Method for regulating and controlling fish skeletal development through runx2b promoter methylation editing and application thereof

By using the CRISPR/dCas9-Dnmt7 system to target the promoter region of the zebrafish runx2b gene for DNA methylation editing, the biosafety issues caused by DNA sequence alterations in existing technologies have been resolved. This approach achieves the reduction of intermuscular bone without altering the DNA sequence, making it suitable for aquaculture breeding.

CN121362793APending Publication Date: 2026-01-20SOUTH CHINA NORMAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511455720.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-12
Publication Date
2026-01-20

AI Technical Summary

Technical Problem

Existing technologies for reducing intermuscular bone in fish rely on permanent DNA sequence alterations, leading to biosafety and ecological concerns, hindering commercial applications and regulatory approvals. Furthermore, traditional methods are difficult to remove intermuscular bone and pose potential health hazards.

Method used

By fusing the CRISPR/dCas9 system with the Dnmt7 catalytic domain, DNA methylation editing was performed on the promoter region of the zebrafish runx2b gene. This increased promoter methylation levels suppressed runx2b gene expression and reduced intermuscular bone formation.

Benefits of technology

It achieves precise regulation of runx2b gene expression without altering the DNA sequence, significantly reducing intermuscular bone formation, maintaining genome integrity, and exhibiting cross-generational heritability, making it suitable for aquaculture breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121362793A_ABST
    Figure CN121362793A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biology, and particularly relates to a construction method of epigenome edited zebrafish, sgRNA of a targeted zebrafish runx2b gene promoter region and application of the sgRNA. The invention provides a construction method of epigenome edited zebrafish, which comprises the step of carrying out methylation editing by using a CRISPR / dCas9-methyltransferase system targeting runx2b gene promoter region, thereby inhibiting runx2b gene expression and reducing intermuscular bone formation. According to the method, the expression level of the runx2b gene is accurately regulated and controlled through an epigenetic editing technology on the premise that a DNA sequence is not changed, and formation of fish intermuscular bones is effectively reduced. The zebra fish F0 treated by the method represents that the runx2b mRNA expression level is obviously reduced, and the intermuscular bones of the eleventh to sixteenth sarcomedo regions of adult F0 generation fish are obviously shorter than those of a control group, and the shortening range reaches 23.3% to 38.8%. Besides, the method provides theoretical basis and technical support for improving fish economic traits by accurately regulating and controlling the expression mode of the key economic trait gene and simultaneously keeping the integrity of genome DNA (Deoxyribose Nucleic Acid).
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a method for targeting DNA methylation editing zebrafish, regulation of zebrafish skeletal development by zebrafish runx2b gene promoter region methylation editing and application thereof. BACKGROUND

[0002] Intervertebral bones are small bony spurs embedded in the intermuscular septum on both sides of the vertebral body in fish, which belong to part of the skeletal structure. According to the attachment position on the fish body, they are divided into myeloid arch bones, vertebral body bones and aortic arch bones. Different fish have different types of intervertebral bones, for example, zebrafish lacks vertebral body bones, but retains myeloid arch bones and aortic arch bones. Intervertebral bones are difficult to remove, difficult to process and have potential health hazards to the throat or digestive organs, which has a negative impact on the consumer acceptance and economic value of aquaculture.

[0003] In the past decade, a large number of studies have been devoted to elucidating the molecular mechanisms of fish intervertebral bone development, and new strains with fewer or no intervertebral bones have been bred through genetic selection. Recently, the traditional method of reducing intervertebral bones through genetic selection has been optimized by using CRISPR / Cas9-mediated key gene knockout technology, and fish strains without intervertebral bones have been successfully created in zebrafish, Megalobrama amblycephala and Carassius auratus. However, this strategy relies on permanent DNA sequence changes, which raises unresolved biosafety and ecological concerns, hindering commercial application and regulatory approval.

[0004] Epigenetic modifications, including DNA methylation, histone modification and non-coding RNA-mediated regulation, provide a promising alternative to regulate gene expression patterns without relying on DNA sequence changes. As the most widely studied epigenetic modification, this biological process involves the addition of a methyl group (-CH3) to specific positions on the genomic DNA under the catalysis of DNA methyltransferases (DNMTs), causing changes in chromatin structure and DNA conformation, and affecting the stability of DNA and its interaction mode with other proteins, thereby regulating gene expression. To utilize such mechanisms, the CRISPR / catalytically inactive Cas9 (dCas9) system achieves reversible and sequence-preserving gene regulation by fusing dCas9 with effector domains such as DNMTs and TETs. Notably, recent studies have shown that epigenetic markers and related phenotypes induced by DNA methylation editing can be stably inherited across generations in mice.

[0005] Given these capabilities, epigenome editing offers significant advantages for targeted breeding within regulatory and consumer acceptance frameworks. Despite its great potential, its application in aquaculture breeding has not been explored so far. SUMMARY

[0006] Based on this, an embodiment of the present application provides a construction method for targeting DNA methylation editing zebrafish, regulating zebrafish bone development through methylation editing of the promoter region of the runx2b gene of zebrafish, and application thereof.

