV spectrophotometer (Thermo Scientific).
[0040] (2) Dilute the extracted DNA to approximately 20 ng / μL and use it as a template for PCR amplification; PCR reaction system (10 μL): DNA (20 ng / μL) 1 μL, upstream primer (2 pmol / μL) 1 μL, downstream primer (2 pmol / μL) 1 μL, 10 × Buffer (MgCl2 free) 1 μL, dNTP (10 mM) 0.2 μL, MgCl2 (25 mM) 0.6 μL, rTaq (5 U / μL) 0.1 μL, ddH2O 5.1 μL, total 10 μL.
[0041] PCR reaction program: denaturation at 94.0℃ for 5 min; denaturation at 94.0℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 1 min, for a total of 35 cycles; extension at 72℃ for 7 min; storage at 10℃. PCR reactions were performed in a LongGene A300 thermal cycler.
[0042] (3) Detection of SSR-labeled PCR products The amplification products were analyzed by 8% non-denaturing polyacrylamide gel electrophoresis. A 50 bp DNA ladder was used as a control to compare the molecular weight of the amplification products, and silver staining was performed for color development.
[0043] The primer development process is as follows: (1) SSR tag development SSR markers from public maps were integrated with rice genome sequences, and BAC / PAC clone sequences near mutation sites were downloaded. Potential SSR sequences (repeat count ≥ 6) in clones were searched using SSRhunter (Li Qiang et al., Genetics, 2005, 27(5): 808-810) or the online SSRIT software (http: / / archive.gramene.org / db / markers / ssrtool). These SSRs and their adjacent 400–500 bp sequences were compared online with corresponding indica rice sequences using the BLAST program on NCBI. If there was a difference in the number of SSR repeats, it was preliminarily inferred that the PCR product of the SSR primers exhibited polymorphism between indica and japonica rice. SSR primers were then designed using Primer Premier 5.0 software and synthesized by Nanjing Genscript Biotech Co., Ltd. The designed SSR primer pairs were mixed in equal proportions, and their polymorphism between NJ6 and N22 was detected. Polymorphic primers were used as molecular markers for fine mapping. Molecular markers used for fine mapping are shown in Table 1.
[0044] Table 1 Molecular markers used for fine localization
[0045] 2. Obtaining the starch gene After sequencing the genes within a 200 kb region, it was found that... OsPRS4 The gene contains a single-base mutation.
[0046] Primers were designed based on sequences published online, as follows: primer1: 5' CGCCGTTCTTTTCGGAGATT 3' (SEQ ID NO.4); primer2: 5' TGTTTATGAAGACGTCAGGCC 3' (SEQ ID NO. 5).
[0047] Using primers 1 and 2, and with NJ6 developing endosperm cDNA as a template, PCR amplification was performed to obtain the target gene. The amplification reaction was conducted on a LongGene A300 PCR instrument: 94℃ for 3 min; 94℃ for 30 sec, 60℃ for 1 min, 72℃ for 10 min, 35 cycles; 72℃ for 5 min. The PCR product was recovered, purified, and ligated into pMD18-T (TaKaRa, Japan), transformed into *E. coli* DH5α competent cells (Tiangen CB101, Beijing), and positive clones were selected for sequencing.
[0048] Sequencing results showed that the fragment obtained by PCR had the nucleotide sequence shown in SEQ ID NO.2, encoding a protein consisting of 326 amino acid residues (see SEQ ID NO.3 in the sequence listing). The protein shown in SEQ ID NO.3 was named OsPRS4, and the gene encoding the protein shown in SEQ ID NO.3 was named... OsPRS4 .
[0049] Example 2: Obtaining and Identifying Transgenic Plants I. Construction of recombinant expression vector and acquisition of recombinant Agrobacterium Using cDNA from NJ6 (from the rice germplasm resource bank of Nanjing Agricultural University) as a template, PCR amplification was performed to obtain... OsPRS4 The gene and PCR primer sequences are as follows: primer3: 5' CCGGCGCGCCAAGCTTTAATGATGATGGAAAACAAC 3' (SEQ ID NO. 6); primer4: 5'GAATTCCCGGGGATCCTAGAATAAAACATGAGTTTT 3' (SEQ ID NO. 7).
