MiRNA for regulating and controlling content of fat and / or unsaturated fatty acid in buffalo muscle and application of miRNA

Abstract

The invention belongs to the technical field of molecular biology, and relates to miRNA for regulating and controlling the content of fat and / or unsaturated fatty acid in buffalo muscle and application of the miRNA. The miRNA is miR-30f (bta-miR-30f), and the fat deposition in the buffalo muscle and the composition of unsaturated fatty acid are influenced by regulating and controlling the expression of an RAD23B gene. The invention finds that transfection of a bta-miR-30f simulant in buffalo intramuscular fat cells can significantly improve intramuscular fat content and unsaturated fatty acid proportion, while transfection of an inhibitor shows a reverse effect. Further research finds that knock-down of the RAD23B gene can also increase the content of triglyceride and unsaturated fatty acid in buffalo muscle tissue. Important gene resources and molecular breeding technical means are provided for genetic improvement of buffalo meat quality characters (including flavor characteristics and nutritional value).

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular biology, and relates to a miRNA for regulating intramuscular fat and / or unsaturated fatty acid content of a buffalo and application thereof. BACKGROUND

[0002] Intramuscular fat (IMF) content and its fatty acid composition are key indicators affecting the eating quality and commercial value of meat products. Studies have shown that IMF content is significantly positively correlated with meat tenderness, juiciness and flavor characteristics. In terms of molecular regulation mechanisms, MicroRNAs (miRNAs), as a class of endogenous non-coding RNAs with a length of about 18-25 nucleotides, regulate gene expression by specifically recognizing the 3'-untranslated region (3'-UTR) of target genes, and have been confirmed to be involved in multiple key processes of fat metabolism. In particular, members of the miR-30 family (such as miR-30a, miR-30d) play an important regulatory role in mammalian adipocyte proliferation and differentiation. However, the biological function of bovine miR-30f (bta-miR-30f) in buffalo intramuscular fat deposition and its molecular mechanism have not been reported so far. In addition, RAD23B (Rad23 homolog B), as an important protein in the nucleotide excision repair pathway, has not been disclosed in any document so far for its function in regulating fat metabolism. SUMMARY

[0003] The application provides a miRNA for regulating intramuscular fat deposition and polyunsaturated fatty acid composition of a buffalo and application thereof. The miRNA of the application is miR-30f (bta-miR-30f), which regulates the content of intramuscular fat and polyunsaturated fatty acid of a buffalo by targeting RAD23B This finding provides a new theoretical basis and technical target for improving the flavor and nutritional value of buffalo meat through molecular breeding technology.

[0004] The technical scheme of the application is as follows: The first technical scheme provided by the application is the application of buffalo bta-miR-30f as a target in regulating the content of intramuscular fat and / or unsaturated fatty acid of a buffalo. Further, the sequence of the buffalo bta-miR-30f is shown as SEQ ID NO: 1. The precursor sequence of the buffalo bta-miR-30f is GAGGGCCAGAUACUGUAAACACCCUACACUCUCAGCUGUGCACAGUGAGAAAGCUGGGAGAAGGCUGUUUACUCUCUCUGCCUU, shown as SEQ ID NO: 31. The unsaturated fatty acid includes monounsaturated fatty acid and polyunsaturated fatty acid.

[0005] The present application finds that bta-miR-30f is highly expressed in mature buffalo intramuscular adipocytes, and the buffalo bta-miR-30f positively regulates the content of buffalo intramuscular fat and / or unsaturated fatty acids, that is, up-regulation of the buffalo bta-miR-30f can increase the content of buffalo intramuscular fat and / or unsaturated fatty acids, and down-regulation of the buffalo bta-miR-30f can decrease the content of buffalo intramuscular fat and / or unsaturated fatty acids. Specifically, the present application finds that overexpression of bta-miR-30f (transfection of bta-miR-30f mimics) can significantly increase the lipid droplet content (oil red O staining) and triglyceride (TG) content of buffalo intramuscular adipocytes, and up-regulate the expression of lipogenic genes such as PPARG, C / EBPα, FABP4, etc.; and treatment of buffalo intramuscular adipocytes with a bta-miR-30f inhibitor can significantly inhibit adipogenesis and down-regulate the expression of lipogenic genes such as PPARG, C / EBPα, FABP4, etc. The present application also confirms that overexpression of bta-miR-30f can increase the level of UFA and the ratio of UFA / SFA, and decrease the level of saturated fatty acids (SFA); and inhibition of bta-miR-30f expression can decrease the ratio of UFA / SFA.

