Recombinant lactic acid bacteria and application thereof in anti-streptococcus iniae disease vaccine
By expressing α-enolase protein from Streptococcus dolphinus through recombinant lactic acid bacteria, the problem of prevention and control of streptococcal disease in dolphins has been solved, achieving efficient immune protection and vaccine delivery, and providing new technologies for green biological feed and oral vaccines.
Patent Information
- Application Number
- CN202511599974.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-04
- Publication Date
- 2026-01-20
AI Technical Summary
There is a lack of effective methods to prevent and control streptococcal disease in dolphins, which causes significant losses to aquaculture, and conventional vaccine delivery methods are either costly or ineffective.
Recombinant lactic acid bacteria were used as a heterologous expression vector to express Streptococcus dolphin α-enolase (ENO) protein, and the vaccine was delivered orally to enhance the immunity and resistance of fish.
It significantly enhances fish resistance to Streptococcus dolphinii, effectively prevents related diseases, improves fish immunity, and provides new technical ideas for the development of green biological feed and oral vaccines.
Smart Images
Figure CN121362716A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a recombinant lactic acid bacteria and its application in an anti-dolphin streptococcal vaccine. Background Technology
[0002] my country is the world's largest aquaculture producer. With the upgrading of aquaculture models and the continuous increase in farming techniques and stocking densities, many diseases are threatening our aquaculture production, causing incalculable losses. Dolphin streptococcal disease is one such example, highly pathogenic to more than twenty species of fish, including tilapia, rainbow trout, and grouper, leading to mass mortality. Therefore, research on prevention and control measures related to dolphin streptococcus is receiving increasing attention.
[0003] Lactic acid bacteria are recognized as green and safe microorganisms, and are now widely used in the food processing industry. Because they naturally possess certain antibacterial activity, can colonize the gut to help improve digestive function, and are harmless to fish, they are naturally suitable as candidate bacteria for novel, safe protein expression and delivery systems. Using lactic acid bacteria as a heterologous expression vector for vaccines means that administration can be done orally, avoiding the high cost of injection immunization or the less effective results of immersion immunization.
[0004] Lactic acid bacteria ( lactic acid bacteria Lactic acid bacteria (LAB) are a collective term for a class of bacteria that can utilize fermentable carbohydrates to produce large amounts of lactic acid. These bacteria are extremely widespread in nature, exhibiting rich species diversity, comprising at least 18 genera and over 200 species. With very few exceptions, the vast majority are essential bacteria in the human body, playing vital physiological roles and widely present in the human gut. Extensive research indicates that lactic acid bacteria can promote animal growth, regulate normal gut flora, maintain microecological balance, thereby improving gastrointestinal function; enhance food digestibility and bioavailability; lower serum cholesterol and control endotoxins; inhibit the growth of putrefactive bacteria in the intestine; and improve immunity. Lactic acid bacteria are not only ideal materials for research in taxonomy, biochemistry, genetics, molecular biology, and genetic engineering, but also have extremely high application value in important fields closely related to human life, such as industry, agriculture, animal husbandry, food, and medicine. Currently, research on lactic acid bacteria for vaccine applications mainly focuses on humans or livestock, with few studies using them as heterologous expression vectors in aquaculture. Unlike conventional vaccines, which are delivered via injection or immersion, lactic acid bacteria, being food-grade microorganisms, can be delivered orally as a heterologous expression vector. This method not only reduces vaccine delivery costs but also enhances immunization efficacy because lactic acid bacteria can colonize the gut.