[0050] The primers described above are located 2 kb upstream and 2.47 kb downstream of the gene shown in SEQ ID NO.2. The amplification product contains the promoter and genomic portions of the gene. The PCR product was recovered and purified.
[0051] The PCR product was cloned into the vector pCAMBIA1390 using the INFUSION recombination kit (Takara Corporation, Japan). Hind III and Bam Between HI restriction sites. INFUSION recombinant reaction system (10 μL): PCR product 2.0 μL, pCAMBIA1305 5.0 μL, 5× infusion buffer 2.0 μL, infusion enzyme mix 1 μL. After brief centrifugation, incubate the mixture at 37°C for 15 minutes, then at 50°C for 15 minutes. Take 2.5 μL of the reaction mixture and transform it into *E. coli* using the heat shock method. DH5α Competent cells (Beijing Tiangen Company; CB101). All transformed cells were evenly spread on LB agar containing 50 mg / L kanamycin. After incubation at 37°C for 16 h, positive clones were picked and sequenced. Sequencing results showed that a recombinant expression vector containing the gene shown in SEQ ID NO.1 was obtained. OsPRS4pCAMBIA1390 is named pCAMBIA1390- OsPRS4 .
[0052] pCAMBIA1390- was subjected to thermal shock. OsPRS4 Agrobacterium strain EHA105 (purchased from Invitrogen, USA) was transformed to obtain a recombinant strain. Plasmids were extracted and identified by PCR and enzyme digestion. The recombinant strain correctly identified by PCR and enzyme digestion was named EH-pCAMBIA1390- OsPRS4 .
[0053] II. Construction of Interference Vector and Obtaining Recombinant Agrobacterium Using cDNA from NJ6 (from the rice germplasm resource bank of Nanjing Agricultural University) as a template, primers primers 5 and 6 were designed to amplify the selected fragment SEQ ID NO. 8. Then, primers 7 and 8 were designed to amplify the fragment SEQ ID NO. 8 using reverse complementation. This specific fragment was then inserted into the FAD1390RNAi interference vector using homologous recombination to form... RNAi- OsPRS4 The primer sequences are as follows: primer5: 5' TTCTGCACTAGGTACCAGGCCTGgctccttcgagcgcgtcgag 3' (SEQ ID NO.9) primer6: 5' CTGACGTAGGGGCGATAGAGCTCcaaccattgggaagttgagc 3' (SEQ ID NO.10) primer7: 5' CGGGGATCCGTCGACTACcaaccattgggaagttgagc 3' (SEQ ID NO.11) primer8: 5' AGGTGGAAGACGCGTTACgctccttcgagcgcgtcgag 3' (SEQ ID NO.12) Using thermal shock method RNAi-OsPRS4 Agrobacterium strain EHA105 (purchased from Invitrogen, USA) was transformed to obtain a recombinant strain. Plasmids were extracted and identified by PCR and enzyme digestion. The recombinant strain correctly identified by PCR and enzyme digestion was named EH- RNAi-OsPRS4 .
[0054] III. Obtaining Transgenic Plants EH- pCAMBIA1390- OsPRS4 strain transformed into rice endosperm developmental abnormal mutant prs4 The specific method is as follows: (1) Incubate EH- pCAMBIA1390- at 28℃ OsPRS4 After 16 hours, the bacterial cells were collected and diluted in N6 liquid medium (Sigma, C1416) to a concentration of OD600 ≈ 0.5 to obtain the bacterial suspension. (2) Cultured for one month prs4 Rice mature embryonic callus was mixed with the bacterial solution from step (1) and infected for 30 min. After the bacterial solution was dried with filter paper, it was transferred to co-culture medium (N6 solid co-culture medium, Sigma) and co-cultured at 24℃ for 3 days. (3) The callus from step (2) was inoculated onto N6 solid selection medium containing 100 mg / L hygromycin for the first screening (16 days). (4) Select healthy callus and transfer it to N6 solid selection medium containing 100 mg / L hygromycin for a second selection. Subculture every 15 days. (5) Select healthy callus and transfer it to N6 solid selection medium containing 50 mg / L hygromycin for the third selection, and subculture every 15 days; (6) Select resistant callus and transfer it to differentiation medium for differentiation to obtain T0 generation positive plants that have differentiated into seedlings.
