Immune nucleic acid amplification detection kit and detection method based on MS2 virus-like particles

By displaying specific peptides or proteins on the surface of MS2 virus-like particles and encapsulating nucleic acid templates internally, combined with recombinase polymerase amplification or quantitative real-time PCR detection, the problem of insufficient sensitivity in the detection of low-abundance target molecules in existing technologies has been solved, realizing a detection method with high sensitivity and specificity, and expanding its application in the fields of food safety and clinical diagnosis.

CN121362770APending Publication Date: 2026-01-20GUANGZHOU MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511201760.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-26
Publication Date
2026-01-20

AI Technical Summary

Technical Problem

Existing immunoassay techniques lack sufficient sensitivity for detecting low-abundance target molecules, making it difficult to meet the detection needs of trace biomarkers. Furthermore, the complex antibody-DNA conjugation process and low conjugation efficiency restrict their standardized application in clinical testing.

Method used

MS2 virus-like particles display specific peptides or proteins on their surface and encapsulate nucleic acid templates internally. The bound nucleic acids inside the MS2 VLPs are detected by recombinase polymerase amplification or quantitative real-time PCR. The nucleic acid sequence is used as a signal amplifier to achieve highly sensitive and specific detection of target molecules.

Benefits of technology

It improves detection sensitivity, breaks through the sensitivity bottleneck of traditional immunoassay, and achieves simple, highly sensitive and specific target molecule detection, which is applicable to food safety and clinical diagnostics.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121362770A_ABST
    Figure CN121362770A_ABST
Patent Text Reader

Abstract

The invention discloses an immune nucleic acid amplification detection kit and detection method based on MS2 virus-like particles, the kit contains the MS2 virus-like particles, the surface of the MS2 VLP displays an antigen conjugate capable of being specifically bound with an object to be detected, and a nucleic acid template is wrapped in the MS2 VLP; after the MS2 VLP is specifically combined with an object to be detected, detecting nucleic acid fragments wrapped in the combined MS2 VLP by adopting a recombinase polymerase amplification technology or real-time fluorescent quantitative PCR (Polymerase Chain Reaction), so as to improve the detection sensitivity of target protein. By utilizing the method, simple, highly sensitive and specific target molecule detection can be realized, the bottleneck of the traditional immunodetection method in sensitivity is broken through, and the problem of low coupling efficiency of the antibody and nucleic acid is effectively solved; the method is also suitable for the field of food safety (such as cereal toxin detection) and the field of clinical diagnosis (such as detection of low-abundance biomarkers in body fluid), and a new technical solution is provided for molecular detection.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological detection, and particularly relates to an immunonucleic acid amplification detection kit and a detection method based on MS2 virus-like particles. BACKGROUND

[0002] High-affinity immunodetection technology based on specific binding of antigen-antibody is an important method system for detection of biological macromolecules such as proteins. Current mainstream immunodetection technologies mainly include enzyme-linked immunosorbent assay (ELISA) and electrochemiluminescence immunoassay (ECLIA), etc. These methods have been widely used in clinical diagnosis and biological detection due to their advantages such as simple operation, controllable cost, and reliable results. However, traditional immunodetection technology still has obvious technical limitations, especially for the detection of low-abundance target molecules, the detection sensitivity is insufficient, which is difficult to meet the detection needs of trace biomarkers (such as early disease markers or trace toxins). This technical bottleneck seriously restricts the further application of immunodetection methods in the fields of precision medicine and food safety, etc.

[0003] Nucleic acid amplification technology occupies a core position in the field of molecular detection due to its high sensitivity (up to fg / mL level) and high specificity (single-base distinguishing ability). By combining immunorecognition (such as antigen-antibody binding) with nucleic acid signal amplification, a “protein-nucleic acid conversion detection system” can be constructed to break through the sensitivity bottleneck of traditional immunodetection. Shun Hu et al. developed an immunomagnetic exosome polymerase chain reaction (iMEP) using DNA-conjugated antibodies. After capturing exosomes by DNA-labeled antibodies, PCR amplification detection was performed to realize the ultra-sensitive detection of Alzheimer's disease markers (Aβ and p-Tau proteins) in serum (sensitivity up to fg level); Alexandr V. Ivanov et al. combined recombinant polymerase amplification (RPA) with immunodetection technology by using a multiplication DNA probe to establish a rapid isothermal detection method for serum troponin T. However, such technologies still face key technical bottlenecks such as complex DNA-antibody coupling process (requiring chemical cross-linking or biotin-streptavidin bridging), low coupling efficiency, and unstable coupling effect, which restrict their standardized application in clinical detection.

[0004] MS2 virus like particle (MS2 VLP) is an artificial virus like particle based on MS2 bacteriophage (host is Escherichia coli). MS2 VLP has simple components, clear formation mechanism, and includes CP protein, mature protein A and pac RNA sequence carrying RNA (pac RNA) 3 components. Two dimers of 2 CP molecules interact with pac RNA sequence to promote spontaneous assembly, and finally 90 CP dimers and 1 molecule of A protein form a virus like particle wrapping exogenous RNA. MS2 VLP has good stability, and the inner cavity of the particle can wrap exogenous RNA, so it is widely researched and applied in nucleic acid standard, drug delivery, subunit vaccine and the like. However, there is no related report on combination of MS2 VLP surface display technology and nucleic acid molecule wrapping technology for detection of low abundance target molecules and trace biomarkers. SUMMARY

[0005] The purpose of the present application is to overcome the above-mentioned defects and deficiencies in the prior art, and to provide a plasmid vector containing a sequence capable of assembling into an MS2 virus like particle, a nucleic acid template capable of being wrapped into the MS2 virus like particle, and a coding sequence of an antigen binding agent to be displayed; the antigen binding agent is a polypeptide or protein capable of specifically binding to a test substance.

