Application of simulated non-phosphorylated OsSIZ1 in promotion of plant phosphorus absorption and enhancement of rice blast resistance

Abstract

The invention discloses application of simulation of non-phosphorylation OsSIZ1 in promotion of plant phosphorus absorption and enhancement of rice blast resistance, and belongs to the technical field of molecular biology. The amino acid sequence of the mutant is as shown in SEQ ID NO.1, and the nucleotide sequence for coding the protein of the mutant is as shown in SEQ ID NO.2. The phosphorylation sites S607 and S609 for regulating and controlling the activity of the OsSIZ1 are mutated into alanine at the same time to silence the phosphorylation state of the OsSIZ1, and the phosphorus absorption and rice blast resistance of rice can be remarkably improved.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to the application of simulating non-phosphorylated OsSIZ1 in promoting phosphorus absorption in plants and enhancing resistance to rice blast. Background Technology

[0002] Rice (Oryza sativa L.) is one of the world's most important food crops, consumed by half the world's population, primarily in Asia, southern Europe, and parts of tropical America and Africa. However, its yield is limited by low soil phosphorus availability.

[0003] Phosphorus (P) constitutes approximately 0.05%-1% of the dry weight of plants and is an important component of plant cell membranes, cytoplasm, and nuclei. It is mainly found in the structures of DNA, RNA, phospholipids, and adenine nucleotides (ATP, ADP, and AMP). Due to its importance in plant physiological and biochemical functions, the amount of phosphorus required by plants ranks fifth, after nitrogen, potassium, calcium, and magnesium. Only soluble inorganic phosphates (orthophosphates, Pi), including H₂PO₄, can be directly absorbed and utilized by plants from the soil. 4- HPO4 2- and PO4 3- When phosphate fertilizer is applied to the soil, some of it is quickly fixed. Excessive application of phosphate fertilizer is not only wasteful, but also causes environmental problems such as eutrophication of water bodies. Summary of the Invention

[0004] To address the aforementioned shortcomings in existing technologies, this invention provides an application of simulating unphosphorylated OsSIZ1 in promoting phosphorus uptake in plants and enhancing rice blast resistance. This invention simultaneously mutates the phosphorylation sites S607 and S609, which regulate OsSIZ1 activity, to alanine to silence their phosphorylation state. This ultimately yields stably expressed, unmutated OsSIZ1-Flag overexpression material and OsSIZ1... AA Overexpression materials with mutations in the -Flag phosphorylation site were named OsSIZ1-Flag-4, OsSIZ1-Flag-12, and OsSIZ1, respectively. AA -Flag-6,OsSIZ1 AA -Flag-16.

[0005] Meanwhile, in order to investigate the effect of silencing mutations of the native expression form of OsSIZ1 on rice growth, OsSIZ1 frameshift mutant transgenic materials were constructed using the Cas9 system with CTAGCCACCAGGAGCCACAGCGG and CTATGACTCTTTCCAGCCAGAGG as target sites to silence the function of OsSIZ1, and finally homozygous Ossiz1+1bp and Ossiz1-1bp gene frameshift mutant materials were obtained.

[0006] To achieve the above objectives, the technical solution adopted by the present invention to solve its technical problem is as follows:

[0007] An OsSIZ1 mutant, the amino acid sequence of which is shown in SEQ ID NO.1.

[0008] MADLVSSCKDKLAYFRIKELKDILNQLGLPKQGKKQDLIDRVLALLTDEQGQRHHGWGRKNSLTKEAVAKIVDDTYSRKMQIQCAPDLATRSHSGSDFSFRPIEEAYDSFQPEAKVRCICSSTMVNDSMIQCEDQRCQVWQHLNCVLIPDKPGESAEVPPVFYCELCRLSRADPFWVTAGNPLLPVKFVSSGVTNDGTSVPQSVEKSFQLSRSDRETVQRQEYDLQVWCMLLNDKVQFRMQWPQYAELHVNGISVRVVTRPGSQLLGINGRDDGPLITTCSREGINKICLSRVDARTFCFGVRIAKRRTVAQVLNLVPKEAEGESFEHALARVRRCLGGGDTAENADSDSDLEVVAESVTVNLRCPNSGSRMRIAGRFKPCIHMGCFDLETFVELNQRSRKWQCPICLKNYSLESLMIDPYFNRITSLLRNCNEDVNEVDVKPDGSWRVKGDAASRELSQWHMPDGTLCNPKEDVKPAMQNGNEQMMEGTSDGQKSLKIGIKRNPNGIWEVSSKADDKKPSVVGNRMQNNSGFRALNNIMHMSNSPTSSYRDGEDPSVNQESNRHVDLSLNNGNNEFDSFSLNFGQACNTDDRPQQQHNATDVIVLADADEENDAMVCPPAVYDNTTTANGSGFPFTTNGIGYTERYQEDAGVGTSGLGLLSNNVDDFEMNNWQMHSSYQQPEQGFQFFGNDTDVHNTFVGSHNSFGLAPNDYSLDCNVGVEEASVTPALSVCRNSNEMHGSLVDNPLALVGDDPSLQIFLPSQPSSVPLQEELSERANAPNGVQSDDWISLTLAAGGGGNEEPAPADVNSQPQIPSTETGIEPLTDAASAFLSTNIERRSGADLNPRRIENIFSHPRQPRSVRPRLCLSIDTDSE. (SEQ ID NO.1)