[0055] EH- RNAi-OsPRS4 The transgenic plants were transformed using the same method as described above, except that the rice variety introduced was Ningjing 6.
[0056] IV. Identification of Transgenic Plants 1. PCR molecular identification In this study, pCAMBIA1390 was identified using hygromycin markers. OsPRS4 Genetically modified plants.
[0057] PCR reaction system for label analysis: DNA (20 ng / μL) 2 μL, Primer3 (10 pmol / μL) 2 μL, Primer4 (10 pmol / μL) 2 μL, 10 × Buffer (MgCl2 free) 2 μL, dNTPs (10 mM) 0.4 μL, MgCl2 (25 mM) 1.2 μL, rTaq (5 U / μL) 0.4 μL, ddH2O 10 μL, total volume 20 μL.
[0058] The amplification reaction was performed on a LongGene A300 PCR instrument: 94℃ for 3 min; 94℃ for 30 sec, 55℃ (adjusted for different primers) for 45 sec, 72℃ for 2.5 min, 35 cycles; 72℃ for 5 min.
[0059] PCR products were purified and recovered according to the kit (Beijing Tiangen Company) procedure. Separation was performed using 8% non-denaturing PAGE gel and silver staining. Transgenic positive plants were identified.
[0060] 2. Identification by quantitative fluorescence analysis In this study, quantitative fluorescence analysis was used to identify... RNAi-OsPRS4 transgenic plants Total RNA was extracted from the plant according to the kit (Beijing Tiangen Company). Reverse transcription of mRNA was performed using the SuperScript II kit (TaKaRa), and cDNA was stored at -20°C.
[0061] Real-time PCR was performed using a SYBR Green I mix (TaKaRa, Cat# RR420A) kit and a Bio-Rad T100™ real-time PCR system (California, USA) for gene expression analysis. Primers for OsPRS4 gene quantification were primers 9 and 10. Rice Ubiquitin gene was used as an internal control, with primers 11 and 12. -△△CT The quantitative results were then analyzed. The primer sequences are shown below: primer9: 5' ACACTAATTCCGCTGGGTCA 3' (SEQ ID NO.13) primer10: 5' ATCGAACCAGCAAGGCTCAA 3' (SEQ ID NO.14) primer11: 5' GCTCCGTGGCGGTATCAT 3' (SEQ ID NO.15) primer12: 5'CGGCAGTTGACAGCCCTAG 3' (SEQ ID NO.16) 3. Phenotypic identification Convert T0 to pCAMBIA1390- OsPRS4Positive plants, mutants prs4 NJ6 and NJ6 were planted in a transgenic field at the Tuqiao Rice Breeding Base of Nanjing Agricultural University. After the seeds matured, the seeds of each material were harvested, and pCAMBIA1390- was observed. OsPRS4 Transparent seeds appeared in the plant's seeds. Figure 6 Therefore, it is proven that... prs4 The mutant phenotype in the middle is caused by OsPRS4 This is caused by a mutation in pCAMBIA1390- OsPRS4 It can prs4 The seeds of the strain have regained their transparent phenotype and are about to... OsPRS4 Gene importation has OsPRS4 Transgenic plants with normal endosperm development can be obtained from plants with genetic defects and abnormal endosperm development.