[0007] In one aspect, the present application provides a construction method for gene editing zebrafish, comprising: targeting to increase the methylation level of the promoter region of the runx2b gene of zebrafish, and preparing zebrafish with DNA methylation editing and intact genomic DNA.

[0008] In one embodiment, the gene editing is in the form of CRISPR / dCas9.

[0009] In one embodiment, it comprises: co-introducing sgRNA targeting the promoter region of the runx2b gene of zebrafish and CRISPR / dCas9-methyltransferase system into zebrafish embryos.

[0010] In one embodiment, the targeting of the promoter region of the runx2b gene uses at least one sgRNA, and the sgRNA targets the position of-268bp or-419bp upstream of the start codon of the runx2b gene.

[0011] In one embodiment, the nucleotide sequence of the sgRNA is shown in SEQ ID NO. 1-SEQ ID NO. 2; and / or

[0012] The CRISPR / dCas9-methyltransferase system comprises a fusion protein of dCas9 and the catalytic domain of Dnmt7.

[0013] In one embodiment, it comprises the following steps:

[0014] S1, constructing a CRISPR / dCas9-methyltransferase system;

[0015] S2, co-injecting the CRISPR / dCas9-methyltransferase system and sgRNA targeting the promoter of the runx2b gene into zebrafish single-cell stage embryos.

[0016] In one embodiment, the S2 comprises: injecting a mixture of dCas9-Dnmt7 mRNA and sgRNA into zebrafish single-cell stage embryos;

[0017] In one embodiment, the concentration of dCas9-Dnmt7 mRNA is 400ng / μL, and the concentration of sgRNA is 200ng / μL.

[0018] In another aspect, the application provides an sgRNA targeting the promoter region of the zebrafish runx2b gene, the nucleotide sequence of which is shown in SEQ ID NO. 1-2.

[0019] In another aspect, the application provides a gene editing product, which comprises the above-mentioned sgRNA targeting the promoter region of the zebrafish runx2b gene and a DNA methylation editing system.

[0020] In another aspect, the application provides a cell, tissue or organ of a gene edited zebrafish constructed by the above-mentioned method for constructing a gene edited zebrafish.

[0021] In another aspect, the application provides the above-mentioned cell, tissue or organ of a gene edited zebrafish for use in the study of intermuscular bones in aquaculture.

[0022] The application provides a method for constructing a gene edited zebrafish, which comprises using a CRISPR / dCas9-methyltransferase system to target the promoter region of the runx2b gene for methylation editing, thereby inhibiting the expression of the runx2b gene and reducing the formation of intermuscular bones. This method precisely regulates the expression level of the runx2b gene without changing the DNA sequence through epigenetic editing technology, effectively reducing the formation of intermuscular bones in fish. Experimental results show that zebrafish F0 treated using this method exhibit a significantly reduced runx2b mRNA expression level, and the intermuscular bones in the 11th to 16th myotome regions of adult F0 fish are significantly shorter than those in the control group, with a shortening range of 23.3% to 38.8%. In addition, this method precisely regulates the expression pattern of key economic trait genes while maintaining the integrity of the genomic DNA, providing a theoretical basis and technical support for improving fish economic traits. BRIEF DESCRIPTION OF DRAWINGS

[0023] In order to more clearly illustrate the technical solutions in the embodiments of the application, more completely understand the application and its beneficial effects, the following will briefly introduce the drawings needed in the embodiment description. Obviously, the drawings in the following description are only some embodiments of the application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0024] Figure 1 pT3TS-dCas9-Dnmt7 plasmid template;

[0025] Figure 2 Targeting runx2b promoter sgRNA position diagram;

[0026] Figure 3Relative expression of runx2b gene at 48hpf for F0 generation;

[0027] Figure 4 Whole mount in situ hybridization embryos of runx2b gene at 48hpf for F0 generation;

[0028] Figure 5 Relative expression of runx2b gene at 40dpf for F0 generation;

[0029] Figure 6 Average methylation level of runx2b promoter for F0 generation; p>0.05 (ns);

[0030] Figure 7 Methylation level of individual CpG site of runx2b promoter for F0 generation; ****p<0.0001;

[0031] Figure 8 Alizarin red staining map for F0 generation; en indicates mylontic arches, ep indicates mylontic arches;

[0032] Figure 9 Interspinale bone length statistics for F0 generation; *p<0.05, **p<0.01, ***p<0.001;

[0033] Figure 10 Interspinale bone number statistics for F0 generation; p>0.05 (ns);

[0034] Figure 11 Relative expression of runx2b gene at 48hpf for F1 generation; *p<0.05, **p<0.01, ***p<0.001;

[0035] Figure 12 Relative expression of runx2b gene at 40dpf for F2 generation, *p<0.05;

[0036] Figure 13 Whole mount in situ hybridization embryos of runx2b gene at 48hpf for F1 and F2 generations; red triangular arrow indicates the expression site of runx2b mRNA, the scale bar is 0.5mm;