[0006] The second purpose of the present application is to provide an MS2 virus like particle.

[0007] The third purpose of the present application is to provide an immunonucleic acid amplification detection kit.

[0008] The fourth purpose of the present application is to provide an immunonucleic acid amplification detection method based on MS2 virus like particle.

[0009] The above purposes of the present application are realized by the following technical solutions: The present application provides a plasmid vector containing a sequence capable of assembling into an MS2 virus like particle, a nucleic acid template capable of being wrapped into the MS2 virus like particle, and a coding sequence of an antigen binding agent to be displayed; the antigen binding agent is a polypeptide or protein capable of specifically binding to a test substance.

[0010] The present application relates to a phage-like particle (MS2 VLP) surface display protein or polypeptide and internal nucleic acid molecule packaging technology. The present application displays a polypeptide or protein (such as a nanobody) capable of specific binding to a target protein on the surface of the MS2 VLP, while internally packaging a nucleic acid fragment. When the detection system contains the target protein to be detected, the protein or polypeptide displayed by the MS2 VLP binds to the target protein to be detected, the unbound MS2 VLP is washed away, the bound MS2 VLP is incubated at high temperature to lyse the internally packaged nucleic acid fragment, and then the recombinase polymerase amplification or fluorescence quantitative PCR detection method is used to detect the internally packaged nucleic acid of the bound MS2 VLP. The packaged nucleic acid sequence acts as a signal amplifier for target protein signal detection. This method can achieve simple, highly sensitive and specific target molecule detection, breaking through the bottleneck of traditional immunodetection methods in sensitivity, and effectively solving the problem of low efficiency of antibody and DNA coupling.

[0011] Further, the nucleic acid template is a CP gene sequence or an exogenous nucleic acid template sequence.

[0012] Further, the nucleic acid template is a CP gene sequence or an exogenous nucleic acid template sequence.

[0013] Further, the polypeptide or protein is a monoclonal antibody, a nanobody.

[0014] Further, the nanobody is N26 nanobody or TP1107 antibody. The present application further optimizes the MS2 virus-like particle-based immunonucleic acid amplification detection method, and displays TP1107 nanobody on the surface of the MS2 VLP in a multivalent manner. With the ability of TP1107 to specifically recognize and bind to the antibody IgG Fc fragment, a single VLP system can be adapted to multiple target detection, realizing a flexible detection mode of "one platform adapting multiple targets". This strategy significantly improves the universality and practicality of the MS2 VLP-based immunonucleic acid amplification method, and further improves the detection sensitivity through multivalent display, expanding its application potential in the field of diagnosis and facilitating the construction of modular detection architecture.

[0015] Further, the sequence capable of assembling into an MS2 virus-like particle includes an MS2 phage single-chain dimer CP gene sequence, a mature protein A coding sequence, and an RNA carrying a pac sequence.

[0016] Further, the polypeptide or protein sequence is adjacent to the 5' end of the mature protein A coding sequence.

[0017] Further, the CP gene sequence is shown in SEQ ID NO. 1.

[0018] The application also provides a MS2 virus-like particle, which is obtained by expression of the phage display strain into which the plasmid vector is transferred; the antigen binder is displayed on the surface of the capsid protein and the nucleic acid template is wrapped inside.

[0019] Further, the phage display strain is the E. coli ER2738 competence.

[0020] Further, the expression is induced by arabinose.

[0021] The application also provides an immunological nucleic acid amplification detection kit, which comprises the MS2 virus-like particle.

[0022] Further, the kit further comprises a solid carrier.

[0023] Further, the kit further comprises reagents required for recombinase polymerase amplification or reagents required for fluorescent quantitative PCR.

[0024] The application also provides an immunological nucleic acid amplification detection method based on the MS2 virus-like particle, which co-incubates the MS2 virus-like particle with a test object, washes away the MS2 virus-like particle that does not specifically bind to the test object, lyses the MS2 virus-like particle to release the nucleic acid template, and detects the nucleic acid template by using the recombinase polymerase amplification technology or the fluorescent quantitative PCR.

[0025] Further, the detection method of the recombinase polymerase amplification technology is that, after the MS2 VLP specifically binds to the target protein, the MS2 VLP that does not bind to the target protein is washed away, 10-20 min of incubation at 75-85℃ is performed to release the nucleic acid sequence inside the MS2 VLP, and the released nucleic acid sequence is amplified by using the recombinase polymerase isothermal amplification technology or the fluorescent quantitative PCR.

[0026] Still further, the reaction system of the recombinase polymerase amplification comprises primers, probes, buffers, recombinase and templates.