[0009] A nucleic acid encoding the OsSIZ1 mutant according to claim 1, characterized in that its nucleic acid sequence is as shown in SEQ ID NO.2.

[0010]

[0011] A recombinant plasmid comprising the aforementioned nucleic acid.

[0012] A cell line comprising the aforementioned nucleic acid or recombinant plasmid.

[0013] An engineered bacterium comprising the aforementioned nucleic acid or recombinant plasmid.

[0014] The application of the above-mentioned OsSIZ1 mutant, nucleic acid, cell line or engineered bacteria in promoting phosphorus absorption by plants.

[0015] The application of the above-mentioned OsSIZ1 mutants, nucleic acids, cell lines or engineered bacteria in enhancing plant resistance to rice blast.

[0016] The above-mentioned OsSIZ1 mutant is used in the preparation of formulations that promote phosphorus uptake in plants and / or enhance plant resistance to rice blast.

[0017] Furthermore, the plant is rice.

[0018] An agent that promotes phosphorus uptake in plants and enhances resistance to rice blast disease includes the aforementioned OsSIZ1 mutant.

[0019] A method to promote phosphorus uptake in plants and enhance resistance to rice blast involves transferring the aforementioned nucleic acid or recombinant plasmid into the plant and allowing it to be expressed normally.

[0020] A method to promote phosphorus absorption in plants and enhance resistance to rice blast involves mutating amino acids at positions 607 and 609 of the OsSIZ1 protein from serine to alanine.

[0021] The beneficial effects of this invention are:

[0022] This invention simultaneously mutates phosphorylation sites S607 and S609, which regulate OsSIZ1 activity, to alanine to silence their phosphorylation state, which can significantly improve phosphorus absorption and resistance to rice blast in rice. Attached Figure Description

[0023] Figure 1 For Ossiz1 and OsSIZ AA - Flag identification;

[0024] Figure 2 For OsSIZ AA -Phenological identification of Flag;

[0025] Figure 3 For OsSIZ1 AA -Detection of phosphorus content, fresh weight, and phosphorus starvation signal gene expression in Flag materials;

[0026] Figure 4For OsSIZ1 AA - Detection of expression of rice blast resistance-related genes in Flag materials;

[0027] Figure 5 For OsSIZ1 AA -Detection of the rice blast resistance of Flag materials. Detailed Implementation

[0028] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0029] Example 1 Ossiz1, OsSIZ1 AA - Construction and identification of Flag materials

[0030] OsSIZ1 was constructed using homologous recombination technology. AA The specific experimental steps for using the Flag (S607 / 609A) vector are as follows:

[0031] (1) Primer design. The sequence information of the OsSIZ1 gene was queried from the RAP-DB (https: / / rapdb.dna / affrc.go.jp) database based on the OsSIZ1 sequence number. The sequence information was then obtained using a webpage (…). https: / / crm.vazyme.com / cetool / singlefragment.html Online design includes primer sequences with vector homologous arms that contain a complete open reading frame or a promoter.

[0032] (2) Primer sequence:

[0033] A:OsSIZ1-Flag-F-KpnI:cttctgcagaagcttggtaccATGGCGGACCTGGTTTCC

[0034] B:OsSIZ1-Flag-R-BamHI:gtctttgtagtccatggatccCTCAGAATCAGTATCTATTGATAAACAGAGTC

[0035] C:OsSIZ1-S607 / 609A-F:GACGTCATTGTTCTTGCTGATGCTGATGAAGAGAATGAT

[0036] D:OsSIZ1-S607 / 609A-R:ATCATTCTCTTCATCAGCATCAGCAAGAACAATGACGTC

[0037] (3) Using ZH11 cDNA as a template, the PCR reaction system was as follows: 2×PhantaMax buffer 12.5μL, dNTPMix 0.5μL, cDNA 1μL, primer 1μL+1μL, phanta super fidelity DNA polymerase 0.5μL, ddH2O To 25μL.

