Cbulbd19 gene for regulating catalpa bungei root development and nitrogen absorption and utilization and application thereof
By cloning and overexpressing the Catalpa CbuLBD19 gene and regulating its expression to reduce root development and nitrogen absorption, the problem of low nitrogen utilization efficiency in Catalpa was solved, achieving genetic improvement and rapid growth and high yield of Catalpa.
Patent Information
- Application Number
- CN202511827518.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-05
- Publication Date
- 2026-04-10
- Estimated Expiration
- 2045-12-05
AI Technical Summary
Catalpa trees have low nitrogen use efficiency, which limits their rapid growth and high yield. The function of the LBD gene in perennial trees is still unclear.
The CbuLBD19 gene of Catalpa bungei was cloned, an overexpression vector was constructed, and transgenic plants were obtained by Agrobacterium-mediated transformation. The negative regulation of root development and nitrogen uptake was verified. Recombinant expression vectors and engineered bacteria were provided to regulate the expression of CbuLBD19 gene to reduce root length, net nitrate uptake rate, NR activity, and amino acid content.
The function of CbuLBD19 in negatively regulating root development and nitrogen absorption in Catalpa bungei was clarified, providing a technical path for improving nitrogen efficiency in Catalpa bungei through gene editing and cultivating new germplasm with more developed roots and stronger nitrogen absorption capacity.
Smart Images

Figure CN121344004B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of forest tree genetic engineering breeding, and more particularly relates to a CbuLBD19 gene for regulating root development and nitrogen absorption and utilization of Catalpa bungeana and application thereof. BACKGROUND
[0002] Plant root architecture is a key agronomic trait determining its anchorage, nutrient and water uptake efficiency. For Catalpa bungeana, a forest tree with high economic and ecological value, the development status of root system is directly related to its growth rate and biomass accumulation. In actual production, low nitrogen utilization efficiency is one of the main bottlenecks limiting the fast growth and high yield of Catalpa bungeana. Therefore, from the genetic level, analyzing and improving the regulation mechanism of root development has become an important issue in forest tree breeding.
[0003] In the complex regulation network of plant root formation, the LBD transcription factor family is recognized as a key regulatory factor. The members of this family have diverse functions and obvious functional differentiation among species. For example, in herbaceous model plants, AtLBD37 / 38 / 39 of Arabidopsis thaliana is reported to function as a negative regulatory factor of nitrogen metabolism, while TaLBD41 in the grass crop wheat is proved to positively regulate root growth and nitrogen uptake efficiency, and its silencing leads to shorter roots and lower nitrogen assimilation capacity. At present, most of the related researches focus on annual herbaceous crops, while in perennial trees, especially in Catalpa bungeana, the functional research of LBD genes is almost blank, and whether and how they participate in root morphological formation and nitrogen response are still unclear. SUMMARY
[0004] The application aims to provide a CbuLBD19 gene for regulating root development and nitrogen absorption and utilization of Catalpa bungeana and application thereof, so as to solve the above technical problems.
[0005] To achieve the above-mentioned purpose, the application adopts the following technical solutions:
[0006] The application provides a CbuLBD19 gene for regulating root development and nitrogen absorption and utilization of Catalpa bungeana, and the nucleotide sequence of the CbuLBD19 gene is shown in SEQ ID NO. 7.
[0007] The application successfully constructs an overexpression vector by cloning the CbuLBD19 gene of Malus hallings and obtains a transgenic plant by using an agrobacterium-mediated method; the function verification result shows that, compared with a wild type, the total root length, root biomass, net nitrate ion absorption rate, NR activity and amino acid content of the CbuLBD19 overexpression strain are significantly reduced, and the key role of CbuLBD19 in negatively regulating the root development and nitrogen absorption and assimilation of Malus hallings is fully confirmed, which provides a firm experimental evidence and feasible technical scheme for improving the nitrogen efficiency of Malus hallings by regulating the expression of the gene.
[0008] The application also provides a recombinant expression vector comprising the CbuLBD19 gene of Malus hallings.
[0009] Further, the vector is obtained by inserting the CbuLBD19 gene of Malus hallings into an endonuclease site of a pCAMBIA1302 vector. Nco I
[0010] The application also provides a recombinant engineering bacterium comprising the recombinant expression vector.