[0006] In a second aspect, the present application provides a buffalo bta-miR-30f modulator, which is an enhancer or an inhibitor; the bta-miR-30f enhancer enhances the activity or expression of bta-miR-30f, and the bta-miR-30f enhancer includes a bta-miR-30f mimic, which is synthesized by simulating the endogenous bta-miR-30f in the organism by a chemical synthesis method, and the sequence of the sense strand of the bta-miR-30f mimic is shown in SEQ ID NO: 1, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 7. The bta-miR-30f inhibitor inhibits the activity or expression of the bta-miR-30f molecule, and the sequence of the inhibitor is shown in SEQ ID NO: 7. Taking the buffalo bta-miR-30f as a target, the use of the buffalo bta-miR-30f modulator can regulate the content of buffalo intramuscular fat and / or unsaturated fatty acids, and specifically, the use of the bta-miR-30f enhancer can be used to increase the content of buffalo intramuscular fat and / or unsaturated fatty acids, and the use of the bta-miR-30f inhibitor can decrease the content of buffalo intramuscular fat and / or unsaturated fatty acids.

[0007] In a third aspect, the present application provides a buffalo RAD23B application of the buffalo bta-miR-30f as a target in regulating the content of buffalo intramuscular fat and / or unsaturated fatty acids, and specifically, the use of the bta-miR-30f enhancer can be used to increase the content of buffalo intramuscular fat and / or unsaturated fatty acids, and the use of the bta-miR-30f inhibitor can decrease the content of buffalo intramuscular fat and / or unsaturated fatty acids. RAD23BThe sequence of the gene is shown as SEQ ID NO: 26. Among them, the buffalo RAD23B The gene negatively regulates the intramuscular fat and / or unsaturated fatty acid content of the buffalo. Specifically, the present application finds that by up-regulating the expression of bta-miR-30f, the mRNA level of the gene can be down-regulated RAD23B , thereby increasing the intramuscular fat and / or unsaturated fatty acid content of the buffalo; the present application proves, through TargetScan and mirWalk prediction and dual luciferase reporter assay, that bta-miR-30f directly binds to the 3'UTR of the gene and inhibits its expression. Down-regulating the expression of bta-miR-30f can up-regulate the mRNA level of the gene, thereby reducing the intramuscular fat and / or unsaturated fatty acid content of the buffalo. RAD23B RAD23B

[0008] Therefore, based on the above, in a fourth aspect, the present application provides a method for increasing the intramuscular fat and / or unsaturated fatty acid content of the buffalo, comprising: by reducing the expression of the gene in the buffalo RAD23B to increase the intramuscular fat and / or unsaturated fatty acid content of the buffalo. Specifically, the expression of the gene in the buffalo can be reduced by introducing an inhibitor into the intramuscular fat cells of the buffalo RAD23B . RAD23B

[0009] Further, the inhibitor is buffalo bta-miR-30f, a buffalo bta-miR-30f enhancer or a siRNA targeting RAD23B the sequence of the sense strand of the siRNA is shown as SEQ ID NO: 27 and the sequence of the antisense strand is shown as SEQ ID NO: 28. The present application finds that introducing the siRNA targeting RAD23B silences RAD23B can mimic the effect of bta-miR-30f, significantly increasing the TG content and the UFA / SFA ratio, and up-regulating the expression of lipogenesis-related genes. RAD23B

[0010] The present application has the following beneficial effects: 1. The present application provides a new target for regulating the intramuscular fat deposition and fatty acid composition of the buffalo. It is the first time to disclose the key role of bta-miR-30f and its target gene RAD23B in regulating the intramuscular fat content and the proportion of unsaturated fatty acids of the buffalo.

[0011] 2. The present application realizes double positive regulation of meat quality traits. By regulating the target, the intramuscular fat content of the buffalo can be increased and the proportion of unsaturated fatty acids can be improved at the same time, which helps to improve the flavor (juiciness, tenderness) and nutritional value of the buffalo meat at the same time.