[0037] Figure 14 Relative expression of runx2b after runx2b promoter methylation in offspring at 40dpf; *p<0.05, **p<0.01;

[0038] Figure 15 Average runx2b promoter methylation level in offspring; the gray dotted line indicates the average methylation level of wild type; ****P<0.0001;

[0039] Figure 16Methylation levels of individual CpG sites in offspring; *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001;

[0040] Figure 17 Figures 8A and 8B are plots of F1 and F2 generations of Alcian red staining; en indicates the osseous arcualia, ep indicates the osseous parietal; scale bar = 1 mm;

[0041] Figure 18 Figures 9A and 9B are plots of F1 / F2 generations of intermuscular bone length of the 11th to 16th myotomes; *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001;

[0042] Figure 19 Figure 10 is a plot of the number of intermuscular bones in offspring; P>0.05 (ns). DETAILED DESCRIPTION

[0043] The present application will be further described with reference to the following embodiments and examples. It should be understood that these embodiments and examples are intended to illustrate the present application and are not intended to limit the scope of the present application. The purpose of these embodiments and examples is to make the present disclosure more thorough and complete, and to provide a better understanding of the present application. It should also be understood that the present application can be implemented in many different forms and is not limited to the embodiments and examples described herein, and those skilled in the art can make various modifications or changes to the present application without departing from the spirit of the present application, and the equivalent forms are also within the scope of the present application. In addition, in the following description, a large number of specific details are given in order to provide a more complete understanding of the present application, and it should be understood that the present application can be implemented without one or more of these details.

[0044] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0045] Terminology

[0046] Unless otherwise indicated or unless the context clearly indicates otherwise, the terms or phrases used herein have the following meanings:

[0047] The selection range of the terms "and / or", "or / and", "and / or" used in the present application includes any one of two or more relevant listed items, and also includes any and all combinations of the relevant listed items, including any two relevant listed items, any more relevant listed items, or all relevant listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", "and / or", it should be understood that in the present application, the technical solution undoubtedly includes the technical solution connected by "logical and", and also undoubtedly includes the technical solution connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For another example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C and D (i.e. the technical solution connected by "logical or"), and also includes any and all combinations of A, B, C and D, i.e. includes the combination of any two or any three of A, B, C and D, and also includes the four-item combination of A, B, C and D (i.e. the technical solution connected by "logical and").

[0048] In the present application, "multiple", "various", "multiple times", "multiple" and the like refer to more than two or equal to two in number, unless otherwise specified. For example, "one or more" means one or more than two.

[0049] In the present application, "optionally", "optional" and "optional" mean optional, i.e. selected from two parallel solutions of "yes" or "no". If there are multiple "optional" in a technical solution, unless otherwise specified, and there is no contradiction or mutual restriction, each "optional" is independent.

[0050] In the present application, the technical features described in an open manner include both the closed technical solution consisting of the listed features and the open technical solution including the listed features.

[0051] In the present application, when referring to a numerical interval (i.e. a numerical range), unless otherwise specified, the optional numerical distribution within the numerical interval is considered to be continuous, and includes both numerical endpoints (i.e. the minimum and maximum values) of the numerical range, and every numerical value between the two numerical endpoints. When a numerical interval refers to integers within the numerical interval, unless otherwise specified, the two numerical endpoints and every integer between the two numerical endpoints are considered to be directly enumerated in the present application, such as when t is an integer selected from 1 to 10, meaning that t is any one integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. In addition, when multiple ranges are provided to describe a characteristic or property, the ranges can be combined. In other words, unless otherwise specified, ranges disclosed herein are to be understood to include any and all sub-ranges of the same, and are

[0052] In the present application, unless otherwise specified, the temperature parameter allows for constant temperature treatment, and also allows for variation within a certain temperature interval. It should be understood that the constant temperature treatment allows for fluctuations within the accuracy range of the instrument control. Fluctuations within a range such as ±5°C, ±4°C, ±3°C, ±2°C, ±1°C are allowed.

[0053] In the present application, % (w / w) and wt% both mean weight percentage, % (v / v) means volume percentage, and % (w / v) means mass volume percentage.

[0054] All documents mentioned in the present application are incorporated by reference into the present application as if each document were individually incorporated by reference. Unless and to the extent that the disclosure of the present application conflicts with the disclosure of the incorporated documents, the disclosure of the present application shall be deemed to be superseding. When the present application refers to the incorporated documents, the definitions of the relevant technical features, terms, names, phrases, etc. in the incorporated documents are also incorporated by reference into the present application. When the present application refers to the incorporated documents, the examples and preferred modes of the relevant technical features that are incorporated by reference into the present application are also incorporated by reference into the present application, subject to the ability to implement the present application. It should be understood that when the incorporated content conflicts with the description in the present application, the present application shall prevail or be modified as appropriate according to the description in the present application.