[0005] This study selected α-enolase as the research subject. α-enolase is an important catalytic enzyme in the glycolysis pathway, capable of converting 2-phosphoglycerate (2-PGE) into phosphoenolpyruvate (PEP). Enolase exists in a variety of organisms. In vertebrates, there are α, β, and γ forms, often existing in dimer form; in prokaryotes, α-enolase is the main form, often existing in octamer form. Enolase is not only present in the cytoplasm of many bacteria, but can also be secreted onto the bacterial surface and extracellularly. In this state, it can bind plasminogen, activating the extracellular and intravascular fibrinolytic systems, promoting bacterial invasion into tissues, and playing an important role in disease development. In Streptococcus dolphinii, α-enolase acts as a virulence factor, promoting the degradation of the cytofibrotic layer, thereby accelerating bacterial penetration into the circulatory system. Research on α-enolase has largely focused on its pathogenic mechanisms, and vaccine research has also concentrated on the production of subunit vaccines. This experiment will use lactic acid bacteria to heterologously express Streptococcus dolphinus α-enolase and explore its immune effect. At the same time, it will provide a foundation for the application of lactic acid bacteria as a heterologous expression vector in the aquaculture field. Summary of the Invention
[0006] In view of the above, it is necessary to provide a recombinant lactic acid bacteria and its application in an anti-dolphin streptococcal vaccine. Lactic acid bacteria are a good probiotic, widely used in animal feed, and can colonize the intestine. This application utilizes this strain to express the ENO protein of dolphin streptococcus, in order to solve the pollution problem of dolphin streptococcus in aquaculture, improve the immunity and resistance of aquatic products to dolphin streptococcus, and provide new technical ideas for developing green biological feed, improving fish immunity, and developing oral dolphin streptococcal vaccines.
[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A recombinant lactic acid bacteria, said recombinant lactic acid bacteria having a dolphin-derived Streptococcus dolphin strain. ENO Genes; as described ENO The gene sequence is shown in the sequence listing SEQ ID NO:3.
[0008] The present invention also includes a pharmaceutical composition comprising the recombinant lactic acid bacteria described above.
[0009] Furthermore, the drug is an oral medication.
[0010] The present invention also includes an aquatic feed comprising the recombinant lactic acid bacteria.
[0011] The present invention also includes the use of the recombinant lactic acid bacteria, the pharmaceutical composition, or the aquatic feed in the preparation of products against Streptococcus dolphin infection.
[0012] The application also provides an oral vaccine comprising the recombinant lactic acid bacteria or the pharmaceutical composition.
[0013] The application also provides a feeding method for improving the resistance of fish to Streptococcus iniae, which comprises adding the recombinant lactic acid bacteria to fish feed and feeding the fish.
[0014] Further, the recombinant lactic acid bacteria also comprises nisin.
[0015] The application also provides a method for constructing the recombinant lactic acid bacteria, which comprises the following steps: (1) amplifying the sfGFP gene by using primer pair 1; ENO (2) linking the sfGFP gene to a pET28-His-MCS-X-sfGFP vector to obtain a recombinant plasmid pET28-His-MCS-X-sfGFP- ENO ENO (3) transforming the recombinant plasmid into E. coli DH5α by calcium transformation; (4) amplifying the recombinant plasmid pET28-His-MCS-X-sfGFP- by using primer pair 2; ENO (5) recovering the amplification product of step (4) and connecting it to a plasmid pNZ8148 to obtain a recombinant plasmid pNZ8148- ENO (6) transforming the recombinant plasmid pNZ8148- of step (5) into Lactococcus lactis by electroporation to obtain the recombinant lactic acid bacteria. ENO The upstream sequence of the primer pair 1 is shown in SEQ ID NO: 1, and the downstream sequence is shown in SEQ ID NO: 2. The upstream sequence of the primer pair 2 is shown in SEQ ID NO: 4, and the downstream sequence is shown in SEQ ID NO: 5. The upstream sequence of the primer pair 2 is shown in SEQ ID NO: 4, and the downstream sequence is shown in SEQ ID NO: 5.