[0027] As an implementable mode, the application provides a specific method for detecting aflatoxin AFB1 by using the N26 MS2 VLP-based immunological recombinase polymerase amplification technology, and the steps are as follows: S1. Constructing a vector plasmid pBAD-2MS2-N26 containing a sequence capable of assembling into a MS2 virus-like particle, a CP nucleic acid sequence capable of being wrapped inside the MS2 virus-like particle, and a coding sequence of the N26 antigen binder to be displayed; S2. Transferring the pBAD-2MS2-N26 plasmid into the ER2738 competence to express, and identifying that the N26 MS2 VLP is successfully assembled and purified to obtain; S3. Add AFB1-BSA antigen (test sample) in 96-well plate, coat, block, then add N26 MS2 VLP and incubate, wash; S4. Incubate at 80°C for 10-20 min to release CP nucleic acid in N26 MS2 VLP combined with AFB1, and obtain RNA template; S5. Design primers (such as SEQ ID NO. 2-3) according to CP sequence (such as SEQ ID NO. 1); S6. According to the primers of step S5, the probe: 5'-CGTACTTAAATATGGAACTAACCATTCCAA[dT-FAM][THF][dT-BHQ1]TCGCTACGAATTCCGAC-C3 Spacer-3', isothermally amplified by RNA RPA isothermal amplification method, and the content of AFB1 in the sample is evaluated according to the CT value.

[0028] As an implementable manner, the present application also provides a specific method for detecting P-Tau217 protein based on TP1107 MS2 VLP fluorescence quantitative PCR, and the steps are as follows: S1. Construct a vector plasmid pBAD-2MS-TP1107 containing a sequence capable of assembling into MS2 virus-like particles, containing a VHH72 nucleic acid sequence that can be encapsulated into the inside of the MS2 virus-like particles, and a coding sequence of the TP1107 antigen binder to be displayed; S2. Transform the pBAD-2MS-TP1107 plasmid into ER2738 competent cells for expression, and identify that TP1107 MS2 VLP is successfully assembled, and is purified to obtain; S3. Add rabbit-derived P-Tau217 monoclonal nanobodies in 96-well plate, coat, block, then add P-Tau217 sample (test sample) and incubate; S4. Add mouse T-Tau monoclonal nanobodies, incubate, then add TP1107 MS2 VLP and incubate, and wash; S5. Incubate at 80°C for 10-20 min to release VHH72 nucleic acid in TP1107 MS2 VLP combined with TP1107, and obtain RNA template and reverse transcribe into cDNA; S5. Design primers (such as SEQ ID NO. 4-5) according to VHH72 sequence; S6. According to the primers of step S5, the cDNA is detected by fluorescence quantitative PCR, and the content of TP1107 in the sample is evaluated according to the CT value.

[0029] In the detection of aflatoxin AFB1 based on N26 MS2 VLP immunorecombinase polymerase amplification technology, it is found that the immunodetection method can realize the ultra-sensitive detection of AFB1, and the detection limit can reach pg level (5 pg / mL), which is significantly better than the traditional immunological analysis method, indicating that the immunological RPA detection method based on MS2 VLP is successfully established; in the fluorescence quantitative PCR detection of P-Tau217 protein based on TP1107 MS2 VLP, the detection limit can reach 1.6 pg / mL, indicating that the daELISA-PCR method based on TP1107 MS2 VLP can further improve the detection sensitivity, and the use of different detection antibodies can realize the flexible conversion of the detection target, and improve the applicability of the detection method. Therefore, the method of the present application can be further applied to the field of food safety (such as grain toxin detection) and the field of clinical diagnosis (such as the detection of low-abundance biomarkers in body fluids), and provides a new technical solution for molecular detection.

[0030] Therefore, the present application also provides the application of the above-mentioned immunodetection method in the field of food safety and the field of clinical diagnosis.

[0031] Further, the application is the detection of grain toxins in the field of food safety; the detection of low-abundance biomarkers in the field of clinical diagnosis.

[0032] Compared with the prior art, the present application has the following beneficial effects: The present application provides an immunonucleic acid amplification detection kit and detection method based on MS2 virus-like particles, the kit contains MS2 virus-like particles, the surface of the MS2 VLP displays an antigen binding substance capable of specifically binding with the target, and the inside is wrapped with a nucleic acid template; after the MS2 VLP specifically binds with the target, the nucleic acid fragment wrapped inside the combined MS2 VLP is detected by using recombinase polymerase amplification technology or real-time fluorescent quantitative PCR, and the wrapped nucleic acid sequence serves as a signal amplifier, which can improve the detection sensitivity of the target protein. Using this method, simple, highly sensitive and specific target molecule detection can be realized, breaking through the bottleneck of the sensitivity of traditional immunodetection methods, and effectively solving the problem of low antibody and nucleic acid coupling efficiency in the existing protein-nucleic acid conversion detection system; in addition, further by means of the specific recognition ability of TP1107 nanobody to IgG Fc fragment, the detection platform is endowed with wide universality, and the sensitivity and practicability of the detection are further improved. At the same time, the detection method of the present application is also applicable to the field of food safety (such as grain toxin detection) and the field of clinical diagnosis (such as the detection of low-abundance biomarkers in body fluids), and provides a new technical solution for molecular detection. BRIEF DESCRIPTION OF DRAWINGS

[0033] Figure 1Structure design and detection flow chart for displaying antibody on the surface of MS2 VLP and packaging nucleic acid sequence during assembly.

[0034] Figure 2 Detection results of pBAD-2MS2-N26 vector expression in ER2738 competent cells and morphology observation of MS2 VLP obtained by assembly.