[0055] The runx2b, which is the focus of the present application, is an important transcription factor for controlling the differentiation of mesenchymal stem cells into osteoblast precursors in vivo, and is a key regulatory gene for driving the transformation of osteoblasts into bone cells through multiple signaling pathways, thereby regulating the development of intermuscular bones. Knocking out this gene can completely eliminate intermuscular bones while retaining the core muscle nutritional ingredient profile, including most amino acids and fatty acids. Importantly, in human osteoarthritic chondrocytes, the expression level of runx2 (homologous to zebrafish runx2b) is negatively correlated with the methylation level of the distal P1 promoter CpG site. These findings suggest that targeting increased methylation of the runx2b promoter can inhibit intermuscular bone development while maintaining genomic integrity.

[0056] Based on these insights, the present application provides a targeted DNA methylation editing system that enables site-specific DNA methylation and demethylation editing in the zebrafish genome by fusing the C-terminus of dCas9 with the catalytic domains of zebrafish Dnmt7 and Tet2. This epigenetic editing can potentially inhibit the expression of Runx2b by increasing its promoter methylation and inhibit the formation of intermuscular bones in zebrafish. In this study, the present application demonstrates that CRISPR / dCas9-Dnmt7-mediated methylation of the runx2b promoter can reduce intermuscular bones in zebrafish. The present application further evaluates the heritability of epigenetic markers after editing and resolves the molecular cascade link between epigenetic modification, gene expression, and phenotypic traits, which can be used to create fish with reduced intermuscular bones through non-transgenic strategies. In theory, this work advances the theory of aquaculture breeding by elucidating the epigenetic regulation of development. In practice, it establishes core technologies for trait-oriented aquaculture breeding, with the ultimate goal of producing high-quality aquaculture products while maintaining genomic integrity.

[0057] In one aspect, the present application provides a method for constructing a gene edited zebrafish, comprising: performing gene editing on a promoter region of a runx2b gene of the zebrafish to prepare the gene edited zebrafish.

[0058] In one embodiment, the gene editing is performed using CRISPR / dCas9.

[0059] In one embodiment, the method comprises: introducing an sgRNA targeting the promoter region of the runx2b gene of the zebrafish and a CRISPR / dCas9-methyltransferase system into a zebrafish embryo.

[0060] Optionally, the sgRNA targeting the promoter region of the runx2b gene uses at least one sgRNA targeting a position of -268bp or -419bp upstream of the start codon of the runx2b gene.

[0061] Further, sgRNA targeting -268bp position (g1) has stronger runx2b inhibition effect than sgRNA targeting -419bp position (g2), which makes runx2b mRNA expression level reduced to 0.4 times of the control group.

[0062] In one embodiment, the nucleotide sequence of the sgRNA is shown in SEQ ID NO. 1-SEQ ID NO. 2.

[0063] runx2b-Dnmt7-g1 runx2b, promoter: TTCAACCGCACTAGCGAGCTTGG (SEQ ID NO. 1)

[0064] runx2b-Dnmt7-g2 runx2b, promoter: CCTCTTTTGGGTTTGTGTGAAGG (SEQ ID NO. 2)

[0065] The two sgRNA sequences can specifically recognize the CpG island in the runx2b promoter region, and guide the dCas9-Dnmt7 fusion protein to carry out targeted methylation editing.

[0066] The CRISPR / dCas9-methyltransferase system comprises a fusion protein of dCas9 and the catalytic domain of Dnmt7. Dnmt7 is a DNA methyltransferase in zebrafish, which can realize site-specific DNA methylation editing after fusion with dCas9, so as to accurately regulate the expression level of the target gene.

[0067] In one embodiment, the method comprises the following steps: S1, constructing a CRISPR / dCas9-methyltransferase system; S2, co-injecting the CRISPR / dCas9-methyltransferase system and sgRNA targeting the promoter of the runx2b gene into zebrafish single-cell stage embryos.

[0068] Further, the method further comprises genetically modifying epigenetic modification to offspring, so that the offspring retain high methylation level of the promoter and sustained inhibition of runx2b expression. Experiments have proved that the F1 and F2 offspring produced by self-crossing of F0 generation fish retain these high methylation levels of the promoter, as well as sustained inhibition of runx2b expression and inhibition of interosseous bone development, indicating that the method has transgenerational inheritance.

[0069] In one embodiment, the S2 comprises: injecting a mixture of dCas9-Dnmt7 mRNA and sgRNA into zebrafish single-cell stage embryos.

[0070] In one of the embodiments, the concentration of the dCas9-Dnmt7 mRNA is 400 ng / μL, and the concentration of the sgRNA is 200 ng / μL. The injection concentration is experimentally verified to be able to achieve efficient methylation editing and gene expression inhibition.

[0071] In another aspect of the present application, an sgRNA targeting the promoter region of the runx2b gene of zebrafish is provided, and the nucleotide sequence of the sgRNA is shown as SEQ ID NO. 1-SEQ ID NO. 2.

[0072] In another aspect of the present application, a gene editing product is provided, and the gene editing product comprises the sgRNA targeting the promoter region of the runx2b gene of zebrafish and a DNA methylation editing system.

[0073] In another aspect of the present application, a cell, tissue or organ of the gene edited zebrafish constructed by the method for constructing a gene edited zebrafish is provided.