[0062] Transform T0 into RNAi-OsPRS4 Positive plants, mutants prs4 NJ6 and NJ6 were planted in a transgenic field at the Tuqiao Rice Breeding Base of Nanjing Agricultural University. After the seeds matured, the seeds of each material were harvested and observed. RNAi-OsPRS4 The plant's seeds contained powdery seeds. Figure 7 Therefore, it is proven that... prs4 The mutant phenotype in the middle is caused by OsPRS4 This is caused by mutations. RNAi- OsPRS4 It can transform wild-type transparent seeds into those that are similar to... prs4 The same strain has powdery seeds.
[0063] SEQ ID NO.1 Rice OsPRS4 sequence 1 tttgcgccgc tactagtagg tgctagtctc gcctcgagcc caaatccagc ctgctcgcgt 61 cggccgatcg atcgatcata ccacgggccg attcgtggct cgcgccgcgc ggctggggtc 121 taagctaggg tttacgctcg cgaaaaaaaa aaagaaaagt gttgagcgaa taatttgctc 181 ctagaccttt gctgcttctc ccctgtcgat aaagccgacc acactgctcg cgtccccccg 241 cgccgttctt ttcggagatt ccgctcgcgc gcgccgccgc cgccgcagcc gcccgccggg 301 gagcccggga cgaggatgga ggtcgtcgtg gcgaggcagc cgaaggcgaa gaagcagata 361 aacctcttct actgctccga gtgcgaggag ctcgcgctca aggtcgccgc tagctccgac 421 accatccatc tccagtccat caactggagg tacgctcccc gtcctcctcc tcctcctcct 481 cctcctcctc gccggtttcg tggagtcacc tgattcgctg attcgcttcc gccgccgccg 541 ccgccgcgca ggagcttcga cgacgggttc cccaacctgt tcatcaacaa cgcgcacgac 601 atccgggggc agcacgtggc gttcctggcg tcgttcagct cgccgtcggt catcttcgag 661 cagatctccg tcatcttcgc gctgcccaag ctgttcatcg cctccttcac gctcgtgctg 721 cctttcttcc ccacgggctc cttcgagcgc gtcgaggagg agggcgacgt cgccaccgcg 781 ttcaccctcg cgcgcatcct ctccatgatt cccaagtccc ggggcggccc gaccagcgtc 841 gtcatctacg acatccacgc gctccaggag aggttctact tcggggacga cgtcctcccc 901 tgcttcgaga ccgggattcc gctcctgctg cagcgcctcc ggcagctccc cgatgctgac 961 aatgtgcgta gcaaggccac cggtgtccta ctaatttctt tcaagtaccc aattcgtgtt 1021 gctactgctg acttgtgtga tttgtgtgtt gcgcagatca ccattgcctt cccggatgat 1081 ggggcgtgga agcgtttcca caagctattg ctcaacttcc caatggttag cttcttgttt 1141 tgtgtgaatg aatgaacatg tcgaaattcg gttatgcatg ccattgtgga attgctcttt 1201 tttttttctg gttgaaagac tccgagtttt tactttgggc tgtttgatta taaggttgtc 1261 tgcgcaaagg ttcgggaagg tgacaagagg atagttcgaa ttaaggaggg gaatcctgaa 1321 ggccggcatg tggttattgt tgatgattta gtgcaatctg ggggaactct tagagaatgt 1381 caggtatcaa catactgtct gtggctttgc catgatacta caaagtagtg cttcagtgac 1441 ttaattttta ctaatgttgg attttcttac ttccacttta gtgggagagg ccaagaggga 1501 tatggttttt tgctatcttt gtttttagtt gtctgacaaa gagtaatgcc tcctataata 1561 tacgtttcac atattaattg ccaacaggca gaggtcctga aaaacagaga ttaattacat 1621 gcccttgtaa aacctgatct tagcaaagtc agtcacatgc ttatttttgc attttcattt 1681 tttagtaggc ttgatgttca ttttactcca tgtaattgtt ttaacacttt tgaggacgta 1741 ctaattcata aactgttgat gggatatgct gctttatgtt gcatttctca ttaatgcttc 1801 tttgtctaat tattttgcag aaagttttgg ctgctcatgg tgctgcaaaa gttagtgctt 1861 acgtgactca tgctgttttt cccaagcagt cgtatgagcg cttcactcac actaattccg 1921 gtaattcgtg attctcttct ctttctacct ttcagccact caacttcagt tctcaccctt 1981 