[0011] Further, the recombinant engineering bacterium is obtained by transforming the recombinant expression vector into an agrobacterium competent cell EHA105.
[0012] The application provides application of the CbuLBD19 gene of Malus hallings, the recombinant expression vector or the recombinant engineering bacterium in regulating the root development of a plant.
[0013] Further, the regulation of the root development of a plant is to reduce the root length of a plant by improving the expression of the CbuLBD19 gene of Malus hallings.
[0014] The application provides application of the CbuLBD19 gene of Malus hallings, the recombinant expression vector or the recombinant engineering bacterium in regulating the nitrogen absorption and utilization of a plant root.
[0015] Further, the regulation of the nitrogen absorption and utilization of a plant root is to reduce the net nitrate ion absorption rate, NR activity and amino acid content of a plant root by improving the expression of the CbuLBD19 gene of Malus hallings.
[0016] The application at least has the following beneficial effects:
[0017] Newly found gene function: the application firstly proves by experiments that CbuLBD19 is a key gene for negatively regulating the root development and nitrogen absorption and utilization of Malus hallings under high nitrogen induction, which provides a new perspective for understanding the molecular mechanism of the nitrogen response of Malus hallings.
[0018] Provide clear technical path: the invention through the creation of CbuLBD19 overexpression strain, and combined with the analysis of phenotype and physiological index (including root morphology, nitrate ion net absorption rate, NR activity and amino acid content), it is proved that the gene has negative regulation function. This discovery directly suggests a feasible genetic improvement technology route: through antisense RNA, RNA interference or gene editing technology to reduce the expression of endogenous CbuLBD19 of catalpa, it is expected to cultivate new germplasm of catalpa with more developed root system and stronger nitrogen absorption capacity.
[0019] Application potential is huge: the invention provides valuable gene resources and clear operation target for molecular breeding of catalpa, which has important significance for solving the bottleneck problem of low nitrogen utilization efficiency in catalpa production and realizing fast growth and high yield. BRIEF DESCRIPTION OF DRAWINGS
[0020] Figure 1 Figure is the transcript level diagram of CbuLBD19 in wild type catalpa roots under different nitrogen supply levels.
[0021] Figure 2 Figure is the full-length cDNA cloning result diagram of CbuLBD19 gene.
[0022] Figure 3 Figure is the DNA and RNA identification of CbuLBD9 overexpression strain, wherein A is the DNA identification result of CbuLBD9 gene overexpression strain, and B is the RNA expression level identification result of CbuLBD9 gene overexpression strain.
[0023] Figure 4 Figure is the morphological feature comparison diagram of WT and CbuLBD19 overexpression catalpa, wherein A is the phenotype diagram of CbuLBD19 overexpression catalpa, B is the total root length statistical diagram, and C is the root biomass statistical diagram.
[0024] Figure 5 Figure is the comparison and analysis diagram of nitrate ion net absorption rate of WT and CbuLBD19 overexpression catalpa.
[0025] Figure 6 Figure is the comparison and analysis diagram of NR activity and AA content of WT and CbuLBD19 overexpression catalpa, wherein A is the NR activity statistical analysis diagram, and B is the AA content statistical analysis diagram. DETAILED DESCRIPTION
[0026] The invention will be described in detail below with specific examples, but should not be understood as a limitation of the invention. If not specially stated, the technical means used in the following examples are the conventional means familiar to those skilled in the art, and the materials, reagents, etc. used in the following examples, if not specially stated, can be obtained from commercial channels.
[0027] The transgenic material used in the following examples is a semi-sib family of Malus hallings, collected from the Malus hallings germplasm garden of the Institute of Botany, Chinese Academy of Sciences in Jiangsu Province. The plant overexpression vector pCAMBIA1302 was purchased from Wuhan Moliang Biotechnology Co., Ltd., and pMD19-T was purchased from Baorai Medical Biotechnology (Beijing) Co., Ltd.
[0028] Malus hallings co-culture medium: MS medium (M519, PhytoTech, Lenexa, USA) 4.43 g / L + sucrose 30 g / L + gel 3 g / L, pH 5.8, 121 ℃ high-temperature high-pressure sterilization for 20 min.