[0035] Figure 3 Verification of detection results of nucleic acid packaged by MS2 VLP using RPA detection system.

[0036] Figure 4 Detection of BSA-AFB1 captured N26 MS2 VLP packaged nucleic acid using RPA technology.

[0037] Figure 5 Standard curve constructed using iELISA-RPA to detect AFB1.

[0038] Figure 6 Detection results of pBAD-2MS2-TP1107 vector expression in ER2738 competent cells, morphology observation of MS2 VLP obtained by assembly and TP1107 MS2 VLP specificity verification results.

[0039] Figure 7 Standard curve constructed using RT-PCR to detect MS2 VLP packaged VHH72.

[0040] Figure 8 Standard curve constructed using dsELISA-PCR to detect P-Tau217. DETAILED DESCRIPTION

[0041] The present application will be further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present application in any form. Unless otherwise specified, the reagents, methods and equipment used in the present application are conventional reagents, methods and equipment in the technical field.

[0042] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0043]

[0044] Instruments used in the specific examples: Ultra-clean workbench, water bath, constant temperature incubator, constant temperature shaker, protein purification instrument, low-temperature high-speed centrifuge, developing instrument, Bole CFX Connect qPCR instrument, microplate reader.

[0045] Example 1: Displaying N26 nanobody on the surface of MS2 VLP and packaging Cp nucleic acid sequence during assembly Aflatoxin is a common fungal toxin contaminant in agricultural products such as corn and peanuts. Due to its strong toxicity and carcinogenicity (especially closely related to liver cancer), it is listed as a key monitoring object of food safety. Among the various isomers of aflatoxin, aflatoxin B1 (AFB1) is the most toxic, and its detection technology development is of great significance. N26 nanobody is a single-domain antibody derived from Camelidae, which has high affinity and specificity, and can specifically recognize and bind AFB1. At the same time, it is easy to express and modify in prokaryotic system. In this embodiment, N26 nanobody is displayed on the surface of MS2 VLP using aflatoxin AFB1 as an example, and Cp nucleic acid sequence wrapped as a signal amplifier to construct an immune nucleic acid detection method based on MS2 VLP. Figure 1 A, B show the structural design of N26 MS2 VLP and the flow chart of detection.

[0046] 1. Experimental method 1.1 Construction of vector (1) Commissioning Shengong to synthesize pBAD-2MS2-N26 plasmid vector. The key sequence of pBAD-2MS2-N26 plasmid vector is shown in Figure 1 A a, which contains the coding sequence of mature protein A, RNA carrying pac sequence, MS2 phage single-chain dimer Cp gene sequence and N26 nanobody sequence to be displayed. The coding sequence of N26 nanobody is next to the 5' end of the A protein coding sequence, and in addition, it contains a His tag sequence for protein purification.

[0047] (2) The cross section and assembly diagram of N26 MS2 VLP is shown in Figure 1 A b, c, the capsid protein dimer interacts with the pac site (-ACAUGAGGAUUACCCAUGU-), spontaneously assembles into a virus-like particle with a nearly icosahedral structure, and at the same time, the Cp nucleic acid sequence is wrapped inside (when designing the plasmid, the pac site is integrated into the exogenous sequence, which can realize the wrapping of the exogenous sequence in the VLP), and the N26 nanobody is displayed on the A protein and Flag tag.

[0048] 1.2 pBAD-2MS2-N26 vector is transformed into ER2738 competent cells for expression (1) Escherichia coli ER2738 competent cells (purchased from Weidi Company) are used as pBAD-2MS2-N26 expression host; and pBAD-2MS2-N26 is transformed into ER2738 according to the instructions, and positive colonies are selected for expression; (2) Activate the positive colonies overnight, take the overnight bacterial solution 1:100, add fresh culture medium containing antibiotics, incubate for 3h, then add arabinose for induction for 12h, and recover the bacterial body. (3) Resuspend the bacteria with PBS, and break them on ice by ultrasonic. Take 2 mL of the broken solution, centrifuge at 12000 rpm for 15 min at 4°C, add RNase and DNase, and digest at 37°C for 30 min (digest the residual E. coli genomic DNA and RNA on the surface of VLP, and protect the sequence in VLP from digestion when VLP is correctly assembled). After digestion, take 10 μL of the supernatant and perform agarose gel electrophoresis to identify whether MS2 VLP is formed.

[0049] 1.3 Purification of MS2 VLP (1) Purify the broken supernatant containing MS2 VLP by nickel column affinity chromatography. The purification instrument is AKTA avant chromatograph (protein purification system), and the purification process is performed according to the operation manual. Finally, MS2 VLP is obtained by elution with 250 mM imidazole. (2) Identify MS2 VLP by SDS-PAGE and Western blot (WB).

[0050] 2. Experimental results (1) The pBAD-2MS2-N26 vector is introduced into E. coli ER2738, and arabinose is used for induction expression. The results are shown in Figure 2 A: After expression, the broken supernatant of the bacteria is digested by RNase and DNase, and there is an obvious band between 1500 bp and 1000 bp, indicating that pBAD-2MS2-N26 can form MS2 VLP in ER2738.