[0016] The application has the following beneficial effects: The subject group of the present application has successfully constructed a recombinant lactic acid bacteria by genetic engineering means, which can effectively inhibit the growth of Streptococcus iniae and improve the resistance of fish to Streptococcus iniae. ENO After gene recombination, the full-length ENO protein was successfully expressed in recombinant Lactococcus lactis, and the resistance to S. iniae was significantly improved in fish fed with feed containing the recombinant Lactococcus lactis, which can effectively prevent diseases caused by S. iniae and improve the immunity of fish. The recombinant Lactococcus lactis of the application is a probiotic with the effects of disease resistance and probiotic, which provides a new technical idea for developing green biological feed, improving fish immunity and developing oral S. iniae vaccine. BRIEF DESCRIPTION OF DRAWINGS
[0017] Figure 1 For S. iniae ENO The figure is a PCR amplification diagram of the gene, in which M is DL2000 plus DNA Marker, and 1 is the ENO gene.
[0018] Figure 2 The figure is a Kpn I-Hind III double enzyme digestion test result diagram, in which M is DL2000 plus DNA Marker, and 1 is the Kpn I-Hind III double enzyme digestion product.
[0019] Figure 3 The figure is a Kpn I-Hind III double enzyme digestion test result diagram, in which M is DL2000 plus DNA Marker, and 1 is the Kpn I-Hind III double enzyme digestion product.
[0020] Figure 4 The figure is a SDS-PAGE analysis result diagram of the expression of recombinant rENO protein in Lactococcus lactis, in which M is Colormixed protein marker 180, 1 is recombinant pNZ8148-ENO Lactococcus lactis without induction of inducer nisin, and 2 is recombinant rENO protein expressed by Lactococcus lactis pNZ8148-ENO induced by 30 ng / ml nisin.
[0021] Figure 5 The figure is a WB detection result diagram of ENO-sfGFP protein, in which M is Colormixed protein marker 180, 1 is expressed and purified recombinant ENO protein, 2 is recombinant pNZ8148-ENO Lactococcus lactis without induction of inducer nisin, and 3 is recombinant rENO protein expressed by Lactococcus lactis pNZ8148-ENO induced by 30 ng / ml nisin.
[0022] Figure 6Figure of ELISA detection results of anti-ENO protein antibody level in blood of Tilapia after feeding with recombinant lactic acid bacteria feed, A is the antibody titer of four control groups at 7 days, 14 days and 21 days; B is the OD450 detection results of ELISA experiment at 7 days 450 ; C is the OD450 detection results of ELISA experiment at 14 days; D is the OD450 detection results of ELISA experiment at 21 days. In the figure, ck is the negative control group, Lac is the lactic acid bacteria group, Lac+eno is the lactic acid bacteria group expressing recombinant rENO, and Lac+eno+nisin is the lactic acid bacteria group expressing recombinant rENO + nisin group. 450 ; C is the OD450 detection results of ELISA experiment at 14 days; D is the OD450 detection results of ELISA experiment at 21 days. In the figure, ck is the negative control group, Lac is the lactic acid bacteria group, Lac+eno is the lactic acid bacteria group expressing recombinant rENO, and Lac+eno+nisin is the lactic acid bacteria group expressing recombinant rENO + nisin group.
[0023] Figure 7 Figure of anti-hemagglutination experiment results of serum of Tilapia after feeding with recombinant lactic acid bacteria feed, A is the serum titer; B is the anti-hemagglutination experiment results; In the figure, lactic acid bacteria is the lactic acid bacteria group without feeding recombinant plasmid, Plasmid8148+eno is the lactic acid bacteria group expressing recombinant plasmid pNZ8148- ENO , and nisin indicates that nisin is added in the commercial feed fermented by lactic acid bacteria expressing recombinant rENO.
[0024] Figure 8 Figure of challenge experiment results of Tilapia after feeding with recombinant lactic acid bacteria feed. DETAILED DESCRIPTION
[0025] In order to make the above-mentioned purposes, features and advantages of the present application more apparent and easy to understand, the specific embodiments of the present application will be described in detail below with reference to the accompanying drawings. In the following description, a large number of specific details are set forth in order to facilitate a full understanding of the present application. However, the present application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without departing from the scope of the present application, so the present application is not limited to the specific embodiments disclosed below. Example 1
[0026] Construction of recombinant lactic acid bacteria genetically engineered bacteria: The construction method of the recombinant strain includes the following steps: The starting strain: Lactococcus lactis atcc19435 (purchased from Shanghai Jerabbit Trading Co., Ltd.).