[0012] ​​​​3. This invention provides important genetic resources and technical means for molecular breeding. This discovery lays a solid theoretical and applied foundation for the targeted improvement of the two key meat quality traits of buffalo—flavor characteristics and nutritional value—through modern breeding techniques such as genetic engineering and molecular marker-assisted selection. Attached Figure Description

[0013] Figure 1 Expression patterns of bta-miR-30f. (A) Differentiation of buffalo intramuscular preadipocytes. With prolonged induction time, lipid droplets gradually increased in size and number. (B) bta-miR-30f was significantly upregulated in mature buffalo intramuscular adipocytes.

[0014] Figure 2: bta-miR-30f promotes the proliferation and differentiation of buffalo intramuscular adipocytes. (A) qRT-PCR assay to detect the overexpression efficiency of MNCs and bta-miR-30f mimics (Mimics). (BC) qRT-PCR detection of adipogenic genes in the MNC and Mimics groups ( PPARG, C / EBPa, FABP4 ), fatty acid desaturation / elongation gene ( SCD, FADS1, FADS2, ELOVL5 (D) White light and Oil Red O staining of the MNC and Mimics groups. Scale bar, 200 μm. (E) Quantitative results of Oil Red O staining of Figure (D). Scale bar, 200 μm. (F) Intracellular triglyceride content of the MNC and Mimics groups. (G) qRT-PCR assay to detect the inhibitory efficiency of INC and bta-miR-30f inhibitors on bta-miR-30f. (HI) qRT-PCR detection of adipogenic genes ( ) in the INC and Inhibitor groups. PPARG, C / EBPa, FABP4 ), fatty acid desaturation / elongation gene ( SCD, FADS1, FADS2, ELOVL5 mRNA expression levels of INC and Inhibitor groups. (J) White light and Oil Red O staining of the INC and Inhibitor groups. Scale bar, 200 μm. (K) Quantitative results of Oil Red O staining of (J). (L) Intracellular triglyceride levels of the INC and Inhibitor groups.

[0015] Figure 3: bta-miR-30f affects fatty acid composition of buffalo MNC-derived adipocytes. (A) White light images of MNC-derived adipocytes transfected with bta-miR-30f mimics for 24 h and induced for 10 days. Scale bar, 200 μm. (B) Differences in fatty acid composition between MNC and mimics groups. (C) UFA / SFA ratio of MNC and mimics groups. (D) MUFA / SFA ratio of MNC and mimics groups. (E) PUFA / SFA ratio of MNC and mimics groups. (F) C16:0, C18:0, C18:1n9c, C18:2n6c and C18:3n3 fatty acid contents of MNC and mimics groups. (G) White light images of MNC-derived adipocytes transfected with bta-miR-30f inhibitor for 24 h and induced for 10 days. Scale bar, 200 μm. (H) Differences in fatty acid composition between INC and inhibitor groups. (I) UFA / SFA ratio of INC and inhibitor groups. (J) MUFA / SFA ratio of INC and inhibitor groups. (K) PUFA / SFA ratio of INC and inhibitor groups. (L) C16:0, C18:0, C18:1n9c, C18:2n6c and C18:3n3 fatty acid contents of INC and inhibitor groups.

[0016] Figure 4 : RAD23B is the target gene of bta-miR-30f. (A) Potential target genes of bta-miR-30f were predicted by TargetScan and mirWalk online websites. (B) RNAhybrid predicted that bta-miR-30f had a complementary binding region with the 3'UTR of RAD23B . (C) qRT-PCR assay was used to detect the mRNA content of RAD23B after overexpression or inhibition of bta-miR-30f. (D) The WT 3'UTR and MUT 3'UTR of RAD23B were inserted into the Xho I between Not I of psi-CHECK2 vector, respectively. (E) Dual-luciferase assay was used to verify the binding of bta-miR-30f to RAD23B .