[0051] (2) The supernatant containing MS2 VLP is purified by nickel column affinity chromatography, and the purified sample is obtained by elution with 250 mM imidazole. The identification results of SDS-PAGE and WB are shown in Figure 2 B: The 250 mM imidazole elution peak sample has an obvious band between 25 kDa and 33 kDa, which is consistent with the expected single-chain dimer, and there is a band near 72 kDa, which is consistent with the expected N26-A protein. Further detection with anti-Flag antibody, the WB results are shown in Figure 2 C: The band near 72 kDa carries a Flag tag.

[0052] (3) The micro-morphology of the purified MS2 VLP is observed and analyzed by transmission electron microscope, and the results are shown in Figure 2 D: MS2 VLP is successfully assembled into an icosahedron with a diameter of about 20 nm. Further analysis of the particle size distribution of MS2 VLP by dynamic light scattering (DLS) technology, the results are shown in Figure 2 E: The average hydrodynamic diameter of MS2 VLP is 25.43 ± 4.639 nm.

[0053] Example 2 Immune recombinase polymerase amplification technology based on N26 MS2 VLP for detection of aflatoxin AFB1 1. Establishment of detection of MS2 VLP-encapsulated nucleic acid and immune RPA method 1.1 Design of primers and probes based on Cp sequence The related primers and probes were synthesized by Genesee Scientific Biotech Co., Ltd. The target sequence was 5'-GCAACCCAGACTGTTGGTGGTGTAGAGCTTCCTGTAGCCGCATGGCGTTCGTACTTAAATATGGAACTAACCATTCCAATTTTCGCCACGAATTCCGACTGCGAGCTTATTGTTAAGGCAATGCAAGGTCTCCT-3' (SEQ ID NO. 1); the sequence of the upstream primer was 5'-GCAACCCAGACTGTTGGTGGTGTAGAGCTTC-3' (SEQ ID NO. 2); the sequence of the downstream primer was 5'-AGGAGACCTTGCATTGCCTTAACAATAAGCT-3' (SEQ ID NO. 3); and the probe was 5'-CGTACTTAAATATGGAACTAACCATTCCAA[dT-FAM][THF][dT-BHQ1]TCGCTACGAATTCCGAC-C3Spacer-3'.

[0054] 1.2 RPA detection of MS2 VLP-encapsulated nucleic acid (1) 50 μL of MS2 VLP with a concentration of 2 μg / mL was heated at 80°C for 15 min to lyse the VLP and release the nucleic acid, and 2 μL of RNAase inhibitor was added to obtain the nucleic acid template; (2) The designed primers and probes were used to perform isothermal amplification of the VLP-encapsulated RNA target sequence according to the instructions of the RNA RPA isothermal amplification kit. The reaction system was 20 μL, including 0.42 μL of Forword Primer (20 μM), 0.42 μL of ReservePrimer (20 μM), 0.6 μL of Probe (4 μM), 10 μL of Reaction Buffer (2×), 2 μL of E-mix (10×), 2 μL of P-mix (10×), 0.56 μL of DEPC water, 2 μL of RNA template, and 2 μL of Starter. The amplification was performed at 40°C for 45 cycles, with 40 s for each cycle. DEPC water was used to replace the RNA template in the negative control. The positive control was provided by the kit.

[0055] 1.3 Establishment of immune RPA method (1) 96-well plate added 100 μL of 0.05 μg / mL AFB1-BSA antigen, negative control for no AFB1-BSA coating solution, 37°C coating 2h; (2) Discard the coating solution, add 300 μL of 0.15% PBST to each well, stand for 5 min, discard the washing solution, repeat washing three times; after the last washing, dry, add 300 μL of protein-free quick blocking solution to each well, 37°C blocking for 10 min; (3) Discard the blocking solution, wash three times, add 100 μL of 1 μg / mL MS2 VLP to each well, 37°C incubation for 1 hour; discard the MS2 VLP, wash with 300 μL of 0.15% PBST five times, then wash with 300 μL of DEPC water three times, 80°C incubation for 15 min, remove water vapor by instant centrifugation, add 2 μL of RNAase inhibitor to each well to obtain the RNA template; (4) Use the designed primers and probes to perform isothermal amplification of the above-mentioned RNA template on MS2 VLP according to the RNA RPA isothermal amplification instructions, and the reaction system is the same as above.

[0056] 1.4 iELISA-RPA detection of AFB1 (1) 96-well plate added 100 μL of 0.05 μg / mL AFB1-BSA antigen, 37°C coating 2h; (2) Discard the coating solution, add 300 μL of 0.15% PBST to each well, stand for 5 min, discard the washing solution, repeat washing three times; after the last washing, dry, add 300 μL of protein-free quick blocking solution to each well, 37°C blocking for 10 min; (3) Discard the blocking solution, wash three times, add 50 μL of 4 μg / mL MS2 VLP and 50 μL of 10-fold gradient dilution of AFB1 (20% methanol solution, concentration of 50 ng / mL, 5 ng / mL, 0.5 ng / mL, 50 pg / mL, 5 pg / mL, 0.5 pg / mL) to each well, negative control added 50 μL of 4 μg / mL MS2 VLP and 50 μL of 20% methanol, 37°C incubation for 1 hour; discard the MS2 VLP, wash with 300 μL of 0.15% PBST five times, then wash with 300 μL of DEPC water three times, 80°C incubation for 15 min, remove water vapor by instant centrifugation, add 2 μL of RNAase inhibitor to each well to obtain the RNA template; (4) Use the designed primers and probes to perform isothermal amplification of the above-mentioned RNA template on MS2 VLP according to the RNA RPA isothermal amplification instructions, and the reaction system is the same as above.