[0027] Preparation method of recombinant plasmid and recombinant lactic acid bacteria: Step 1: Amplify the nucleic acid sequence according to the gene of Streptococcus iniae ENO , design the corresponding primer pet28-eno-F: GGAATTC CAT ATG ATGTCAATTATTACTGATG (underlined is Nde I restriction site, SEQ ID NO: 1) and pet28-eno-R: GG ACT AGT TTTTTAAGGTTGTAGAATG (underlined is Spe I restriction site, SEQ ID NO: 2). The PCR amplification was performed using the genomic DNA of Streptococcus iniae as template ENO Gene: 94℃ pre-denaturation 5 min; 94℃ denaturation 50 s, 55℃ annealing 45 s, 72℃ extension 90 s, 30 cycles; 72℃ final extension 10 min. The PCR product was gel recovered and purified (agarose gel DNA recovery kit, Tianmei Bio, China), and the amplified ENO gene sequence is shown in SEQ ID NO: 3, and the electrophoretogram is shown in Figure 1 , Figure 1 Streptococcus iniae ENO gene, and the electrophoretogram is shown in ENO gene, and the electrophoretogram is shown in ENO gene, and the electrophoretogram is shown in ENO gene.
[0028] Step 2: The gel recovery product and plasmid pET28-His-MCS-X-sf-GFP (Shanghai Haigehaoge) were double-digested using Nde I and Spe I (ABclonal), and the digested gel recovery product was ligated to pET28-His-MCS-X-sfGFP vector using T4 ligase (ABclonal) to obtain recombinant plasmid containing pET28-His-MCS-X-sfGFP-ENO, which was transformed into E. coli DH5a, and the clones were picked and the plasmid was extracted for Nde I-Spe I double digestion, and the verification results are shown in Figure 2 , Figure 2 , in which M is DL1000 DNA Marker, and 1 is the plasmid after Nde I-Spe I double digestion, and two bands (expected size is 6058 bp and 1304 bp) appeared in lane 1, and the band size was consistent with the expectation.
[0029] Step 3: The pET28-His-MCS-X-sfGFP-ENO recombinant plasmid was used as template to design primers: 8148-eno-F: GG GGT ACC TTTGTTTAACTTTAAGAAGGAG (underlined is Kpn I restriction site, SEQ ID NO: 4); 8148-eno-R: CCC AAG CTT TCAGCCATGAGTGATAC (underlined HindIII restriction site, SEQ ID NO:5) was used for PCR amplification of ENO-sfGFP using primers: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 50 s, 60℃ annealing for 45 s, 72℃ extension for 90 s, 30 cycles; 72℃ extension for 10 min. The PCR product was then analyzed by agarose gel electrophoresis and purified.
[0030] Step 4: Plasmid pNZ8148 (RegiBio) and PCR amplification products were ligated after double digestion with KpnI and HindIII (ABclonal). The ligation product was transferred to E. coli MC1061 via calcium transfer, and clones were screened using chloramphenicol (34 μg / mL). Double digestion at the KpnI and HindIII sites was performed for verification. Positive clones were identified as the recombinant plasmid pNZ8148-ENO. The KpnI and HindIII double digestion verification results are shown below. Figure 3 As shown in the figure, M represents DL2000 plus DNA Marker, and 1 represents the product of KpnⅠ-HindⅢ double digestion. Electrophoresis results showed two bands in lane 1 (expected sizes of approximately 3167bp and 2114bp, respectively). The band sizes after digestion were consistent with expectations. Further sequencing verification confirmed that the sequence and insertion site were correct, indicating successful plasmid construction and readiness for use. ENO Gene expression analysis.
