A heavy metal tolerant dehalobacterium and its application in halogenated hydrocarbon pollution remediation

By isolating and identifying the heavy metal-tolerant dehalogenated coccidia strain Y2, the problem of the inefficient biodegradation of halogenated hydrocarbon pollutants under heavy metal coexistence conditions was solved, and efficient bioremediation of halogenated hydrocarbons under high concentrations of heavy metals was achieved.

CN121343847BActive Publication Date: 2026-03-24SHENYANG INST OF APPL ECOLOGY CHINESE ACAD OF SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511913193.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-18
Publication Date
2026-03-24
Estimated Expiration
2045-12-18

AI Technical Summary

Technical Problem

Existing technologies struggle to efficiently biodegrade halogenated hydrocarbon pollutants, especially tetrachloroethylene and trichloroethylene, under conditions where heavy metals coexist. Furthermore, common dehalogenated streptococcal strains are sensitive to heavy metals, affecting their dehalogenation process.

Method used

A heavy metal-tolerant dehalogenated *Dehalococcoides mccartyi* strain Y2 was isolated and identified. This strain can convert tetrachloroethylene and trichloroethylene into non-toxic ethylene compounds through a reductive dehalogenation process under anaerobic conditions in the presence of heavy metals such as zinc, copper, and cadmium.

Benefits of technology

Even under heavy metal concentrations as high as 50 mg/L zinc ions, strain Y2 can still effectively reduce tetrachloroethylene to dichloroethylene, significantly improving the bioremediation efficiency of halogenated hydrocarbon pollutants and providing a new microbial remediation resource.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121343847B_ABST
    Figure CN121343847B_ABST
Patent Text Reader

Abstract

The present application belongs to the field of environmental microbial remediation, and specifically relates to a heavy metal tolerant dehalobacterium and application thereof in halogenated hydrocarbon pollution remediation. The dehalobacterium Y2 strain can maintain high-efficiency dehalogenation activity under high-concentration heavy metal stress. The strain has been preserved in the China General Microbiological Culture Collection Center (CGMCC) in 2023, address: No. 1, Yihuangyuan, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, postcode: 100101, preservation number: CGMCC No. 40795. The Y2 strain provided by the present application can overcome the inhibitory effect of heavy metals on dehalogenation microorganisms, and provides important strain resources for in-situ bioremediation of heavy metal and halogenated hydrocarbon compound contaminated sites.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of environmental microbial remediation, specifically relating to a heavy metal-tolerant dehalogenated *Bacillus* strain and its application in the remediation of halohydrocarbon pollution. It involves a heavy metal-tolerant dehalogenated *Bacillus* strain (… Dehalococcoides mccartyi ( ) and its application in in-situ bioremediation of sites contaminated with heavy metals and halogenated hydrocarbons, achieving efficient biodegradation and transformation of halogenated hydrocarbon pollutants under conditions of heavy metal coexistence. Background Technology

[0002] Halogenated hydrocarbons are a major class of pollutants in deep soil and groundwater environments, primarily originating from chemical synthesis intermediates, organic solvents, and improper disposal during pesticide production. Halogenated hydrocarbons are highly stable, dense, and have low water solubility, easily accumulating in groundwater over long periods, forming persistent pollution sources that seriously threaten drinking water safety and human health. Tetrachloroethylene and its low-chlorinated derivatives are particularly prevalent. Tetrachloroethylene is a potential carcinogen; long-term exposure can lead to liver and kidney damage and toxic effects on the immune and nervous systems. Trichloroethylene has been classified as a known human carcinogen by the World Health Organization, significantly increasing the risk of liver cancer and leukemia.