[0017] Figure 5 : RAD23B Effects of knockdown on buffalo MNC-derived adipocytes. (A) qRT-PCR assay was used to detect the interference efficiency of NC and siRNA-1363 on RAD23B . (B) qRT-PCR assay was used to detect the mRNA content of RAD23B after interference of NC and siRNA-1363 groupsSCD , FADS1 , FADS2 , ELOVL5 , CD36 , GPAM , XDH , PPARG , FABP4 mRNA levels. (C) Effect of siRNA-1363 on fat deposition after interference detected by oil red O staining. (D) Changes of intracellular triglyceride after interference of NC and siRNA-1363 groups. (E) Changes of fatty acid composition after interference of NC and siRNA-1363 groups. (F) UFA / SFA ratio after interference of NC and siRNA-1363 groups. (G) MUFA / SFA ratio after interference of NC and siRNA-1363 groups. (H) PUFA / SFA ratio after interference of NC and siRNA-1363 groups. (I) Contents of C16:0, C18:0, C18:1n9c, C18:2n6c and C18:3n3 fatty acids after interference of NC and siRNA-1363 groups. RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B DETAILED DESCRIPTION

[0018] In order to make the objects, technical solutions and advantages of the present application clearer, the technical solutions in the embodiments of the present application will be described clearly below in conjunction with the drawings in the embodiments of the present application. Obviously, the described embodiments are some of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work fall within the scope of protection of the present application.

[0019] In the examples, buffalo intramuscular adipocytes were prepared from the longest muscle of the fetal buffalo back using collagenase digestion method, and the preparation method referred to the Chinese invention patent application with the application publication number CN 114990057A. In the examples, the specific conditions not specified were carried out according to the conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used without specifying the manufacturer were all conventional products that could be purchased on the market.

[0020] Example 1 I. Induction and differentiation of buffalo intramuscular adipocytes ​​​​​​​The buffalo intramuscular adipocytes after differential adhesion purification were cultured in a 37°C, 5% CO2 incubator, and the DMEM medium containing 20% fetal bovine serum and 1% double antibodies was replaced every two days during the culture. When the cell density reached about 100%, the induction medium was replaced, and after 2 days of induction, the maintenance medium was replaced, and then the maintenance medium was replaced every two days, and the maintenance culture was maintained for 6-8 days. The induction medium is based on the DMEM medium containing 20% fetal bovine serum and 1% double antibodies, and the components of the induction differentiation agent are added: 0.5mM 3-isobutyl-1-methyl xanthine, 1 μM dexamethasone, 10 μg / mL insulin and 1 μM rosiglitazone; the maintenance medium is based on the DMEM medium containing 20% fetal bovine serum and 1% double antibodies, and the components of the maintenance differentiation agent are added: 10 μg / mL insulin and 1 μM rosiglitazone.

[0021] From Figure 1 As can be seen, the cells become round after 2 days of induction medium culture. As the time of buffalo intramuscular adipocyte differentiation increases, the adipogenic phenomenon becomes more and more obvious.

[0022] II. qRT-PCR detection of bta-miR-30f expression RNA extraction and reverse transcription: total RNA of buffalo intramuscular adipocytes induced and differentiated for 0, 2, 4, 8 days was extracted by TRIzol (Vazyme, Nanjing, China), and then reverse transcribed by StarScript III RT Mix Kit (GenStar, Beijing, China); in addition, StarScript III miRNA RT Kit (Stem-loop) (GenStar, Beijing, China) was used for reverse transcription of bta-miR-30f, and the operation process was performed according to the manufacturer's instructions. Among them, the reverse transcription primers of bta-miR-30f and U6 as the internal reference gene for standardization. The sequence of bta-miR-30f is UGUAAACACCCUACACUCUCAGCU (SEQ ID NO: 1), and the reverse transcription primers of bta-miR-30f and U6 The sequence of the reverse transcription primers of the internal reference gene is shown in Table 1.

[0023] Then 2x RealStar Green Fast Mixture (GenStar, Beijing, China) was used for quantitative real-time PCR (qRT-PCR) detection of bta-miR-30f expression, and U6The relative expression of bta-miR-30f was calculated by 2−ΔΔCt method as an internal reference gene. The primer sequences used in the detection of bta-miR-30f expression are shown in Table 1. The data are expressed as mean ± standard error (SEM) and analyzed and visualized using GraphPad Prism 8.0 software. Unpaired Student's t test was used between two groups, and one-way ANOVA was used for three or more groups.

[0024] Results are shown in Figure 1 As shown in Figure B, bta-miR-30f is highly expressed in mature buffalo intramuscular adipocytes (e.g., on the 8th day of induced differentiation).