[0057] 2. Experimental results (1) The MS2 VLP was heated and cracked at high temperature to release the nucleic acid wrapped therein, and the RPA was used for detection, and the results are shown in Figure 3 The positive control and the nucleic acid released by cracking the MS2 VLP both showed amplification curves, while the negative control did not detect the amplification signal. It is shown that the established RPA detection system has good detection sensitivity for the nucleic acid wrapped by the MS2 VLP.

[0058] (2) The BSA-AFB1 wrapping system was used, the N26 MS2 VLP was used to capture the BSA-AFB1, and the RPA technology was used to detect the nucleic acid wrapped by the VLP, and the results are shown in Figure 4 The positive control and the nucleic acid released by cracking the MS2 VLP both showed amplification curves, while the negative control did not detect the amplification signal. It is shown that the established RPA detection system has good detection sensitivity for the nucleic acid wrapped by the MS2 VLP.

[0059] (3) Based on the above system, the iELISA-RPA detection AFB1 was constructed, taking the Ct value (the difference between the Ct value of the sample added and the Ct value of the negative control) as the vertical coordinate, and the logarithmic value of the AFB1 concentration as the horizontal coordinate, to draw a standard curve, and the fitting curve and equation are shown in Figure 5 The fitting equation is Y = 4.987 log 10 X + 0.5678, R 2 = 0.9784, and the LOD is calculated according to the baseline mean plus 3 times the maximum baseline standard deviation (3σ), and the detection limit is 5 pg / mL. It can be seen that the detection method constructed by the application is significantly better than the traditional immunoassay method.

[0060] Example 3: Establishment of an immunological real-time fluorescent quantitative PCR method based on TP1107 MS2 VLP TP1107 nanobody is a single-domain antibody developed by Tino Pleiner et al. which specifically binds to mouse IgG1 Fc fragment, can be expressed in E. coli with high efficiency and solubility, has high affinity and specificity, and provides a reliable animal-friendly solution to replace the traditional secondary antibody. In this embodiment, TP1107 nanobody is multivalently displayed on the surface of MS2 VLP, and the novel coronavirus spike protein receptor binding domain gene sequence (VHH72) is wrapped in it, which fully utilizes the specific binding ability of TP1107 to IgG1 Fc fragment, significantly improves the applicability of the immunological nucleic acid amplification method based on MS2 VLP. At the same time, the multivalent display of TP1107 further enhances the sensitivity of the detection, which brings a new breakthrough for the optimization of related detection technology. Figure 1C, D show the structural design of TP1107 MS2 VLP and the detection flowchart schematic diagram. To verify the system performance, the neurodegenerative disease marker p-Tau217 protein was used as the detection object, and the excellent performance of the VLP system in the immunological nucleic acid amplification method was verified.

[0061] 1. Displaying TP1107 nanobodies on the surface of MS2 VLP and packaging VHH72 nucleic acid sequence 1.1 Construction of vector pBAD-2MS-TP1107 plasmid vector was synthesized by GenScript. The key sequence of pBAD-2MS-TP1107 plasmid vector is as shown in Figure 1 C, which contains packaging sequence, MS2 phage single-chain dimer Cp gene sequence, TP1107 nanobody sequence to be displayed, and novel coronavirus spike protein receptor binding domain gene sequence (VHH72), in addition to His tag sequence for protein purification.

[0062] The cross-section and assembly schematic diagram of TP1107 MS2 VLP is as shown in Figure 1 C b, c, the capsid protein dimer interacts with the pac site, spontaneously assembles to form a virus-like particle with a nearly icosahedral structure, at the same time, the VHH72 nucleic acid sequence is packaged inside, and the TP1107 nanobody is displayed on the surface.

[0063] 1.2 pBAD-2MS2-TP1107 vector is transformed into ER2738 competent cells for expression Figure 6 A) (1) Escherichia coli ER2738 competent cells (purchased from Weidi Company) were used as pBAD-2MS2-TP1107 expression host, and pBAD-2MS2-TP1107 was transformed into ER2738 according to the instruction, and positive colonies were picked for expression; (2) The positive colonies were activated overnight, and 1:100 of the overnight bacterial solution was added to fresh culture medium containing antibiotics for 3h, then arabinose was added for induction for 12h, and the bacterial body was recovered; (3) The bacterial body was resuspended with PBS, and was broken by ultrasonic on ice; 2mL of the broken solution was centrifuged at 12000rpm for 15min at 4°C, RNAse and DNAse were added, and the mixture was digested at 37°C for 30min; 10μL of the supernatant after digestion was subjected to DNA agarose gel electrophoresis to identify whether MS2 VLP was formed.

[0064] 1.3 Purification of MS2 VLP (1) The supernatant containing MS2 VLP was purified by nickel column affinity chromatography. The purification instrument was AKTA avant chromatograph (protein purification system), and the purification process was performed according to the operation manual. Finally, MS2 VLP was obtained by elution with 250 mM imidazole; (2) SDS-PAGE and Western blot (WB) were used to identify MS2 VLP.