ttttttccca ctcacagctg ggtcagctga caagtttgcg tatttctgga tcactgactc 2041 ctgccctcaa acagtgaaag ccatcaacca acaacctcca tttgaggtgt tgagccttgc 2101 tggttcgatt gcggatgccc ttcaaatatg aactttgttt ttggtaatgg gctactccca 2161 tttttcctaa atgttagagt tcactttcag ctccagtaaa aacaaataat gtggagtgag 2221 ttatcttaat tatggctttg gcctgacgtc ttcataaaca tctcaatatg tgatggtaaa 2281 ataaggcatt tgatgctcat ctgttccttc ttgagcaaag cgcacacaat cactgcttta 2341 tttcctgaca tgtatactac tggaggctga gcacatctgc acaagtgctc gttttttgtc 2401 ttgctcccga aaaagcgct tattctctc ttaatattga tatgactgtt tattaaaact 2461 catgttttat tcta SEQ ID NO.2 See more of OsPRS4 and CDS 1 atggaggtcg tcgtggcgag gcagccgaag gcgaagaagc agataaacct cttctactgc 61 tccgagtgcg aggagctcgc gctcaggtc gccgctagct ccgacaccat ccatctccag 121 tall squirrel squirrel squirrel squirrel squirrel squirrel squirrel 181 gataccggg ggcagcacgt gcgttcctg gcgtcgttca gctcgccgtc ggtcatctc 241 gagcagatct cgtcatctt cgcgctgccc aagctgttca tcgctcctt cacgctcgtg 301 ctgccttct tcccacgggg ctccttcgag cgcgtcgagg aggaggcga cgtcgccacc 361 gcgttcaccc tcgcgcgcat cctctccatg attcccaagt cccggggcgg cccgaccagc 421 gtcgtcatct acgacatcca cgcgctccag gagaggttct acttcgggga cgacgtccctc 481 ccctgctcg agaccgggat tccgctcctg ctgcagcgcc tccgcagct ccccgatgct 541 gataatca ccattgcctt cccggatgat gggcgtgga agcgttcca caagctattg 601 ctcaacttcc caatggttgt ctgcgcaaag gttcgggaag gtgacaagag gatagttcga 661 attaaggagg ggaatcctga aggccggcat gtggttattg ttgatgattt agtgcaatct 721 gggggaactc ttagagaatg tcagaaagtt ttggctgctc atggtgctgc aaaagttagt 781 gcttacgtga ctcatgctgt ttttcccaag cagtcgtatg agcgcttcac tcacactaat 841 tccgctgggt cagctgacaa gtttgcgtat ttctggatca ctgactcctg ccctcaaaca 901 gtgaaagcca tcaaccaaca acctccattt gaggtgttga gccttgctgg ttcgattgcg 961 gatgcccttc aaatatga SEQ ID NO.3 Rice OsPRS4 protein 1 MEVVVARQPK AKKQINLFYC SECEELALKV AASSDTIHLQ SINWRSFDDG FPNLFINNAH 61 DIRGQHVAFL ASFSSPSVIF EQISVIFALP KLFIASFTLV LPFFPTGSFE RVEEEGDVAT 121 AFTLARILSM IPKSRGGPTS VVIYDIHALQ ERFYFGDDVL PCFETGIPLL LQRLRQLPDA 181 DNITIAFPDD GAWKRFHKLL LNFPMVVCAK VREGDKRIVR IKEGNPEGRH VVIVDDLVQS 241 GGTLRECQKV LAAHGAAKVS AYVTHAVFPK QSYERFTHTN SAGSADKFAY FWITDSCPQT 301 VKAINQQPPF EVLSLAGSIA DALQI SEQ ID NO.8 Endosperm development gene OsPRS4 Transgenic interference sequence 1 gctccttcga gcgcgtcgag gaggagggcg acgtcgccac cgcgttcacc ctcgcgcgca 61 tcctctccat gattcccaag tcccggggcg gcccgaccag cgtcgtcatc tacgacatcc 121 acgcgctcca ggagaggttc tacttcgggg acgacgtcct cccctgcttc gagaccggga 181 ttccgctcct gctgcagcgc ctccggcagc tccccgatgc tgacaatatc accattgcct 241 tcccggatga tggggcgtgg aagcgtttcc acaagctatt gctcaacttc ccaatggttg
Claims
1. A rice OsPRS4 protein, characterized in that, The OsPRS4 protein is selected from any one of (a) or (b): (a) a protein consisting of the amino acid sequence shown in SEQ ID NO. 3; (b) a protein derived from SEQ ID NO. 3 by substitution and / or deletion and / or addition of one or several amino acid residues and associated with starch synthesis.