[0031] Step 5: Expression and SDS-PAGE detection of ENO-sfGFP fusion protein in recombinant plasmid pNZ8148-ENO. The recombinant plasmid pNZ8148-ENO was electroporated into Lactococcus lactis. Lactococcus lactis (atcc19435). Two hours after resuscitation on MRS medium, the culture was plated onto MRS plates (containing 34 μg / mL chloramphenicol, Baisha Biotechnology). Single colonies were then picked and inoculated into fresh MRS medium (containing 34 μg / mL chloramphenicol). The following day, the colonies were inoculated 1:100 into 100 mL of MRS medium containing 34 μg / mL chloramphenicol and incubated at 37°C until OD reached. 600The concentration was approximately 0.6. Take 1 mL of culture, centrifuge at 10000 r / min for 2 min at room temperature, discard the supernatant, and resuspend the bacterial pellet in 100 μL of 5× loading buffer. This is the control strain without induced expression. Add nisin to the remaining culture to a final concentration of 0.1 mM and incubate at 37℃ for 8 h to induce pNZ8148-ENO fusion protein expression. Take 1 mL of culture, centrifuge at 10000 r / min for 2 min at room temperature, discard the supernatant, and resuspend the bacterial pellet in 100 μL of 5× loading buffer (Solepro). This is the bacterial cell with induced protein expression. Perform 12% SDS-PAGE analysis, and observe the banding with Coomassie brilliant blue staining. The results are as follows. Figure 4 As shown in the figure, M represents the color-mixed protein marker 180; 1 represents lactic acid bacteria pNZ8148-ENO without nisin induction; 2 represents recombinant rENO protein expression in lactic acid bacteria pNZ8148-ENO induced with 30 ng / ml nisin. The molecular weight of rENO protein is approximately 41 kDa, and the molecular weight of sfGFP protein is approximately 26 kDa. Therefore, the expected size of the recombinant rENO-sfGFP fusion protein is approximately 67 kDa. Figure 4 As can be seen, a 67KD band can be clearly observed in lane 2, and the size of the target protein is as expected, indicating that the transformed lactic acid bacteria can express the recombinant rENO protein well.
[0032] Step 6: Western blot (WB) detection of ENO-sfGFP protein. The prepared SDS-PAGE gel and transfer filter paper (BioSharp BS-TPB-01B, 1 mm thick) were soaked in transfer buffer for 15 min. The gel was then assembled into a sandwich structure in the following order: two layers of filter paper, PVDF membrane, SDS-PAGE gel, and two more layers of filter paper. Air bubbles were removed during assembly using a glass rod. The protein on the SDS-PAGE gel was transferred to the PVDF membrane using a semi-dry transfer method (BioSharp Trans-Blot Turbo system) (2V constant voltage, 40 min). After transfer, the membrane was washed four times with PBST for 5 min each time, blocked with 5% skim milk blocking buffer at 37°C for 1 h, and incubated with primary and secondary antibodies for 1 h each, washing with PBST during the incubation period. Finally, DAB staining was performed. The results are shown below. Figure 5 As shown: The results indicate that the recombinant rENO-sfGFP fusion protein, after induction, can be synthesized in Lactococcus lactis (Lactococcus lactis). Lactococcus lactis The expression shows a clear band (expected size 67kDa), which is consistent with the expected size. Example 2
[0033] This example is a study on the immunogenicity of recombinant lactic acid bacteria in vivo, as detailed below: 1. Feed experiment of Tilapia: The experimental Tilapia (average weight = 5g) were divided into four groups, respectively: Negative control group: feeding ordinary commercial feed; Lactic acid bacteria group: feeding fermented commercial feed for 3-4 days in the fermentation feed prepared by feeding the commercial feed fermented by Lactococcus lactis transformed with pNZ8148 empty vector; Recombinant rENO lactic acid bacteria group: Lactococcus lactis containing pNZ8148-ENO recombinant plasmid was cultured in liquid MRS medium, and the bacteria liquid harvested after nisin induction was added to the commercial feed at 10% to prepare the fermentation feed for 3-4 days; Recombinant lactic acid bacteria rENO + nisin group: on the basis of the treatment of recombinant rENO lactic acid bacteria group, nisin was added during the fermentation of the fermentation feed.