[0029] CbuLBD19 overexpression Malus hallings selection medium: DKW medium (D2470, PhytoTech, Lenexa, USA) 5.32 g / L + 6-benzylaminopurine 0.6 mg / L + 1-naphthalene acetic acid 0.15 mg / L + sucrose 30 g / L + Gelzan™ CM gellan gum (G1910, Sigma) 3 g / L, pH 5.8, 121 ℃ high-temperature high-pressure sterilization for 20 min, then add zeatin 0.2 mg / L, Timentin (SL4080, purchased from Beijing Coolab Technology Co., Ltd.) 200 mg / L and hygromycin 1 mg / L.
[0030] Malus hallings proliferation medium: DKW medium 5.32 g / L + 6-benzylaminopurine 0.6 mg / L + 1-naphthalene acetic acid 0.15 mg / L + sucrose 30 g / L + Gelzan™ CM gellan gum 3 g / L, pH 5.8, 121 ℃ high-temperature high-pressure sterilization for 20 min, then add zeatin 0.2 mg / L.
[0031] Malus hallings rooting medium: DKW medium 5.32 g / L + 3-indolebutyric acid 0.15 mg / L + 1-naphthalene acetic acid 0.15 mg / L + sucrose 20 g / L + Gelzan™ CM gellan gum 3 g / L, pH 5.8, 121 ℃ high-temperature high-pressure sterilization for 20 min, then add zeatin 0.2 mg / L and 200 mg / L Timentin.
[0032] Example 1: Changes in CbuLBD19 expression under different nitrogen supply levels.
[0033] 1. Nitrogen treatment: In the artificial climate chamber (day / night temperature: 25 / 18 ℃; relative air humidity: 50%~60%; 14 hours of light per day; photosynthetic photon flux: 150 μmol·m -2 ·s -1 ), wild-type Malus hallings was treated with normal nitrogen (NN, 2 mM KNO3) and low nitrogen (LN, 0.2 mM KNO3) using a hydroponic system, and the treatment time was 21 d.
[0034] 2. Total RNA extraction and reverse transcription: The total RNA was extracted from the treated young roots of Malus hallings using Trizol method, and then reverse transcribed into cDNA using PrimeScriptTM 1st Strand cDNA Synthesis Kit.
[0035] 3. Real-time fluorescent quantitative PCR (RT-qPCR): The qPCR specific primers of CbuLBD19 gene and internal reference gene were designed, the sequence of the upstream primer CbuLBD19-qPCR-F is shown as SEQ ID NO. 1, the sequence of the downstream primer CbuLBD19-qPCR-R is shown as SEQ ID NO. 2, the sequence of the upstream primer CbuActin-F is shown as SEQ ID NO. 3, and the sequence of the downstream primer CbuActin-R is shown as SEQ ID NO. 4.
[0036] SEQ ID NO. 1: TGCTATTTGAAGCTGCCGGA.
[0037] SEQ ID NO. 2: TGTGCACTCAGAAGCATCGT.
[0038] SEQ ID NO. 3: GATGATGCTCCAAGGGCTGT.
[0039] SEQ ID NO. 4: TCCATATCATCCCAGTTGCT.
[0040] The cDNA obtained by reverse transcription was diluted 5 times with sterile water, and then the RT-qPCR reaction was performed according to the instructions of the RT-qPCR kit (MF787-NR-01, Beijing Junxing Biotechnology Co., Ltd.). Figure 1 The results show that under the low nitrogen concentration culture condition, the transcript level of the gene CbuLBD19 in the wild type of Malus hallings is significantly decreased.
[0041] Example 2: Cloning of Malus hallings CbuLBD19 gene and construction of gene overexpression plasmid and recombinant agrobacterium.
[0042] 1. Cloning of the Catalpa 'CbuLBD19' gene and construction of the pMD19-T vector: Using young roots of Catalpa 'CbuLBD19' as material, total RNA was extracted using the Trizol method, and then reverse transcribed into cDNA using the PrimeScript™ 1st Strand cDNA Synthesis Kit. Specific primers for the CbuLBD19 gene were designed. The sequence of the upstream primer CbuLBD19-F is shown in SEQ ID NO. 5, and the sequence of the downstream primer CbuLBD19-R is shown in SEQ ID NO. 6.