[0003] Under anaerobic conditions, the natural transformation and degradation of halogenated hydrocarbon pollutants mainly depend on reductive dehalogenation processes mediated by dehalogenating microorganisms. These organohalogenating bacteria use halogenated hydrocarbons as electron acceptors to catalyze reductive dehalogenation reactions to produce hypohalogenated or non-halogenated products. Dehalogenated *Bacillus* (… Dehalococcoides mccartyi Dehalogenated microorganisms are among the most studied types of dehalogenated microorganisms. The first dehalogenated *Tetrachloroethylene* strain, 195, was discovered and isolated in 1997, capable of completely dechlorinating tetrachloroethylene to non-toxic ethylene. Dehalogenated *Tetrachloroethylene* plays a crucial role in the complete neutralization of vinyl chloride contaminants. Currently, more than ten strains of dehalogenated *Tetrachloroethylene* have been isolated and purified that can use vinyl chloride contaminants as electron acceptors, but the vast majority cannot utilize tetrachloroethylene as an electron acceptor. In the reduction and dechlorination of tetrachloroethylene by strain 195, the process of dechlorinating tetrachloroethylene to trichloroethylene is the rate-limiting step, requiring up to 70 days. In previous bioremediation processes, the synergistic cooperation of other dehalogenated microbial populations, such as *Typhalus sulfide*, is often required. Sulfurospirillium ), Trichlorfon Trichlorobacter ), dehalogenated bacteria ( Dehalobacter After reducing tetrachloroethylene to trichloroethylene or dichloroethylene, dehalogenated Streptococcus bacteria further reduce these intermediate products to non-toxic ethylene.

[0004] Functional microbial agents, primarily *Bacillus dehalogenatingus*, such as KB-1 and SDC-9, have successfully achieved highly efficient bioremediation of vinyl chloride contaminants at multiple contaminated sites worldwide. However, in actual contaminated sites, compound pollution of halogenated hydrocarbons and heavy metals is extremely common, posing new challenges to the remediation of organochlorine pollution. Heavy metals are a significant environmental factor restricting in-situ bioremediation, exerting harmful effects on microbial cells and altering their physiological and biochemical characteristics. For dehalogenating microorganisms, heavy metals not only affect protein conformation, thus inactivating key dehalogenating enzymes, but can also act as competitive electron acceptors, inhibiting the dehalogenation process. Studies have shown that 5 mg / L of heavy metal ions can significantly affect the dehalogenation process. Zinc, a common industrial heavy metal pollutant, often coexists with halogenated hydrocarbons in the soil and groundwater of industrial sites such as electroplating, metallurgy, and battery manufacturing. Summary of the Invention

[0005] The purpose of this invention is to provide a heavy metal-tolerant dehalogenated cocci ( Dehalococcoides mccartyi ( ) and its application in in-situ bioremediation of sites contaminated with heavy metals and halogenated hydrocarbons, achieving efficient biodegradation and transformation of halogenated hydrocarbon pollutants under conditions of heavy metal coexistence.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] A heavy metal-tolerant dehalogenated *Bacillus* strain, classified as *Bacillus dehalogenated* strain Y2. Dehalococcoides mccartyi The strain was deposited on December 25, 2023, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China, with accession number CGMCC No. 40795.

[0008] The Y2 strain was isolated from sediment samples from the Xihe River in Shenyang, Liaoning Province, and grown in an anaerobic inorganic salt medium containing tetrachloroethylene, acetic acid, and hydrogen.

[0009] The isolation and culture technique for strain Y2 includes the following steps: a mixture of river sediments and the addition of tetrachloroethylene, acetic acid, hydrogen, and 50 mg / L Zn. 2+ The culture was enriched in an anaerobic inorganic salt medium and continuously subcultured 10 times. Using this as the isolation source, pure cultures were obtained by extinction dilution and then subjected to multiple subcultures under growth conditions with tetrachloroethylene as the electron acceptor.

[0010] Strain Y2 is Gram-negative and shares 98.69% sequence similarity with the 16S rRNA gene of the type strain 195 of the genus *Dehalogenated Coccidia*, indicating that they belong to the same genus. Given that the genus *Dehalogenated Coccidia* currently only has... mccartyi A named species, therefore strain Y2 is classified as Dehalococcoides mccartyi .