[0074] In another aspect of the present application, the cell, tissue or organ of the gene edited zebrafish is applied in the research of intermuscular bone of aquaculture.

[0075] The embodiments of the present application will be described in detail below with reference to the examples. It should be understood that the examples are only used to illustrate but not to limit the scope of the present application. The experimental methods in the following examples without specific conditions are preferred to refer to the guidance given in the present application, and can also be carried out according to the experimental manual or conventional conditions in the art, or according to the conditions suggested by the manufacturer, or according to the known experimental methods in the art.

[0076] In the following specific examples, the measurement parameters of the raw material components may have slight deviations within the weighing accuracy range if not otherwise specified. The temperature and time parameters allow for acceptable deviations caused by the instrument testing accuracy or operation accuracy.

[0077] It should be understood that the size of the sequence number of each process described above in various embodiments of the present application does not mean the order of execution, and the execution order of each process should be determined according to its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

[0078] Example 1

[0079] The present example provides a method for constructing a gene edited zebrafish.

[0080] 1. Zebrafish breeding

[0081] All zebrafish (AB strain, wild type) used in this study were housed in the zebrafish room of the Institute of Modern Aquaculture Science and Engineering, South China Normal University. The research protocol was approved by the South China Normal University Scientific Research Ethics Committee (Approval Number: SCNU-SLS-2021-026). The fish room facility was equipped with a standard recirculating water system, maintaining a 14-hour light / 10-hour dark alternating light cycle and water temperature of 28 ± 1 °C. Freshly hatched brine shrimp was fed twice a day, and all other rearing conditions and procedures were performed in accordance with the relevant international regulations as previously described.

[0082] 2. sgRNA preparation

[0083] Two sgRNAs were designed based on the PAM sequence position for DNA methylation editing strain construction, both of which were located in the runx2b promoter region. A third sgRNA was designed for knockout strain construction, located in the second exon of runx2b. All sgRNAs used in this study were synthesized by GenScript Biotech Co., Ltd. (Beijing, China). The sgRNA sequences are shown in Table 1.

[0084] Table 1

[0085]

[0086] 3. mRNA synthesis and microinjection

[0087] dCas9-Dnmt7 mRNA was transcribed in vitro from linearized pT3TS-dCas9-Dnmt7 plasmid template ( ) using T3 mMESSAGE Kit (Invitrogen, USA) and purified using RNeasy® Mini Kit (QIAGEN, Germany) according to the previously described method. For DNA methylation editing strains, 2 nL of a mixture containing dCas9-Dnmt7 mRNA (400 ng / μL) and sgRNA (200 ng / μL) was injected into zebrafish single-cell stage embryos. For gene knockout strains, 2 nL of a complex containing Cas9 protein (New England Biolabs, USA) and sgRNA (5 μM) was injected into embryos. Figure 1 4. Real-time quantitative PCR (RT-qPCR)

[0088] 4. Real-time quantitative PCR (RT-qPCR)

[0089] ​Total RNA was extracted using TRNzol reagent (TIANGEN, China). RNA concentration was quantified using NanoDrop One (Thermo Fisher Scientific, USA). cDNA for RT-qPCR was synthesized using StarScript Pro All-in-one RT Mix with gDNA Remover kit (GenStar, China). RT-qPCR analysis was performed on a CFX96 real-time PCR system (Bio-Rad, USA) using Hieff. TM qPCR Green Master Mix (Yeasen Biotech, China) was used. The experiment was set up with three replicates, each using either 30 embryos or five tissue samples. Zebrafish gapdh was used as an internal control gene. Data were collected using 2- ΔΔCt Methodological analysis. The relevant primer sequences are listed in Table 2.

[0090] Table 2

[0091]

[0092] 5. Multiple bisulfite sequencing PCR (BSP)

[0093] At 48 hpf, 30 injected embryos were collected from each group, and genomic DNA was extracted using a genomic DNA extraction kit (TIANGEN). Three biological replicates were processed per group. EZ DNA Methylation-Lightning was used. TM The kit (ZymoResearch) treats plasmids or DNA with bisulfite, converting unmethylated cytosine (C) to uracil (U), while methylated cytosine remains unchanged. For plasmid detection, specific BSP primers (Table 3) were designed to amplify the CpG island region of the runx2b promoter. Bisulfite-treated DNA was amplified using BSP primers (Table 4). Multiplex BSP integrates multiplex PCR and methylation-specific high-throughput sequencing, enabling simultaneous detection of methylation levels in multiple gene regions. Sequencing was performed by Magentech Co., Ltd. (Guangzhou, China). High-quality reads were aligned with a reference genome (GRCz11) for CpG methylation quantification.