[0034] 2. Feeding experiment: (1) ELISA antibody level detection: the experimental Tilapia were divided into negative control group, lactic acid bacteria group, recombinant rENO lactic acid bacteria group, and recombinant lactic acid bacteria rENO + nisin group, 20 in each group, and the four groups of fish were collected respectively at 7 days, 14 days, and 21 days after feeding. Fresh blood was collected, and the upper serum was collected after overnight storage at 4°C. The serum was used for subsequent ELISA experiments. An 8x12 enzyme-labeled plate was used, and four groups were divided into three columns in parallel. First, dilute rENO protein to 5 μg / mL with PBS coating solution (pH 9.6), and incubate overnight at 4°C. The next day, discard the coating solution, wash the plate 3 times with PBST (add 1‰ Tween 20), and add 200 μL 5% skim milk powder blocking solution to each well and incubate in a 37°C incubator for 1 h. Take out the enzyme-labeled plate, discard the inner liquid, and wash the plate 3 times with PBST. Dilute the antibody serum by 1:1, and add 100 μL to each well and incubate in a 37°C incubator for 1 h. Discard the inner liquid, wash the plate 3 times with PBST, and add 100 μl of diluted secondary antibody (goat anti-mouse IgG-HRP polyclonal antibody, 1:5000, ABclonal) to each well. Discard the inner liquid, wash the plate 4 times with PBST, and mix TMB double-component color developing solution at a ratio of 1:1. Add 100 μL of mixed color developing solution to each well. When the color developing is completed, add 100 μL of 2 M sulfuric acid solution to each well to terminate the reaction. Immediately after termination, read the OD 450 nm data on the enzyme-labeled instrument. The OD value greater than 2.1 times the OD value of the negative control corresponds to the dilution of the sample, which is defined as the titer. The ELISA antibody level detection results are as follows: Figure 6Figure 1 shows the antibody titers of the four control groups at 7 days, 14 days, and 21 days (A), the OD values of the ELISA test at 7 days (B), the OD values of the ELISA test at 14 days (C), and the OD values of the ELISA test at 21 days (D). 450 Figure 1 shows the antibody titers of the four control groups at 7 days, 14 days, and 21 days (A), the OD values of the ELISA test at 7 days (B), the OD values of the ELISA test at 14 days (C), and the OD values of the ELISA test at 21 days (D). 450 Figure 1 shows the antibody titers of the four control groups at 7 days, 14 days, and 21 days (A), the OD values of the ELISA test at 7 days (B), the OD values of the ELISA test at 14 days (C), and the OD values of the ELISA test at 21 days (D). 450 Figure 1 shows the antibody titers of the four control groups at 7 days, 14 days, and 21 days (A), the OD values of the ELISA test at 7 days (B), the OD values of the ELISA test at 14 days (C), and the OD values of the ELISA test at 21 days (D). In the figure, ck is the negative control group, Lac is the lactic acid bacteria group, Lac+eno is the recombinant rENO lactic acid bacteria group, and Lac+eno+nisin is the recombinant lactic acid bacteria rENO+nisin group. As can be seen from the figure, the antibody titer level of the recombinant rENO lactic acid bacteria group and the recombinant lactic acid bacteria rENO+nisin group is higher in the nisin induction group than in the non-induction group. Both groups have the highest antibody titer at seven days after immunization, which is about 341 (recombinant lactic acid bacteria group) and 682 (recombinant lactic acid bacteria+nisin group), respectively. Subsequently, at 14 days and 21 days, the antibody titer decreases with time, and at 21 days, the antibody titer is at a relatively low level.