[0011] An application of the dehalogenated *Streptococcus* strain Y2, wherein the strain is used in the bioremediation of halogenated hydrocarbons in sites contaminated with a combination of halogenated hydrocarbons and heavy metals.

[0012] The halogenated hydrocarbon is tetrachloroethylene and / or trichloroethylene.

[0013] The heavy metal is one or more of zinc, copper and cadmium, wherein the content of zinc and copper is 0-50 mg / L and the content of cadmium ions is 0-100 mg / L.

[0014] Strain Y2 was tested at 30℃, pH 7.2, and 0-50 mg / L Zn. 2+ Under certain conditions, tetrachloroethylene can be completely reduced and dehalogenated to cis-1,2-dichloroethylene and trans-1,2-dichloroethylene. The isolation and purification of this strain contributes to the efficient bioremediation of halogenated hydrocarbon contamination in sites with combined heavy metal and halogenated hydrocarbon pollution.

[0015] A microbial agent for degrading halogenated hydrocarbon contamination, wherein the microbial agent contains the aforementioned dehalogenated *Streptococcus* strain Y2.

[0016] The bacterial agent is one or more of the following: culture of strain Y2, bacterial suspension, concentrated solution, and separation solution.

[0017] An application of the aforementioned environmental remediation microbial agent, specifically its application in the bioremediation of halogenated hydrocarbon pollutants in the presence of heavy metals.

[0018] A method for bioremediation and degradation of pollutants in the presence of heavy metals, comprising inoculating the dehalogenated Streptococcus Y2 strain or the bacterial agent in an anaerobic environment to be treated; the inoculation amount is 1-10%.

[0019] The inoculated *Typhaeidae* strain Y2 or the bacterial agent is cultured under conditions of pH 7.2, 30°C, and in the dark.

[0020] The anaerobic environment to be treated also includes a carbon source and an electron donor, which can bioremediate and degrade halogenated hydrocarbon pollutants in the presence of heavy metals; wherein the amount of carbon source added is 5 μM-10 mM, and the amount of electron donor added is 0.6 nM-0.8 mM.

[0021] The carbon source is acetic acid; the electron donor is hydrogen.

[0022] Advantages of this invention:

[0023] This invention isolated strain Y2 from river sediment samples. Taxonomically, it belongs to the genus *Dehalogenated Coccidia*. Using acetic acid as a carbon source and hydrogen as an electron donor in an anaerobic inorganic salt medium, strain Y2 was able to completely dehalogenate 49.1 μmol of tetrachloroethylene to cis-1,2-dichloroethylene and trans-1,2-dichloroethylene within 10 days. Compared to previous reports, strain Y2 is one of the few *Dehalogenated Coccidia* strains capable of directly using tetrachloroethylene as an electron acceptor for respiratory metabolism, and exhibits the fastest dehalogenation rate for tetrachloroethylene. Furthermore, strain Y2 demonstrates tolerance to high concentrations of heavy metals, providing a new microbial germplasm resource for the remediation of sites contaminated with halogenated hydrocarbons under heavy metal coexistence conditions. Attached Figure Description

[0024] Figure 1 Phylogenetic tree constructed based on the 16S rRNA gene sequences of the Y2 strain and representative strains of the genus *Dehalogenated Coccidia* of this invention.

[0025] Figure 2 This is a high-throughput sequencing relative abundance diagram of the 16S rRNA gene of the Y2 strain of the present invention.

[0026] Figure 3 This is a scanning electron microscope image of the Y2 strain of the present invention.

[0027] Figure 4 The anaerobic reduction dechlorination degradation curves of tetrachloroethylene (a) and trichloroethylene (b) by the Y2 strain of the present invention are shown.