[0094] Table 4

[0095]

[0096] 6. Whole-body in situ hybridization (WISH)

[0097] Use primers

[0098] runx2b-probeF: 5'-TCTAGAATTCACAAACCCACCGCAAG-3' (SEQ ID NO. 24)

[0099] runx2b-probeR: 5'-TAATACGACTCACTATACACTCCTCCACTTCCGTCAG-3' (SEQ ID NO. 25)

[0100] The coding sequence of zebrafish runx2b was cloned into T-zero vector, primers introduced Xbal restriction enzyme sites and T7 promoter flanking. Using linearized plasmid template, digoxigenin-labeled antisense RNA probes were synthesized by T7 RNA polymerase (TaKaRa) and DIG RNA Labeling Mix (Roche, USA). Whole-mount in situ hybridization was performed on 48hpf zebrafish embryos according to established protocols. Finally, samples were mounted in glycerol and imaged using a stereomicroscope equipped with a digital CCD camera (SZ-0850T, AOSVI, China).

[0101] Related protocol operations:

[0102] I. Collect and fix embryos

[0103] Collect 20-30 anesthetized 48hpf zebrafish embryos in a 1.5mL centrifuge tube, add 4% paraformaldehyde and fix overnight at 4°C.

[0104] After fixation, add pigment removal solution (3% H2O2: 2% KOH = 1:1) to remove zebrafish pigments, observe the removal of pigments under a stereomicroscope during the process. After the pigments are completely removed, add a small amount of anhydrous ethanol to the centrifuge tube to precipitate the embryos and wash with PBST solution (PBS + 2% Tween-20) to terminate the reaction.

[0105] Dehydrate the embryos with PBST solution-25% ethanol / PBST solution-50% ethanol / PBST solution-75% ethanol / PBST solution-100% ethanol solution, 5min for each gradient, 1mL for each time, and store at -20°C after gradient dehydration.

[0106] II. Experimental procedure

[0107] Day 1: RNase free treatment throughout, 1mL for each time.

[0108] 1. Graded rehydration of embryos with 100% ethanol solution - 75% ethanol / PBST solution - 50% ethanol / PBST solution - 25% ethanol / PBST solution - PBST solution, 5 min for each step. Wash twice with PBST solution, 5 min for each step.

[0109] 2. Add 1 mL of 10 μg / mL proteinase K to the embryos and digest for 1 min. Stop the reaction by replacing the solution with PBST.

[0110] 3. Fix the embryos with 4% paraformaldehyde for 20 min, inactivate the proteinase K, and wash the embryos with PBST four times, 5 min for each step.

[0111] 4. Prehybridization: Add 400 μL of HYB (hybridization solution) to the embryos, remove the HYB and store it in a new centrifuge tube at -20°C. Add 500 μL of fresh HYB and incubate at 65°C for 2-5 hours.

[0112] 5. Hybridization: Dilute the synthesized probe to 3 ng / μL with HYB. Incubate the probe in a metal bath at 72°C for 5 min to destroy the secondary structure of the RNA. Immediately place the probe on ice after incubation. Add the diluted probe solution to the embryos and hybridize overnight at 65°C. Do not exceed 16 hours.

[0113] Day 2: The operations at 65°C still require RNase free treatment. The operations at room temperature do not require RNase free treatment.

[0114] 1. Recover the probe solution after overnight hybridization into a new centrifuge tube and store it at -80°C.

[0115] 2. Rinse the embryos at 65°C: gently operate and preheat all reagents at 65°C. Replace the solution with 1 mL for each step.

[0116] a) Rinse once with the HYB recovered on the first day, 15 min;

[0117] b) Rinse once with 75% HYB + 25% 2xSSC solution, 15 min;

[0118] c) Rinse once with 50% HYB + 50% 2xSSC solution, 15 min;

[0119] d) Rinse once with 25% HYB + 75% 2xSSC solution, 15 min;

[0120] e) Rinse once with 2xSSC solution, 15 min;

[0121] f) Rinse twice with 0.2xSSC solution, 30 min for each step.

[0122] 3. Wash embryos at room temperature: gentle manipulation, all reagents need to be pre-warmed at room temperature, 1 mL per change.

[0123] a) 1 wash with 75% 0.2x SSC solution + 25% PBST solution, 10 min;

[0124] b) 1 wash with 50% 0.2x SSC solution + 50% PBST solution, 10 min;

[0125] c) 1 wash with 25% 0.2x SSC solution + 75% PBST solution, 10 min;

[0126] d) 1 wash with PBST solution, 10 min.

[0127] 4. Add 1 mL blocking solution (PBST + 2% sheep serum), shake slowly at room temperature for 3 hours.

[0128] 5. Add 600 μL anti-digoxigenin antibody diluted 1:3000 in blocking solution, shake overnight at 4°C.

[0129] Day 3: develop at room temperature, no RNase free treatment needed.

[0130] 1. Recover antibody solution, wash 6 times with 1 mL PBST solution, 15 min each time.

[0131] 2. Wash 2 times with 500 μL AP Buffer, 5 min each time, after the last wash, transfer embryos to a 24-well culture plate.

[0132] 3. Prepare developing solution at low temperature, system is 1 mL AP Buffer + 4.5 μL NBT + 3.5 μL BCIP, after adding developing solution, keep away from light at room temperature for 2-3 hours, observe developing condition under microscope every half hour.