[0035] (2) Hemagglutination inhibition test: healthy non-immune tilapia were used as experimental fish, and each fish was used to collect fresh blood of about 1 ml using an anticoagulated syringe and an anticoagulated tube (white shark). After collection, centrifugal treatment was immediately performed, the upper layer was discarded, and the blood cells were retained. The blood cells were diluted 10 times with PBS to prepare a red blood cell suspension for subsequent hemagglutination inhibition test. The tilapia red blood cell suspension was used for hemagglutination test with Streptococcus iniae liquid on a hemagglutination plate. The Streptococcus iniae liquid was diluted, and OD 600 values of 0.6-0.8 were added to each well to make the final concentration 5%-50%, 1% red blood cell suspension was added, and PBS was added to each well to make up to 100 μl. The minimum concentration of Streptococcus iniae that caused red blood cell agglutination was determined. Then, the sera of the negative control group, the lactic acid bacteria group, the recombinant rENO lactic acid bacteria group, and the recombinant lactic acid bacteria rENO+nisin group of tilapia were used for hemagglutination inhibition test. Each group was added with 1% red blood cell suspension, 30% Streptococcus iniae liquid, 25 μl of four groups of tilapia serum diluted by gradient ratio, and finally PBS was added to make up to 100 μl. After standing for 40 min, when the red blood cells in the control wells were significantly in the form of buttons, the results were determined. The highest dilution of serum that completely inhibited red blood cell agglutination (red blood cells completely sliding down) was taken as the determination endpoint. The hemagglutination test results are shown in Figure 7 Figure 1 shows the antibody titers of the four control groups at 7 days, 14 days, and 21 days (A), the OD values of the ELISA test at 7 days (B), the OD values of the ELISA test at 14 days (C), and the OD values of the ELISA test at 21 days (D). In the figure, ck is the negative control group, Lac is the lactic acid bacteria group, Lac+eno is the recombinant rENO lactic acid bacteria group, and Lac+eno+nisin is the recombinant lactic acid bacteria rENO+nisin group. As can be seen from the figure, the antibody titer level of the recombinant rENO lactic acid bacteria group and the recombinant lactic acid bacteria rENO+nisin group is higher in the nisin induction group than in the non-induction group. Both groups have the highest antibody titer at seven days after immunization, which is about 341 (recombinant lactic acid bacteria group) and 682 (recombinant lactic acid bacteria+nisin group), respectively. Subsequently, at 14 days and 21 days, the antibody titer decreases with time, and at 21 days, the antibody titer is at a relatively low level. ENOLactococcus group, nisin indicates that nisin is added in the recombinant rENO-expressed Lactococcus fermentation of commercial feed. "+" in the table represents yes, "-" represents no; the results show that the hemagglutination inhibition effect of the recombinant Lactococcus group after induction is relatively the best, the average serum titer is 37, the average serum titer of the recombinant Lactococcus group without induction is 21, the non-recombinant Lactococcus has no obvious hemagglutination inhibition effect, and the result is negative.
[0036] (3) Challenge experiment: before the experiment, the tilapia is fed to a suitable size (average weight 5g), and then the tilapia of a suitable size is selected for experimental grouping. The experimental group is divided into four groups, 40 in each group, which are negative control group, Lactococcus group, recombinant rENO Lactococcus group and recombinant Lactococcus rENO + nisin group, 40 fish in each group. First, feed each group with the specified feed for one week, and then perform the challenge experiment. Freshly cultured Streptococcus iniae is used for challenge, which is cultured in 100ml of bovine brain medium to OD 600 0.6-0.8 before use, and then challenged by injection. The results after challenge are observed.
[0037] Relative protection rate calculation formula: relative protection rate (RPS) = [1- (immunization group mortality% / control group mortality)] x 100%.