[0025] Table 1, primers used to detect bta-miR-30f Example 2 In vitro cell level verification of the function of bta-miR-30f I. qRT-PCR verification of the function of bta-miR-30f Buffalo intramuscular adipocytes were inoculated in 6-well plates, 12-well plates, and 24-well plates at an appropriate density. When the cell density reached 80%, bta-miR-30f mimics and bta-miR-30f inhibitors were transfected into buffalo intramuscular adipocytes using Lipofectamine 3000 transfection reagent kit (Invitrogen) according to the manufacturer's instructions. After 24 hours of transfection, a portion of the cells were used to detect the overexpression or interference efficiency; the remaining cells were induced to differentiate, and after 2 days of induction, the maintenance medium was replaced, and then the maintenance medium was replaced every two days. After 8-10 days of maintenance culture, subsequent adipogenic differentiation studies were performed.

[0026] The sense strand of the bta-miR-30f mimic is UGUAAACACCCUACACUCUCAGCU (SEQ ID NO: 1); and the antisense strand is AGCUGAGAGUGUAGGGUGUUUACA (SEQ ID NO: 7). The sequence of the bta-miR-30f inhibitor is AGCUGAGAGUGUAGGGUGUUUACA (SEQ ID NO: 7). The sense strand of the bta-miR-30f mimic negative control (MNC) used in the examples is UCACAACCUCCUAGAAAGAGUAGA (SEQ ID NO: 8); and the antisense strand is UCUACUCUUUCUAGGAGGUUGUGA (SEQ ID NO: 9). The bta-miR-30f inhibitor negative control (INC) is UCUACUCUUUCUAGGAGGUUGUGA (SEQ ID NO: 9).

[0027] As shown in Figure 2 After the bta-miR-30f mimic and the bta-miR-30f inhibitor were transfected into buffalo intramuscular adipocytes, the bta-miR-30f was successfully overexpressed or interfered, as shown in Figure 2 As shown in PPARG , C / EBPa , FABP4 ) and the mRNA levels of desaturase and elongase related genes ( SCD , FADS1 , FADS2 , ELOVL5 ) were significantly up-regulated; and after the activity of the bta-miR-30f was inhibited, the mRNA levels of the adipogenic marker genes ( PPARG , C / EBPa , FABP4 ) and the desaturase and elongase related genes ( SCD , FADS1 , FADS2 , ELOVL5 ) were down-regulated, as shown in Figure 2 H and 2I.

[0028] The method for detecting the expression levels of the adipogenic marker genes, the desaturase and elongase related genes, and the internal reference β- actin The method for detecting the expression levels of the adipogenic marker genes, the desaturase and elongase related genes, and the internal reference

[0029] Table 2, Primers used for qRT-PCR validation of bta-miR-30f function II. Detection of fat deposition and unsaturated fatty acid content in bta-miR-30f 1. Oil red O quantification When a large number of lipid droplets were observed in buffalo intramuscular adipocytes, the cells were fixed with 4% paraformaldehyde solution at room temperature for 20 minutes. Subsequently, the cells were stained with oil red O staining agent for 30 minutes. After staining, unbound oil red O was removed by washing with PBS, and observed under a microscope.

[0030] As shown in Figure 2 D and 2E, overexpression of bta-miR-30f significantly increased lipid accumulation in buffalo intramuscular adipocytes. After interfering with bta-miR-30f, the lipid accumulation in buffalo intramuscular adipocytes was significantly reduced (P < 0.05) Figure 2 J and Figure 2 K).

[0031] 2. Detection of triglyceride content After 8 days of induction and differentiation of buffalo intramuscular adipocytes, a triglyceride detection kit (Nanjing Jiancheng Biological Engineering Institute, Nanjing, China) was used for cell lysis and detection of triglyceride content.

[0032] The results showed that overexpression of bta-miR-30f significantly increased the triglyceride content of buffalo intramuscular adipocytes (P < 0.05) Figure 2 F). Conversely, after interfering with bta-miR-30f, the triglyceride content of buffalo intramuscular adipocytes was significantly reduced (P < 0.05) Figure 2 L).

[0033] 3. Analysis of fatty acid composition After transfection of bta-miR-30f mimics or inhibitors into buffalo intramuscular adipocytes and 10 days of adipogenic differentiation culture, the cell precipitate was collected and sent to Sanshumi Biological Technology Company for fatty acid analysis. The specific process is as follows: after acid hydrolysis treatment of buffalo intramuscular adipocytes, the fat was extracted with petroleum ether, and then the fat was saponified and methylated. Finally, 37 kinds of fatty acids in the methylated sample were analyzed by gas chromatography-mass spectrometry (GC-MS).