[0133] 4. After developing is finished, wash 2 times with PBST solution, 5 min each time.

[0134] 5. Perform gradient glycerol treatment on embryos with 25% glycerol / PBST solution - 50% glycerol / PBST solution - 75% glycerol / PBST solution, finally transfer to glycerol and take pictures directly under microscope.

[0135] Three, alizarin red bone staining

[0136] Adult zebrafish skin and scales were dissected with forceps and fixed in 95% ethanol or 4% paraformaldehyde for >3 days. Samples were pre-transparented in 1% KOH for 2 hours, then stained in alcian blue staining solution (saturated alcian blue: 0.5% KOH = 1:9) for 6 hours. Then treated with gradient glycerol (25% glycerol / 0.5% KOH→50% glycerol / 0.5% KOH→75% glycerol / 0.5% KOH→100% glycerol) sequentially until muscle was transparent and intermuscular bone was clearly visible. Zebrafish treated were placed in glycerol for photographing and preservation.

[0137] V. Statistical analysis

[0138] Data were expressed as mean ± standard error (SEM). Statistical analysis was performed using one-way ANOVA, and P < 0.05 was considered statistically significant.

[0139] VI. Results

[0140] 2. dCas9 Dnmt7-mediated runx2b promoter methylation in F0 generation reduced intermuscular bone length

[0141] To explore whether targeted methylation of the runx2b promoter could reduce the expression level of runx2b and change the intermuscular bone phenotype, the present application used the CRISPR / dCas9-Dnmt7 system in zebrafish. The present application used the CRISPR / dCas9-Dnmt7 system to target DNA methylation of the runx2b promoter in zebrafish. Two sgRNAs were designed to target the CpG island at the positions -268 bp (g1) and -419 bp (g2) upstream of the start codon of runx2b. Figure 2 ) of runx2b.

[0142] At 48 hpf, RT-qPCR showed that the expression level of runx2b mRNA in all experimental groups (g1, g2, g1+g2 groups) was significantly reduced ( Figure 3 ), confirming that both sgRNAs can effectively regulate transcription.

[0143] The g1 and g1+g2 groups showed stronger inhibition than the g2 group alone. There was no significant difference in the inhibition effect of runx2b between the g1 and g1+g2 groups, and the expression of the g1 group was slightly lower, indicating that double targeting had no synergistic effect. The reduction in the expression level of runx2b in g1 embryos was further confirmed by whole-mount in situ hybridization (ISH) at 48 hpf (Figure 2). Figure 4

[0144] Among them, at 40 dpf (peak period of intermuscular bone development), the persistent runx2b inhibition in tail muscle (0.4 times relative to the control group; Figure 5 ) confirmed the presence of transcriptional inhibition.​

[0145] The present application further analyzed the methylation level within the runx2b CpG island and found that the average promoter methylation level of F0 zebrafish was significantly higher than that of the control group at 48hpf ( Figure 6 ), confirming the high efficiency of targeted methylation of the CRISPR / dCas9-Dnmt7 system.

[0146] Although most individual CpG sites showed a slight increase in methylation, these differences did not reach a statistically significant level ( Figure 7 ).

[0147] To assess the phenotypic results, g1 group embryos were raised to adulthood. Alizarin red bone staining showed that the length of the haemal arch ossicles on both sides of the 11th to 16th myotome region was significantly shortened, with a decrease of 26.9%, 38.8%, 35.8%, 38.1%, 34.4% and 23.3%, respectively ( Figure 8 and Figure 9 ). However, the number of intermuscular bones was almost unchanged ( Figure 10 ). This indicates that targeted methylation of the runx2b promoter by CRISPR / dCas9-Dnmt7 significantly reduced runx2b expression and shortened the length of intermuscular bones, but did not change the number of intermuscular bones in F0.

[0148] 3. Effects induced by runx2b promoter methylation are retained in offspring

[0149] To explore the genetic effects of runx2b promoter methylation on zebrafish gene expression and intermuscular bone phenotype, the present application self-crossed the raised F0 lines (g1, g2 and g1+g2 groups) to generate F1. At 48hpf, F1 embryos showed significantly reduced runx2b mRNA expression levels ( Figure 11 ).

[0150] Consistent with the trend observed in F0, the g1 group had the strongest inhibitory effect (0.16-fold), followed by the g1+g2 group (0.36-fold) and the g2 group (0.59-fold). Given its maximum efficacy, the present application chose the g1 line to generate F2. The F2 line also showed significant downregulation of runx2b at 48hpf ( Figure 12 )

[0151] In addition, whole-mount in situ hybridization results at 48hpf confirmed that, in F1 and F2, runx2b expression was restricted to the eye, ethmoid plate and pharyngeal arches, and the signal intensity was weaker than that of the control group ( Figure 13 ). At 40dpf, the relative runx2b inhibition persisted ( Figure 14). DNA methylation analysis showed that the average runx2b promoter methylation level was significantly increased in F1 / F2 generations, but did not show an increasing trend Figure 15

[0152] Site-specific analysis showed that most sites in F1 generation presented high methylation, among which nine sites at -696 bp, -677 bp, -584 bp, -579 bp, -568 bp, -537 bp, -531 bp, -511 bp and -77 bp were significantly increased.