[0038] The challenge experiment results are shown in Table 4. Figure 8 Figure 8 The results show that the recombinant lactic acid bacteria fermented feed (recombinant rENO lactic acid bacteria group and recombinant lactic acid bacteria rENO + nisin group) after expressing rENO protein, all have obvious protective effect compared with the control group of feeding ordinary commercial feed (CK control group) and lactic acid bacteria fermented feed without expressing rENO protein (lactic acid bacteria group). The control group of feeding commercial feed has all died at 48 hours, and the final mortality is 100%; the mortality of the group of feeding lactic acid bacteria fermented feed without expressing rENO protein is 85%; the mortality of the group of feeding recombinant lactic acid bacteria fermented feed expressing rENO protein (nisin is added during fermentation) is 45%; the mortality of the group of feeding recombinant lactic acid bacteria fermented feed expressing rENO protein (nisin is not added during fermentation) is 40%. Calculate the relative protection rate (RPS), taking the CK group as the control, the relative protection rate of the recombinant rENO lactic acid bacteria group is 55%, and the relative protection rate of the recombinant lactic acid bacteria rENO + nisin group is 60%; taking the lactic acid bacteria group as the control, the relative protection rate of the recombinant rENO lactic acid bacteria group is 47%, and the relative protection rate of the recombinant lactic acid bacteria rENO + nisin group is 53%, it can be seen that the two groups of fermented feed by recombinant lactic acid bacteria have obvious protective effect.
[0039] In summary, the feed prepared by the recombinant lactic acid bacteria of the present application can have good protective effect on Streptococcus iniae, which shows that the recombinant lactic acid bacteria has good immune protection effect on Streptococcus iniae, and provides a new technical idea for developing green biological feed, improving fish immunity and developing oral Streptococcus iniae vaccine.
[0040] The above-described embodiments only express several embodiments of the present application, which are described in detail and specifically, but cannot be understood as limiting the scope of the present application. It should be noted that, for ordinary skilled in the art, without departing from the concept of the present application, several modifications and improvements can be made, which all belong to the protection scope of the present application. Therefore, the protection scope of the present application should be subject to the appended claims.
Claims
1. A recombinant lactic acid bacterium, characterized in that, The recombinant lactic acid bacteria has an ENO gene from Streptococcus iniae; the gene sequence of the ENO is shown in the sequence table SEQ ID NO:
3.
2. A pharmaceutical composition, characterized by, The pharmaceutical composition comprises the recombinant lactic acid bacteria as claimed in claim 1.
3. The pharmaceutical composition of claim 2, wherein, The medicine is an oral medicine.
4. An aquatic feed, characterized in that, The aquatic feed comprises the recombinant lactic acid bacteria as claimed in claim 1.
5. Use of the recombinant lactic acid bacteria as claimed in claim 1, the pharmaceutical composition as claimed in claim 2 or the aquatic feed as claimed in claim 4 in the preparation of a product against Streptococcus iniae infection.
6. An oral vaccine, characterized in that, The oral vaccine comprises the recombinant lactic acid bacteria as claimed in claim 1 or the pharmaceutical composition as claimed in claim 2.
7. A method of feeding fish to improve resistance to Streptococcus iniae, characterized in that, The method is to add the recombinant lactic acid bacteria as claimed in claim 1 to fish feed and feed the fish.
8. The method of feeding of claim 7, wherein, The recombinant lactic acid bacteria further comprises a lactic acid bacteriocin.
9. A method for constructing the recombinant lactic acid bacterium according to claim 1, characterized by, The method is: (1) amplifying the ENO gene by using primer pair 1; (2) linking the ENO gene to the pET28-His-MCS-X-sfGFP vector to obtain the recombinant plasmid pET28-His-MCS-X-sfGFP-ENO; (3) calcium transfer of the recombinant plasmid to Escherichia coli DH5α; (4) amplification of the recombinant plasmid pET28-His-MCS-X-sfGFP-ENO by using primer pair 2; (5) recovery of the amplification product of step (4) and connection to the plasmid pNZ8148 to obtain the recombinant plasmid pNZ8148-ENO; (6) electrotransformation of the recombinant plasmid pNZ8148-ENO of step (5) to Lactococcus lactis to obtain the recombinant lactic acid bacteria; the upstream sequence of the primer pair 1 is shown in SEQ ID NO: 1 and the downstream sequence is shown in SEQ ID NO: 2; the upstream sequence of the primer pair 2 is shown in SEQ ID NO: 4 and the downstream sequence is shown in SEQ ID NO: 5.