2. An OsPRS4 gene encoding the OsPRS4 protein of claim 1, characterized in that, The gene is a DNA molecule as shown in 1) or 2) or 3) or 4) below: 1) a DNA molecule shown in SEQ ID NO. 1; 2) a DNA molecule shown in SEQ ID NO. 2; 3) a DNA molecule hybridizing with the DNA sequence defined in 1) or 2) under stringent conditions and encoding the protein shown in SEQ ID NO. 3; 4) a DNA molecule having more than 90% homology with the DNA sequence defined in 1) or 2) or 3) and encoding a protein associated with endosperm development.
3. A recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria containing the gene of claim 2.
4. The recombinant expression vector of claim 3, wherein, The recombinant expression vector is obtained by inserting the OsPRS4 gene into the multiple cloning site of the pCAMBIA1390 vector Hind III and BamH I.
5. A primer pair amplifying the full length of the gene of claim 2 or any fragment thereof or a positioning primer of the gene of claim 2.
6. The primer of claim 5, wherein The amplification primer is: primer1: 5' CGCCGTTCTTTTCGGAGATT 3' (SEQ ID NO. 4); primer2: 5' TGTTTATGAAGACGTCAGGCC 3' (SEQ ID NO. 5); or primer3: 5' CCGGCGCGCCAAGCTTTAATGATGATGGAAAACAAC 3' (SEQ ID NO. 6); primer4: 5' GAATTCCCGGGGATCCTAGAATAAAACATGAGTTTT 3' (SEQ ID NO. 7).
7. Use of the rice OsPRS4 protein of claim 1 or the OsPRS4 gene of claim 2 or the recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria of claim 3 or the primer of claim 5 in regulating endosperm development of rice.
8. Use according to claim 7, characterized in that, Increasing the expression level of the rice OsPRS4 protein in the endosperm development abnormal plant deficient in the OsPRS4 gene or increasing the expression amount of the rice OsPRS4 gene in the endosperm development abnormal plant deficient in the OsPRS4 gene or introducing the recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria into the plant, to obtain a transgenic plant with normal endosperm development.
9. Use according to claim 8, characterized in that, Using the primer pair of claim 5 to amplify the total DNA of the rice plant, and detecting the expression amount of the OsPRS4 gene from the amplification product, if the OsPRS4 gene cannot be amplified or the expression amount of the OsPRS4 gene is reduced, it is an endosperm development abnormal plant deficient in the OsPRS4 gene.
10. Use according to claim 7, characterized in that, Decreasing the expression level of the OsPRS4 protein in the rice plant with normal endosperm development or decreasing the expression amount of the OsPRS4 gene in the rice plant with normal endosperm development, to obtain a transgenic plant with abnormal endosperm development. Decreasing the expression level of the OsPRS4 protein in the rice plant with normal endosperm development or decreasing the expression amount of the OsPRS4 gene in the rice plant with normal endosperm development, to obtain a transgenic plant with abnormal endosperm development.