[0028] Figure 5 The Y2 strain of the present invention was used in a 10 mg / L Zn 2+ (a) 25 mg / L Zn 2+ (b) and 50 mg / L Zn 2+ (c) Anaerobic reduction dechlorination degradation curve of tetrachloroethylene under the condition. Detailed Implementation

[0029] The following examples further illustrate specific embodiments of the present invention. It should be noted that these examples are for illustrative purposes only and are not intended to limit the scope of the invention.

[0030] This invention successfully screened and obtained a *Dehalogenated Coccidia* strain Y2 with highly efficient reductive dehalogenation ability for tetrachloroethylene. This strain can rapidly initiate the reductive dehalogenation process of tetrachloroethylene and reduce it to dichloroethylene with significantly reduced toxicity within 10 days. Furthermore, this strain exhibits significant zinc ion tolerance, maintaining its reductive dehalogenation activity for tetrachloroethylene even under zinc ion concentrations as high as 50 mg / L. This strain is suitable for the bioenhanced remediation of sites contaminated with tetrachloroethylene alone, as well as sites contaminated with a combination of tetrachloroethylene and high concentrations of zinc, providing a new microbial resource and an effective technical solution for the remediation of sites with combined contamination.

[0031] Example 1:

[0032] Enrichment of tetrachloroethylene dehalogenation microorganisms resistant to high concentrations of heavy metal zinc

[0033] The inorganic salt culture medium consists of the following components: NaCl 1.0 g / L, MgCl₂•6H₂O 0.5 g / L, KH₂PO₄ 0.2 g / L, NH₄Cl 0.3 g / L, KCl 0.3 g / L, CaCl₂•2H₂O 0.015 g / L, FeCl₂•4H₂O 1.5 mg / L, CoCl₂•6H₂O 190 μg / L, MnCl₂•4H₂O 100 μg / L, ZnCl₂ 70 μg / L, H₃BO₃ 6 μg / L, Na₂MoO₄•2H₂O 36 μg / L, NiCl₂•6H₂O 24 μg / L, CuCl₂•2H₂O 2 μg / L, Na₂SeO₃•5H₂O 6 μg / L, and Na₂WO₄•2H₂O 8. μg / L, resazurin indicator 0.025% (w / v), L-cysteine ​​24 mg / L (0.2 mM), Na2S•9H2O 48 mg / L (0.2 mM), dithiothreitol 77 mg / L (0.5 mM), NaHCO3 2.52 g / L (30 mM), adjust pH to 7.2-7.3 and bring volume to 1 L with water; add multivitamins after sterilization; ready for use.

[0034] The inorganic salt culture medium was supplemented with a complex vitamin, and the final concentrations of the vitamins in the system were: biotin 20 μg / L, folic acid 20 μg / L, pyridoxine hydrochloride 100 μg / L, riboflavin 50 μg / L, thiamine 50 μg / L, pantothenic acid 50 μg / L, nicotinic acid 50 μg / L, and vitamin B12. 12 50 μg / L, p-aminobenzoic acid 50 μg / L, lipoic acid 50 μg / L.

[0035] Dispense 80 mL of the inorganic salt culture medium into a 120 mL serum bottle, add 5 mM acetic acid as the crop carbon source, 10 mL of hydrogen as the electron donor, 8 μL of tetrachloroethylene as the electron acceptor, and add 50 mg / L of Zn. 2+ Two g of river sediment, collected from the Xihe River in Shenyang, Liaoning Province, was inoculated into an anaerobic glove box, sealed with a butyl rubber stopper and an aluminum cap, and cultured statically in the dark at 30°C. The degradation process of tetrachloroethylene was monitored periodically using gas chromatography-flame ionization detector. After complete degradation of tetrachloroethylene, it was transferred to an inorganic salt medium at a ratio of 1 wt% and cultured under the above conditions to obtain an enrichment of tetrachloroethylene-degrading bacteria.