[0043] SEQ ID NO. 5: ATGAGTTGCAATGGCTGCCGT.
[0044] SEQ ID NO. 6: AGCGATGGGCTTCCGCGT.
[0045] PCR amplification was performed using cDNA as a template, such as Figure 2 As shown, the amplified target fragment of approximately 560 bp was recovered via gel electrophoresis. Following the instructions of the cloning kit (6013, Takara, Beijing, China), the recovered product was ligated into the pMD19-T vector, and gene sequencing was performed. The sequenced sequence was compared with the genome sequence. The coding region of the cloned CbuLBD19 gene is 561 bp in length, as shown in SEQ ID NO.7. The amino acid sequence of the expressed protein is shown in SEQ ID NO.8, and its molecular weight is 20.4 kDa. The successfully constructed positive plasmid was named pMD19-T-CbuLBD19.
[0046] SEQ ID NO. 7: ATGAGTTGCAATGGCTGCCGTGTTCTTCGAAAGGGTTGCAGCGAGAACTGTATTTTAAGGGCCTGTTTACAGTGGATTGAGAGTGCAGAAGCACAAGGCCATGCCACGATCTTCGTTGCCAAGTTCTTCGGCCGTGCCGGCCTCATGTCCTTCATCTCCGCTGTTCCGGAAAATCAAAGACCTGCTCTTTTTCAGTCTCTGCTATTTGAAGCTGCCGGAAGAACAGTAAATCCCGTAAATGGGGCCGCGGGGCTTTTGTGGACCGGAAATTGGCACGTCTGCAAAGCAGCGGTGGAGGCTGTCCTCCGCGGCGGCACGTTGAAGCCAATTCCAGAGTTTCTCGGCGATCCATCGGAGCCTGACGATGCTTCTGAGTGCACAGACATGTTCGAACTCCAAGATCCTGACCTTAGTCCACGGCAGAAACGCCGCCGTTTTCCGGATGAGCCGGCGAAGATTATGCAGTTAGCTGATCTTGATCTCAGCTTAACACCAGGGTTTTCTTGGCAAGAAAAGGAACCCTTCACCGGAGAAGCGGCGACGCGGAAGCCCATCGCTTAA.
[0047] SEQ ID NO. 8: MSCNGCRVLRKGCSENCILRACLQWIESAEAQGHATIFVAKFFGRAGLMSFISAVPENQRPALFQSLLFEAAGRTVNPVNGAAGLLWTGNWHVCKAAVEAVLRGGTLKPIPEFLGDPSEPDDASECTDMFELQDPDLSPRQKRRRFPDEPAKIMQLADLDLSLTPGFSWQEKEPFTGEAATRKPIA.
[0048] 2. Construction of CbuLBD19 gene overexpression plasmid and Agrobacterium transformation: CbuLBD19 gene amplification primers containing pCAMBIA1302 vector homologous arms were designed, the sequence of the upstream primer CbuLBD19-OE-F is shown in SEQ ID NO. 9, and the sequence of the downstream primer CbuLBD19-OE-R is shown in SEQ ID NO. 10.
[0049] SEQ ID NO. 9: CACGGGGGACTCTTGACATGAGTTGCAATGGCTGCCGT.
[0050] SEQ ID NO. 10: TCTCCTTTACTAGTCAGATCTACCATGCCAGCGATGGGCTTCCGCGT.
[0051] PCR reaction was performed using the plasmid pMD19-T-CbuLBD19 as template and primers CbuLBD19-OE-F and CbuLBD19-OE-R. The target fragment was recovered after agarose gel electrophoresis detection. The QuickCut™ Nco The pCAMBIA1302 vector was single-enzyme cut by I (1620, Takara, Beijing, China) endonuclease. Then, the target fragment was ligated with the enzyme-cut pCAMBIA1302 vector by homologous recombination. The successfully constructed vector was transformed into DH5a E. coli by heat shock method, and the single colony with normal growth was picked for sequencing. The obtained overexpression plasmid containing the target gene CbuLBD19 was transformed into Agrobacterium EHA105 by freeze-thaw method, and then the bacterial solution was spread on LB solid medium (containing 50 mg / L kanamycin and 25 mg / L rifampicin). The single colony was picked and verified by bacterial solution PCR using vector primers. After agarose gel electrophoresis detection, the bacterial solution with correct band was selected, glycerol was added, and it was stored in a -80°C refrigerator for standby use.