[0065] 1.4 Verification of TP1107 MS2 VLP capture antibody specificity (1) 100 ng of mouse IgG, rabbit IgG and human IgG antibodies were coated on an enzyme-labeled plate respectively at 37°C for 2 h. (2) Discard the coating solution, add 300 μL of 0.15% PBST to each well, stand for 5 min, discard the washing solution, and repeat the washing three times. After the last washing, dry the plate, add 300 μL of protein-free blocking solution to each well, and incubate at 37°C for 10 min. (3) Discard the blocking solution, wash three times, and add 100 μL of gradient-diluted TP1107 MS2 VLP (original concentration: 2.8 mg / mL, dilute at 1:250, 1:500, 1:1000, 1:2000, 1:4000, 1:8000, and 1:16000) to each well. The negative control is 0.1% BSA, and incubate at 37°C for 1 h. (4) Discard the above solution, wash three times with 300 μL of 0.15% PBST per well, and add 100 μL of His-HRP, and incubate at 37°C for 1 h. (5) Discard the His-HRP, wash 5 times with 0.15% PBST, and use an enzyme-labeled instrument to detect the absorbance value at 450 nm.

[0066] 1.5 Experimental results (1) pBAD-2MS2-TP1107 vector was introduced into E. coli ER2738, and arabinose was used for induction expression. The results are shown in FIG. B: after RNAse and DNAse digestion, there was a clear band near 2000 bp in the supernatant after cell disruption, indicating that pBAD-2MS2-TP1107 could form MS2 VLP in ER2738. Figure 6

[0067] (2) The supernatant containing MS2 VLP was purified by nickel column affinity chromatography, and the purified sample was obtained after elution with 250 mM imidazole. The identification results are shown in FIG. C: the purified sample showed a clear band near 2000 bp in SDS-PAGE, indicating that the purified sample was MS2 VLP. Figure 6 ​As shown in Fig. C, the 250Mm imidazole elution peak sample had obvious bands near 15 kDa, which was consistent with the expected value of single Cp (13.7K), bands at 33-25 kDa, which was consistent with the expected value of Cp-TP1107-His protein (30.3 kDa), and bands near 43 kDa, which was consistent with the expected value of protein A (44 kDa).

[0068] (3) Transmission electron microscopy was used to observe and analyze the micro-morphology of the purified MS2 VLP, and the results are shown in Fig. Figure 6 As shown in Fig. D, MS2 VLP was successfully assembled into an icosahedron with a diameter of about 20 nm; image J was used to statistically analyze the particle size distribution of MS2 VLP, and the results are shown in Fig. Figure 6 As shown in Fig. E, the average diameter of MS2 VLP was 24.08 ± 1.02 nm.

[0069] (4) The results of ELIS are shown in Figs. Figure 6 F and G, TP1107 MS2 VLP can specifically bind to mouse IgG and human IgG, and has stronger binding ability to mouse IgG than to human IgG, but almost no binding to rabbit IgG, which is consistent with the research results of Tino Pleiner.

[0070] 2. Establishment of nucleic acid detection standard curve based on TP1107 MS2 VLP 2.1 Primer design based on VHH72 sequence The related primers were synthesized by Genesee Scientific Biotechnology Co., Ltd. The upstream primer sequence was 5'-TGTGCCCTTTTGGTGAAGTT-3' (SEQ ID NO. 4), and the downstream primer sequence was 5'-TACCACCAACCTTAGAATCAAGAT-3' (SEQ ID NO. 5). 2.2 RT-PCR detection of MS2 VLP packaged VHH72 to construct standard curve

[0071] (1) Take 50 μL of TP1107 MS2 VLP with a concentration of 1.89 mg / mL, dilute 10 times to 1.89 pg / mL, heat at 80°C for 15 min to lyse VLP and release nucleic acid, add 2 μL of RNase inhibitor to obtain nucleic acid template; (2) Using the designed primers, the cDNA of VHH72 was obtained by reverse transcription according to the reagent instruction of PrimeScriptTM RT reagent Kit with gDNA Eraser of Baori Medical Biotechnology (Beijing) Co., Ltd. (2) Using the designed primers, the cDNA of VHH72 was obtained by reverse transcription according to the reagent instruction of PrimeScriptTM RT reagent Kit with gDNA Eraser of Baori Medical Biotechnology (Beijing) Co., Ltd. (3) The obtained cDNA was amplified by PCR according to the SYBR® Green Premix Pro Taq HS qPCR kit of Hunan Aikerui Biotechnology Co., Ltd. The qPCR reaction system was 20 μL, including 10 μL 2×SYBR® Green ProTaq HS Premix, 1 μL Forward Primer, 1 μL Reserve Primer, 2 μL cDNA template, and 6 μL RNaseFree dH2O; 95℃ for 2 min; 95℃ for 5 s, 60℃ for 30 s; amplification for 39 cycles; 95℃ for 5 s; 65℃ for 5 s; 95℃ for 50 s.

[0072] 2.3 Experimental Results A standard curve was plotted using the logarithm of the dilution factor and the Ct value, as shown below. Figure 7 As a result, the correlation coefficient R of the curve 2 =0.9989, slope is -2.6648, intercept is 31.945, and the linear correlation expression of the standard curve is y=-2.6648x+31.945.