[0036] Example 2:

[0037] (1) Isolation of tetrachloroethylene dehalogenation microorganisms tolerant to high concentrations of heavy metal zinc

[0038] 0.8 mL of the culture medium obtained from the enrichment in Example 1 was transferred to a 120 mL serum bottle containing 80 mL of inorganic salt medium to establish a 10 -2 Dilute the vials and continue diluting to obtain 10 ppm. -4 10 -6 10 -8 10 -10 10 -12 10 -14 Dilution bottles. Then, following the method described in Example 1 above, the dehalogenated microorganisms in different dilution bottles were cultured, and the changes in tetrachloroethylene were monitored periodically. The results showed that 10 -12 The dilution process involved the dehalogenation and conversion of tetrachloroethylene, producing cis-1,2-dichloroethylene and trans-1,2-dichloroethylene. Repeated dilution and separation steps were performed to obtain a pure culture strain, which was named strain Y2.

[0039] (2) Purity and taxonomic identification of strain Y2

[0040] Cells were collected from 5 mL of culture medium by filtration, and genomic DNA of strain Y2 was extracted. PCR amplification was performed using universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-GGTTACCTTGTTACGACTT-3') for the prokaryotic 16S rRNA gene. The amplified products were sent to Anshengda Biotechnology Co., Ltd. for Sanger sequencing. The sequencing results showed no peak overlap, preliminarily confirming that the strain had been purified. The obtained 16S rRNA gene fragment was 1376 bp in length. This sequence was uploaded to NCBI for comparison and analysis. The results showed that strain Y2 had 98.69% sequence homology with the type strain 195 of the genus *Dehaloxyfopsis*, indicating that they belong to the same genus (…). Figure 1 However, strain 195 has not been reported to tolerate high concentrations of the heavy metal zinc. Therefore, strain Y2 is a novel strain belonging to the genus *Dehalogenated Coccidia*. Currently, only one species, *McCarthyella*, has been reported in the genus *Dehalogenated Coccidia*, so strain Y2 belongs to the species *McCarthyella* of the genus *Dehalogenated Coccidia*. Dehalococcoides mccartyi The 16S rRNA gene sequence of strain Y2 is as follows:

[0041] 5'-CTCGGCGACTGCCTCCTTGCGGTTGGCACATCGACTTCAAGTGTTACCGGC

[0042]

[0043] Five mL of Y2 strain culture medium was collected by filtration, and genomic DNA was extracted. The DNA was then sent to Anshengda Biotechnology Co., Ltd. for high-throughput 16S rRNA sequencing. The results showed that 99.63% of the sample was *Dehalogenated Bacteroides*, and the remaining components were due to errors during the sequencing process. This further confirmed that a pure culture of Y2 strain had been obtained. Figure 2 ).

[0044] Meanwhile, the obtained Y2 strain bacterial suspension was centrifuged at 15000 g for 15 minutes at 4℃ to collect cells in the logarithmic growth phase; immediately transferred to 2.5% glutaraldehyde solution for fixation, placed in a 4℃ refrigerator for 24 hours, the glutaraldehyde solution was discarded, and the sample was rinsed three times with 0.1M phosphate buffer (pH 7.0) for 15 minutes each time; the sample was fixed with 1% osmium tetroxide solution for 2 hours, the osmium tetroxide waste was carefully removed, and then rinsed three times with 0.1M phosphate buffer (pH 7.4) for 15 minutes each time; the sample was dehydrated with a gradient concentration of ethanol (30%, 50%, 70%, 80%, 90%, 95%) for 15 minutes at each concentration, then treated with 100% ethanol for 20 minutes, and finally, fresh 100% ethanol was used; the sample was dried in a critical point desiccator; the sample was fixed on the sample stage using conductive carbon gel, and sputtered with Pt for 120 seconds using an ion sputtering instrument; the bacterial morphology was observed under a scanning electron microscope. The results show that ( Figure 3 The cells of the strain isolated in the above steps were disc-shaped, with a diameter of 0.3~0.4μm, and lacked flagella and pili. The morphology of strain Y2 was consistent with that of previously reported *Dehalogenated Coccidia*, further confirming that strain Y2 belonged to the genus *McCarchari*.