[0034] The visible micrographs of buffalo intramuscular adipocytes after transfection of bta-miR-30f mimics or inhibitors and 10 days of adipogenic differentiation culture are shown in Figure 3 A and 3G. Overexpression of bta-miR-30f significantly increased the level of unsaturated fatty acids (UFA) and reduced the level of saturated fatty acids (SFA) (P < 0.05) Figure 3B). Specifically, bta-miR-30f mimics significantly enhanced the levels of monounsaturated fatty acids (MUFA) and polyunsaturated fatty acids (PUFA) Figure 3 B). bta-miR-30f overexpression significantly increased the ratio of unsaturated fatty acids / saturated fatty acids (UFA / SFA) Figure 3 C), monounsaturated fatty acids / saturated fatty acids (MUFA / SFA) Figure 3 D), and polyunsaturated fatty acids / saturated fatty acids (PUFA / SFA) Figure 3 E). In addition, bta-miR-30f overexpression changed the composition of specific fatty acids in buffalo intramuscular adipocytes: the ratios of C18:0, C18:1n9c, C18:2n6c and C18:3n3 were increased, while the ratio of C16:0 was decreased Figure 3 F).

[0035] In contrast, inhibition of bta-miR-30f led to a significant upregulation of saturated fatty acids (SFA) and a downregulation of unsaturated fatty acids (UFA) Figure 3 H). Specifically, the levels of monounsaturated fatty acids (MUFA) were significantly decreased, while the levels of polyunsaturated fatty acids (PUFA) were not affected Figure 3 H). The UFA / SFA and MUFA / SFA ratios were significantly decreased Figure 3 I, J). The PUFA / SFA ratio was decreased, but this change was not statistically significant Figure 3 K). After inhibition of bta-miR-30f, the levels of C16:0 and C18:0 were increased, while the levels of C18:1n9c and C18:3n3 were significantly decreased. In contrast, the level of C18:2n6c remained unchanged RAD23B L).

[0036] Example 3: Verification of the molecular mechanism and confirmation of the function of the target genes I. Verification of the targeting relationship The target genes of bta-miR-30f were predicted by the online platforms mirWALK and TargetScan, and the results showed that Figure 4 A) are potential targets of bta-miR-30f RAD23B A), which RAD23BFigure 4 Secondary structure with 3'UTR bond ( RAD23B B). RAD23B Expression was negatively correlated with bta-miR-30f activity, and bta-miR-30f mimics could be downregulated. RAD23B Expression, while bta-miR-30f inhibitors upregulate expression. Figure 4 Express( RAD23B C).

[0037] II. Target Gene Validation Experiment To verify whether bta-miR-30f can directly act on the predicted binding site, we synthesized wild-type (WT) and mutant (MUT) formulations containing the bta-miR-30f target site. Figure 4 The 3'UTR fragment of the gene was cloned into the psi-CHECK2 vector. RAD23B D). Constructing a system containing RAD23B Luciferase vectors containing 3'UTR wild-type (WT) and mutant (MUT) cells were co-transfected with bta-miR-30f mimics into 293T cells. Dual fluorescence assays showed that overexpression of bta-miR-30f significantly downregulated wild-type cells. RAD23B Luciferase activity of 3'UTR, but for mutants Figure 4 The luciferase activity of the 3'UTR was not affected. RAD23B E).

[0038] III. In vitro cell-level verification RAD23B Functions We assessed its functional effects using siRNA-mediated knockdown technology. We conducted research at Anhui General Biotechnology Co., Ltd. RAD23B Three siRNAs were designed based on the gene sequence. First, the siRNAs were transfected into buffalo intramuscular preadipocytes using the lip3000 transfection reagent to verify the effects of the siRNAs on… RAD23B Gene interference efficiency. The siRNA with the highest interference efficiency was selected. The sense strand of the siRNA with the highest interference efficiency (siRNA-1363) is: UCAAGAAGCUGGUGGUCAATT (SEQ ID NO:27), and the antisense strand is: UUGACCACCAGCUUCUUGATT (SEQ ID NO:28). The sense strand of the negative control (NC) is: UUCUCCGAACGUGUCACGUTT (SEQ ID NO:29); the antisense strand is: ACGUGACACGUUCGGAGAATT (SEQ ID NO:30).