[0052] Example 3: Obtaining CbuLBD19 overexpression plant of Malus hallings.
[0053] 1. CbuLBD19 overexpression Malus hallings genetic transformation steps: The obtained CbuLBD19 overexpression recombinant Agrobacterium EHA105 was activated, and the single colony was picked and added to LB liquid medium (containing 50 mg / L kanamycin and 25 mg / L rifampicin) and 10 μM acetyl-syringone (As) to culture to OD600=1.25. Resuspend the solution was prepared: 100 mL sterile water + 10 mM MgCl2+ 10 mM MES + 10 μM As solution.
[0054] Resuspend the bacteria with the resuspension solution, adjust the resuspension solution OD600 concentration to 0.65, and activate at room temperature for 3 h in the dark. Place the Malus hallings callus in the activated resuspension solution, incubate at 28°C, 120 rpm for 15 min, then dry the callus surface with sterile paper, and culture on the co-culture medium for 2 days. Then transfer to CbuLBD19 overexpression Malus hallings selection medium for culture, replace the medium every three weeks, wait for sprouting, and transfer to rooting medium for rooting after sprouting.
[0055] 2, CbuLBD19 overexpression Sorbus pohuashii strain identification and screening: the use of SDS method and Trizol method extraction overexpression Sorbus pohuashii and wild type Sorbus pohuashii plant leaves DNA and total RNA. Design CbuLBD19 overexpression Sorbus pohuashii strain identification primer, pCAMBIA1302-CbuLBD19-jd-F sequence as shown in SEQ ID NO. 11, pCAMBIA1302-CbuLBD19-jd-R sequence as shown in SEQ ID NO. 12.
[0056] SEQ ID NO. 11: CTGACGTAAGGGATGACGCA.
[0057] SEQ ID NO. 12: CTTAGCGAGGAAGACGGTGG.
[0058] With leaf DNA as template, using identification primer pCAMBIA1302-CbuLBD19-jd-F and pCAMBIA1302-CbuLBD19-jd-R PCR, identification of CbuLBD19 overexpression transgenic plants. Positive control is CbuLBD19 overexpression recombinant vector plasmid, negative control is wild type Sorbus pohuashii plant (WT), blank is water. As shown in Figure 1A, at the DNA level, five CbuLBD19 overexpression positive strains were identified. CbuLBD19-OE1, CbuLBD19-OE3, CbuLBD19-OE5, CbuLBD19-OE6 and CbuLBD19-OE8. Figure 3
[0059] CbuLBD19 overexpression Sorbus pohuashii CbuLBD19-OE1, CbuLBD19-OE3, CbuLBD19-OE5, CbuLBD19-OE6 and CbuLBD19-OE8. And wild type Sorbus pohuashii (WT) cDNA as template, CbuLBD19-qPCR-F and CbuLBD19-qPCR-R as primer for fluorescent quantitative PCR. Identification of CbuLBD19 overexpression Sorbus pohuashii different transgenic strains CbuLBD19 relative expression amount. CbuActin as internal reference gene. As shown in Figure 1B, at the RNA level, three CbuLBD19 overexpression strains with higher expression were identified by gene expression, CbuLBD19-OE3, CbuLBD19-OE5 and CbuLBD19-OE6. The selected transgenic strains were subcultured in the proliferation medium without antibiotics. Figure 3
[0060] Wild-type Catalpa trees and Catalpa trees overexpressing CbuLBD19 with similar root growth were selected and hydroponically cultured in an artificial climate chamber using LA nutrient solution. After six weeks of culture, root samples were harvested, weighed, and their fresh weight recorded. The harvested samples were placed in foil bags and immediately frozen in liquid nitrogen. The frozen samples were then ground into a fine powder using a ball mill and stored at -80°C for further analysis.
[0061] Example 4: Functional verification of the Catalpa tree CbuLBD19 gene.