[0045] The dehalogenated *Typhaeidae* strain Y2 was deposited on December 25, 2023, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China, accession number: CGMCC No. 40795.

[0046] Example 3: Test of the reductive dehalogenation ability of strain Y2 against halogenated hydrocarbon pollutants

[0047] The Y2 strain obtained by isolation and purification in the above examples was inoculated at 3% (v / v) into a 120 mL serum bottle containing 80 mL inorganic salt medium. 5 mM acetic acid was added as a carbon source, 10 mL hydrogen as an electron donor, and 6 μL tetrachloroethylene as an electron acceptor. The culture was then incubated in the dark at 30°C.

[0048] Tetrachloroethylene and its reduction dehalogenation products were detected by gas chromatography with a tandem flame ionization detector (GC-FID), and separated by an Agilent DB-624 capillary column.

[0049] Using Henry's Law to convert between the concentration and amount of substance in the liquid phase:

[0050] M=C a ×(V a +V g ×H cc )

[0051] Where M is the amount of substance, C a V is the liquid phase concentration. a V is the volume of the liquid phase. g H is the volume of the gas phase. cc is the dimensionless Henry's constant, and is the ratio of gas phase concentration to liquid phase concentration.

[0052] The results showed that strain Y2 could dehalogenate 49.1 μmol of tetrachloroethylene to cis-1,2-dichloroethylene and trans-1,2-dichloroethylene via trichloroethylene reduction within 10 days, with a constant ratio of approximately 6. Figure 4 Due to the high toxicity determined by high halogen substitution, most reported dehalogenated *Streptococcus* strains cannot directly utilize tetrachloroethylene as an electron acceptor for respiratory growth. Strain Y2, however, not only directly utilizes tetrachloroethylene, but also exhibits a faster ability to reduce and dehalogenate tetrachloroethylene compared to a few other dehalogenated *Streptococcus* strains that can utilize tetrachloroethylene (Table 1), achieving complete conversion of tetrachloroethylene in approximately one week. Using trichloroethylene as an electron donor, strain Y2 can reduce and dehalogenate 51.7 μmol of trichloroethylene to cis-1,2-dichloroethylene and trans-1,2-dichloroethylene within 12 days, with a ratio of 6. Furthermore, strain Y2 can achieve further degradation in the presence of heavy metals, as shown in Example 4.

[0053] Table 1 compares the reported dechlorination capabilities of dehalogenated *Streptococcus* strains for vinyl chloride.

[0054]

[0055] a Monochloroethylene is the end product of respiratory metabolism, while ethylene is a co-metabolite, producing no energy.

[0056] b Tetrachloroethylene can be cometodegraded in the presence of trichloroethylene.

[0057] "——” It has no ability to reduce and dechlorinate with tetrachloroethylene.

[0058] Example 4: Y2 strain in high concentration of Zn 2+ Test of the reducing dehalogenation capacity of tetrachloroethylene under certain conditions

[0059] The Y2 strain isolated and purified in the above examples was inoculated at 3% (v / v) into a 120 mL serum bottle containing 80 mL of inorganic salt medium. 5 mM acetic acid was added as a carbon source, 10 mL of hydrogen gas as an electron donor, and 5 μL of tetrachloroethylene (49.1 μmol) as an electron acceptor. Additionally, 10 mg / L, 25 mg / L, and 50 mg / L Zn were added. 2+ Incubate in the dark at 30°C.