[0153] Although most sites in F2 generation also showed increased methylation levels, among which -584 bp and -537 bp sites were significantly increased, the increase was weaker than that in F1 generation Figure 16 ). Alizarin red bone staining of adult F1 and F2 generations showed normal bone development, but the marrow arch bones in the 11th to 16th myotome regions were significantly shortened, with 17.5% to 38.0% in F1 generation and 11.9% to 26.5% in F2 generation Figure 17 and Figure 18 ).

[0154] Intersomitic bone counts remained unchanged Figure 19 ). In summary, these results demonstrated that CRISPR / dCas9-Dnmt7-induced runx2b suppression and related intersomitic bone shortening had stable transgenerational inheritance without methylation accumulation increase.

[0155] In summary, these findings suggest that CRISPR / dCas9-Dnmt7-mediated runx2b promoter methylation can disrupt the mechanisms related to skeletal development in zebrafish.

[0156] Promoter methylation is a conserved epigenetic gene regulation mechanism that usually silences transcription by hindering transcription factor binding and chromatin remodeling. A large number of studies have demonstrated a significant negative correlation between promoter methylation and gene expression levels. In this application, we targeted the zebrafish runx2b promoter for site-specific methylation using the CRISPR / dCas9-Dnmt7 fusion system. Subsequent RT-qPCR and whole-mount in situ hybridization experiments revealed significantly reduced runx2b mRNA expression levels and altered spatial distribution patterns.

[0157] ​Previous studies have shown that epigenetic interventions applied to F0 generation can have large instability and randomness due to the high sensitivity of early developmental stages, which can hinder their complete transmission to F1 and F2 generations. To evaluate the genetic potential of DNA methylation-induced runx2b inhibition, the present application quantifies the methylation levels and gene expression patterns in F0, F1 and F2 generations. The results of the present application prove that this epigenetic silencing mechanism has direct and transgenerational inheritance in zebrafish. In F0 adult fish, the present application observes a significant shortening of the myoseptum bones in the 11th to 16th myotome region, which represents the first time that fish intermuscular bone abnormalities have been successfully induced through epigenome editing. This abnormal phenotype persists in F1 and F2 offspring, confirming that methylation-mediated runx2b silencing has transgenerational inheritance. This method provides a new basic technology for aquatic animal breeding.

[0158] In summary, the present application studies apply this CRISPR / dCas9-Dnmt7-mediated promoter methylation editing technology to inhibit the expression of the key gene runx2b that regulates intermuscular bone development, thereby affecting its normal growth for the first time. Notably, the inhibitory effect is proven to be direct and transgenerational. Mechanistically, high methylation of the runx2b promoter can initiate transcriptional silencing, supplemented by histone ubiquitination-mediated Runx2b degradation and PPAR / FoxO-dependent inhibition of osteoblast proliferation / differentiation, ultimately inhibiting normal intermuscular bone development. By utilizing such epigenetic modifications for trait engineering, the present application establishes a safer and more adaptable paradigm for genome editing, bringing transformative potential for aquaculture breeding.

[0159] The above-described embodiments only express several implementation manners of the present application, facilitate specific and detailed understanding of the technical solutions of the present application, but cannot be understood as a limitation on the patent protection scope of the present application. It should be noted that, for ordinary skilled persons in the art, several modifications and improvements can be made without departing from the concept of the present application, which are all within the protection scope of the present application. In addition, it should be understood that, after reading the above teaching content of the present application, the skilled person in the art can make various changes or modifications to the present application, and the equivalent forms obtained are also within the protection scope of the present application. It should also be understood that, the technical solutions obtained by the skilled person in the art through logical analysis, reasoning or limited experiments on the basis of the technical solutions provided by the present application are all within the protection scope of the appended claims of the present application. Therefore, the protection scope of the patent of the present application should be subject to the content of the appended claims, and the description can be used to explain the content of the claims.

Claims

1. A method for constructing epigenome-edited zebrafish, characterized in that, The application relates to a method for constructing an epigenome edited zebrafish. The method comprises the following steps:

2. The method of constructing a genetically edited zebrafish according to claim 1, wherein, The method comprises the following steps:

3. The method of constructing a genetically edited zebrafish according to claim 1, wherein, The method comprises the following steps: The method comprises the following steps: The method comprises the following steps:

4. The method of constructing a genetically edited zebrafish according to claim 3, wherein, The method comprises the following steps: The method comprises the following steps:

5. The method of constructing a genetically edited zebrafish according to any one of claims 1 to 4, wherein, The method comprises the following steps: The method comprises the following steps: The method comprises the following steps:

6. The method of constructing a genetically edited zebrafish of claim 5, wherein, The method comprises the following steps:

7. An sgRNA targeting the promoter region of the zebrafish runx2b gene, characterized in that, The method comprises the following steps:

8. A gene editing product, characterized in that, The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the following steps: The method comprises the