[0062] Root morphology characteristics determination: 1g root samples were collected and root scanning analysis was performed using the WinRHIZO root analysis system (WinRHIZO version 2012b, Regent Instruments Canada, Montreal, Canada). Figure 4 It can be seen that, compared with WT, the total root length and root biomass of the overexpression lines were significantly reduced.
[0063] Net nitrate ion uptake rate determination: White fine roots with a diameter of 1.5 mm were selected and measured using a non-destructive microelectrode technique (NMT-YG-100, Younger USA LLC, Amherst, MA, USA). A fine root was transferred to a petri dish containing 10 ml of measurement solution (0.1 mM CaCl2, pH 6.0) and 2 mM KNO3 was added, followed by equilibration for 20 min. Before measurement, the equilibrated root was transferred to a new petri dish containing fresh measurement solution. Recordings were taken for 5 min at each site. Figure 5 It can be seen that, compared with WT, the net nitrate uptake rate of CbuLBD19 overexpression lines was significantly reduced, indicating that CbuLBD19 inhibits nitrogen uptake in Catalpa bungei.
[0064] NR activity assay: Assay was performed using a nitrate reductase (NR) kit (BC0085, Solarbio, Beijing, China). Figure 6 As can be seen from A, CbuLBD19 overexpression inhibits NR activity in plants.
[0065] Amino acid (AA) concentration determination: The concentration was determined according to the instructions of the amino acid content determination kit (AA-1-W, Comin, Suzhou, China). AA content can reflect changes in nitrogen metabolism in plants. Figure 6 The results of the B assay showed that CbuLBD19 overexpression also inhibited the AA content in the plant.
[0066] It is to be understood that the numerical ranges recited in the claims are intended to include every integer value within the range and any fraction of the values within the range. In other words, the numerical ranges are intended to include every value from the lower limit to the upper limit, inclusive of the lower and upper limits, as well as any intervening incremental values. Preferred embodiments of the application are described herein.
[0067] Although preferred embodiments of the application have been described herein, it will be apparent to those skilled in the art that various modifications and changes can be made without departing from the spirit and scope of the application. Accordingly, it is intended that all claims be interpreted to include all equivalent processes, procedures, compositions, and compounds that fall within the scope of the claims. The following examples are provided to further illustrate the application.
[0068] Obviously, numerous modifications and variations of the present application are possible in light of the above teachings. It is therefore to be understood that within the scope of the appended claims and their equivalents, the application can be practiced otherwise than as specifically described herein.
Claims
1. A Malus hupehensis CbuLBD19 gene, characterized in that, The nucleotide sequence of the CbuLBD19 gene is shown as SEQ ID NO.
7.
2. A recombinant expression vector, characterized in that, The application further provides a plant containing the CbuLBD19 gene.
3. The recombinant expression vector of claim 2, wherein, is the pCAMBIA1302 vector into which the Schisandra CbuLBD19 gene is inserted Nco I endonuclease sites are obtained.
4. A recombinant engineered bacterium, characterized in that, The recombinant engineering bacteria contain the recombinant expression vector.
5. The recombineering bacteria of claim 4, wherein, The recombinant expression vector is transformed into the Agrobacterium competent cell EHA105.
6. The application of Catalpa bungeana CbuLBD19 gene of claim 1, the recombinant expression vector of claim 2 or the recombinant engineering bacteria of claim 4 in reducing the root length and root biomass of Catalpa bungeana, characterized in that, The reduction of the root length and root biomass of the Catalpa bungeana is achieved by increasing the expression of the CbuLBD19 gene.
7. The application of Catalpa bungei CbuLBD19 gene of claim 1, the recombinant expression vector of claim 2 or the recombinant engineering bacteria of claim 4 in reducing the net absorption rate of nitrate ion, nitrate reductase activity and amino acid content of Catalpa bungei root system, characterized in that, The reduction of the nitrate ion net absorption rate, nitrate reductase activity and amino acid content of the root system of the Catalpa bungeana is achieved by increasing the expression of the CbuLBD19 gene.
Citation Information
Patent Citations
Key gene CbWRKY27 for regulating adventitious root generation of catalpa bungei and application of key gene CbWRKY27
CN116574738A
PagPB gene for regulating and controlling woody plant root system to absorb and utilize nitrogen and application of PagPB gene
CN119082132A