[0060] The results showed that at 10 mg / L Zn 2+ Under the given conditions, strain Y2 was able to reduce and dehalogenate 49.1 μmol of tetrachloroethylene to a mixture of cis-1,2-dichloroethylene and trans-1,2-dichloroethylene within 20 days. Figure 5 a) at 25 mg / L Zn 2+ Under the given conditions, strain Y2 was able to reduce and dehalogenate tetrachloroethylene to a mixture of cis-1,2-dichloroethylene and trans-1,2-dichloroethylene within 30 days. Figure 5 b) At 50 mg / L Zn 2+ Under the given conditions, strain Y2, after a lag period of approximately one month, can still reduce and dehalogenate tetrachloroethylene to a mixture of cis-1,2-dichloroethylene and trans-1,2-dichloroethylene within 70 days. Figure 5 c).

[0061] As can be seen from the above, the Y2 strain described in this invention can withstand concentrations up to 50 mg / L Zn. 2+ Under the presence of certain conditions, tetrachloroethylene / trichloroethylene is reduced and dechlorinated to dichloroethylene / ethylene, while Zn... 2+ At concentrations below 25 mg / L, strain Y2 exhibited stronger tolerance and dechlorination ability with vinyl chloride reduction, thus strain Y2 is a novel strain that distinguishes it from other dehalogenated Streptococcus strains.

[0062] In addition, the Y2 strain described in this invention also exhibited resistance to high concentrations of Cd. 2+ (0-100 mg / L), Cu 2+ Tolerance to (0-50 mg / L). The above-described embodiments are several implementations of the present invention and should not be construed as limiting the scope of the present invention. Various improvements can be made without departing from the concept of the present invention, and all such improvements are within the scope of protection of the present invention.

Claims

1. A heavy metal-tolerant dehalogenated *Streptococcus* strain, characterized by: Dehalogenated cocci Dehalococcoides mccartyi Strain Y2 was deposited on December 25, 2023, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 40795.

2. The application of the dehalogenated *Streptococcus* according to claim 1, characterized in that: Application of the dehalogenated Streptococcus Y2 strain in the bioremediation of halohydrocarbon pollution; Alternatively, the application of the dehalogenated *Streptococcus* Y2 strain in the bioremediation of halohydrocarbon pollution under heavy metal stress; The heavy metal is zinc; the halogenated hydrocarbon is tetrachloroethylene and / or trichloroethylene.

3. A remediation microbial agent for halogenated hydrocarbon contamination, characterized in that: The bacterial agent contains the dehalogenated *Streptococcus* Y2 strain as described in claim 1.

4. The microbial agent according to claim 3, characterized in that: The bacterial agent is one or more of the following: culture of strain Y2, bacterial suspension, and concentrated solution.

5. The application of the remediation microbial agent according to claim 3, characterized in that: The application of the bacterial agent in the remediation of halogenated hydrocarbons in sites contaminated with a combination of heavy metals and halogenated hydrocarbons. The heavy metal is zinc; the halogenated hydrocarbon is tetrachloroethylene and / or trichloroethylene.

6. A method for bioremediation of haloalkanes under heavy metal stress, characterized in that: Inoculate the dehalogenated *Typhaeidae* strain Y2 of claim 1 or the bacterial agent of claim 3 into the anaerobic environment to be treated; the inoculation amount is 1-10%. The heavy metal is zinc; the halogenated hydrocarbon is tetrachloroethylene and / or trichloroethylene.

7. The method for bioremediation of haloalkanes under heavy metal stress according to claim 6, characterized in that: The anaerobic environment to be treated also includes a carbon source and an electron donor, which can bioremediate and degrade halogenated hydrocarbon pollutants in the presence of heavy metals; the amount of carbon source added is 5 μM-10 mM, and the amount of electron donor added is 0.6 nM-0.8 mM.

8. The method for bioremediation of haloalkanes under heavy metal stress according to claim 7, characterized in that: The carbon source is acetic acid; the electron donor is hydrogen.

Citation Information

Patent Citations

  • Geobacteraceae sulferreducens Geo-LYY strain for dehalogenation of halogenated organic compounds and dye decoloration and application thereof

    CN111269854A

  • Microbial regeneration method of biochar adsorbing trichloroethylene

    CN118002105A