[0039] qRT-PCR analysis showed that, compared with the negative control group (NC), the siRNA-1363 group... Figure 5mRNA expression was significantly reduced by 50% ( RAD23B A), indicating RAD23B It was knocked down. We then conducted further testing. SCD knock down FADS1 , FADS2 , ELOVL5 , CD36 , GPAM , XDH , PPARG , FABP4 and RAD23B The effect of mRNA levels. The results showed SCD Knock down significantly increased GPAM , XDH , PPARG , FABP4 and Figure 5 The expression ( Figure 5 B). Similarly, siRNA-1363 transfection significantly increased lipid accumulation and triglyceride content in buffalo intramuscular adipocytes (B). RAD23B (C and 5D). These findings combined suggest that... RAD23B It may function as a negative regulator of intramuscular fat production in buffalo. To investigate... RAD23B To determine whether it affected the fatty acid composition, further fatty acid testing was conducted. Figure 5 Knockdown significantly reduced saturated fatty acid (SFA) levels while increasing unsaturated fatty acid (UFA) levels, and simultaneously increased levels of both polyunsaturated fatty acids (PUFA) and monounsaturated fatty acids (MUFA). RAD23B E). Compared to the NC group, Figure 5 Knockdown increases the ratios of UFA / SFA, PUFA / SFA, and MUFA / SFA. RAD23B FH). Furthermore... Figure 5 Knockdown altered the levels of specific fatty acids, increasing the proportions of C18:1n9c and C18:2n6c in buffalo intramuscular adipocytes while decreasing the proportion of C16:0. The levels of C18:0, C18:1n9t, and C18:3n3 did not change significantly. ​ I).

[0040] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of buffalo bta-miR-30f as a target point in regulating buffalo intramuscular fat and / or unsaturated fatty acid content.

2. Use according to claim 1, characterized in that, The sequence of the buffalo bta-miR-30f is shown as SEQ ID NO:

1.

3. Use according to claim 1, characterized in that, The buffalo bta-miR-30f positively regulates the content of buffalo intramuscular fat and / or unsaturated fatty acid.

4. Use according to claim 1, characterized in that, The unsaturated fatty acid includes monounsaturated fatty acid and polyunsaturated fatty acid.

5. A modulator of buffalo bta-miR-30f, characterized in that, The sequence of the buffalo bta-miR-30f is shown as SEQ ID NO: 1, and the regulator of the buffalo bta-miR-30f is an enhancer or an inhibitor; the sequence of the sense strand of the enhancer is shown as SEQ ID NO: 1, and the nucleotide sequence of the antisense strand is shown as SEQ ID NO: 7, and the sequence of the inhibitor is shown as SEQ ID NO:

7.

6. Water buffalo RAD23B The use of the gene as a target in regulating the content of intramuscular fat and / or unsaturated fatty acids in water buffalo is characterized in that, The water buffalo RAD23B The sequence of the gene is shown as SEQ ID NO:

26.

7. Use according to claim 6, characterized in that, Water buffalo RAD23B Genes negatively regulate intramuscular fat and / or unsaturated fatty acid content in water buffalo.

8. A method for increasing intramuscular fat and / or unsaturated fatty acid content in a water buffalo, characterized by, including: By reducing the expression of the gene in the buffalo RAD23B muscle intramuscular fat and / or unsaturated fatty acid content.

9. The method of claim 8, wherein, By introducing the buffalo RAD23B inhibitor to reduce the buffalo RAD23B expression of the gene.

10. The method of claim 9, wherein, The RAD23B inhibitor is a water buffalo bta-miR-30f, a water buffalo bta-miR-30f enhancer or a siRNA targeting RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B RAD23B, the sequence of the water buffalo bta-miR-30f is shown as SEQ ID NO: 1, the sequence of the sense strand of the water buffalo bta-miR-30f enhancer is shown as SEQ ID NO: 1, the nucleotide sequence of the antisense strand is shown as SEQ ID NO: 7; the sequence of the sense strand of the siRNA targeting RAD23B is shown as SEQ ID NO: 27, the sequence of the antisense strand is shown as SEQ ID NO: 28.

Images