[0073] Example 4: Detection of P-Tau217 protein by real-time PCR based on TP1107 MS2 VLP 1. Establishment of dsELISA-PCR method (1) Add 100 μL of rabbit-derived P-Tau217 monoclonal nanobody (2 μg / mL) to a 96-well plate and coat it at 37°C for 2 h. (2) Discard the coating solution, add 300 μL of 0.15% PBST to each well, let stand for 5 min, discard the washing solution, and repeat the washing three times; after the last washing, pat dry, add 300 μL of protein-free rapid blocking solution to each well, and block at 37°C for 10 min. (3) Discard the blocking solution, wash three times, and add 100 μL of P-Tau217 standard diluted 5 times (concentrations of 250 ng / mL, 50 ng / mL, 25 ng / mL, 5 ng / mL, 1 ng / mL, 0.2 ng / mL, 0.04 ng / mL, 8 pg / mL, 1.6 pg / mL, 0.32 pg / mL, 0.16 pg / mL, and 0.08 pg / mL, respectively) to each well. Add 100 μL of 0.15% PBST containing 0.05% BSA to the negative control. Incubate at 37°C for 1 h. (4) Discard the antigen, wash three times with 300 μL of 0.15% PBST per well, add 100 μL of 0.75 μg / mL mouse T-Tau monoclonal nanobody, and incubate at 37°C for 1 h; (5) Discard the antibody, wash three times with 300 μL of 0.15% PBST per well, add 100 μL of 2 μg / mL TP1107MS2 VLP, and incubate at 37°C for 1 h; (6) Discard MS2 VLP, wash five times with 300 μL of 0.15% PBST in each well, then wash three times with 300 μL of DEPC water, incubate at 80℃ for 15 min, centrifuge briefly to remove water vapor, add 2 μL of RNase inhibitor to each well to obtain RNA template; (4) Using the designed primers, VHH72 was reverse transcribed to obtain cDNA according to the instructions of PrimeScript™ RTreagent Kit with gDNA Eraser from Baori Biotechnology (Beijing) Co., Ltd. (5) In accordance with the SYBR Bioengineering Co., Ltd. of Hunan Aikerui Biotechnology Co., Ltd. ® The Green Premix Pro Taq HS qPCR kit was used to amplify the obtained cDNA by PCR. The qPCR reaction volume was 20 μL, including 10 μL of 2×SYBR. ® Green Pro TaqHS Premix, 1 μL Forward Primer, 1 μL Reserve Primer, 2 μL cDNA template, 6 μL RNase Freed H2O; 95℃ for 2 min; 95℃ for 5 s, 60℃ for 30 s; amplify 39 cycles; 95℃ for 5 s; 65℃ for 5 s; 95℃ for 50 s.

[0074] 2. Experimental Results Based on the above system, a dsELISA-PCR detection method was constructed to detect P-Tau217. A standard curve was plotted with ΔCt (the difference between the Ct value of the added sample and the Ct value of the negative control) as the ordinate and the logarithm of the P-Tau217 concentration as the abscissa. Figure 8 The fitted curve and equation are shown below. The fitted equation is Y = -0.5905 + 25.8705 / [1 + 10]. 0.4192(2.568-X) ], R 2 =0.9976. The limit of detection (LOD) was calculated by adding three times the maximum baseline standard deviation (3σ) to the baseline mean, resulting in a detection limit of 1.6 pg / mL. This shows that the daELISA-PCR method based on TP1107MS2 VLP can further improve the detection sensitivity. At the same time, the use of different detection antibody pairs can achieve flexible switching of detection targets, improving the applicability of this detection method.

Claims

1. A plasmid vector, characterized in that, It contains a sequence capable of assembling into MS2 virus-like particles, a nucleic acid template capable of being encapsulated into MS2 virus-like particles, and a coding sequence for an antigen conjugate to be displayed; the antigen conjugate is a polypeptide or protein capable of specifically binding to the analyte.

2. The plasmid vector according to claim 1, characterized in that, The nucleic acid template is the CP gene sequence or an exogenous nucleic acid template sequence.

3. The plasmid vector according to claim 1, characterized in that, The polypeptide or protein is a monoclonal antibody or nanobody.

4. The plasmid vector according to claim 3, characterized in that, The nanobody is either an N26 nanobody or a TP1107 antibody.

5. The plasmid vector according to claim 1, characterized in that, The polypeptide or protein sequence is adjacent to the 5' end of the MS2 virus-like particle mature protein A coding sequence.

6. An MS2 virus-like particle, characterized in that, It is obtained by expressing the plasmid vector described in any one of claims 1 to 5 into a phage display strain; its capsid protein surface displays antigen conjugates and encapsulates a nucleic acid template inside.

7. An immunonucleic acid amplification detection kit, characterized in that, It contains the MS2 virus-like particles as described in claim 6.

8. The reagent kit according to claim 7, characterized in that, The kit also includes a solid-phase support.

9. The reagent kit according to claim 7, characterized in that, The kit also contains reagents required for recombinase polymerase amplification or for quantitative real-time PCR.

10. A method for detecting MS2 virus-like particles using immunonucleic acid amplification, characterized in that, The MS2 virus-like particles described in claim 6 are co-incubated with the analyte, and the MS2 virus-like particles that do not specifically bind to the analyte are washed away. The MS2 virus-like particles are lysed to release the nucleic acid template, and the nucleic acid template is detected by recombinase polymerase amplification technology or real-time PCR.