[0038] (4) The PCR amplification program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension at 1 kb / min, repeated 34 times; 72℃ final extension for 5 min. For the native OsSIZ1 gene, primers A+B were used for amplification. AA The variant gene was amplified separately using primers A+D and B+C, and the PCR products of the two primers were mixed and used as a template for amplification with primers A+B.

[0039] (5) The PCR amplification products were separated by nucleic acid electrophoresis on a 1% agarose gel. After staining with nucleic acid dye, the gel was photographed under UV light, the results were recorded, and the OsSIZ1 and OsSIZ1AA gene PCR products were recovered by gel excision. The electrophoretic bands were recovered using a VWI gel recovery kit.

[0040] (6) After extracting the Ubi-Flag plasmid using the VWI plasmid extraction kit, digest it with Takara's rapid nucleic acid digestion enzymes (KpnI, BamHI) and then recover it.

[0041] (7) The PCR product and the vector enzyme digestion product were separated by nucleic acid electrophoresis on a 1% agarose gel. After staining with nucleic acid dye, the results were photographed under a UV lamp. The concentration of the PCR product and the vector enzyme digestion product was measured by comparing the brightness of the developed band with the marker.

[0042] (8) Use Vazyme’s ClonExpress II One Step Cloning Kit to ligate the fragment and vector. Mix the vector and insert at a ratio of 1:3 and react at 37 degrees for 30 minutes. Immediately put the ligation product back on ice.

[0043] (9) Gently mix the ligation product with 20 μL Tiangen of DH5α competent cells, incubate on ice for 20 min, heat shock at 42℃ for 1 min, incubate on ice for 2 min, add 300 μL of antibiotic-free LB medium, and revive and culture on a shaker at 37℃ for 1 h. Then, spread the bacterial culture on resistant LB plates (containing 50 mg / mL ampicillin). Incubate at 37℃ for 12-16 h.

[0044] (10) Single colonies were taken from the plate for colony PCR verification. The primers used were SIZ1-CDS-F-2168 and the reverse primer Ubi-Flag-R downstream of the vector. The colony PCR-identified clones were those carrying OsSIZ1-Flag or OsSIZ1. AA DH5α Escherichia coli with the Flag plasmid was inhaled into 6 mL of ampicillin-resistant LB broth and cultured in a shaker at 37°C for 12-16 h.

[0045] (11) Add 1 mL of bacterial culture to glycerol to make a final concentration of 20%. Extract plasmids from the remaining bacterial culture using the Highpureplasmid isolation kit provided by VWI.

[0046] (12) The extracted plasmid was measured by 1% agarose gel electrophoresis in 1 μL. If a single target band was obtained, the plasmid was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing.

[0047] (13) Genetic transformation experiments were conducted on leaf callus tissue of wild-type ZH11 material using Agrobacterium EHA105. Stable transgenic lines were finally obtained: OsSIZ1-Flag-4, OsSIZ1-Flag-12, and OsSIZ1. AA -Flag-6,OsSIZ1 AA -Flag-16. Gene-silenced plants with frameshift mutations were obtained using the Cas9 system and Agrobacterium EHA105: Ossiz1+1bp and Ossiz1-1bp. (See...) Figure 1 )

[0048] Example 2: Phenotypic and Transcriptional Level Identification of Mutant Materials

[0049] 1. Phenotypic identification

[0050] After rice seeds were sown, the rice materials were grown for 30 days in HP (200 μM) and LP (5 μM) nutrient solutions (the nutrient solution was changed weekly, and the rice was cultured in a greenhouse). The phenotypes of the rice materials were recorded by photographing them against a black cloth background (see [link to original text]). Figure 2 ).

[0051] 2. Transcription level identification

[0052] For transcriptional level identification, RNA was first extracted from leaves of wild-type Zhonghua 11 (ZH11) and overexpressing rice under phosphorus-sufficient conditions, then reverse transcribed into cDNA. The cDNA was then used as a template for quantification to analyze the expression level of OsSIZ1 in seedlings. The specific experimental methods for RNA extraction are as follows:

[0053] (1) Cut an appropriate amount of rice roots and aboveground parts with scissors, then wrap them with aluminum foil and mark the sample name and treatment conditions on the surface of the aluminum foil. Immediately place them in liquid nitrogen to freeze the samples quickly.

[0054] (2) First, fill the mortar with liquid nitrogen, then put the sample into the mortar and grind it into powder.

[0055] (3) Weigh 100mg of sample powder into a 2mL EP tube, add 1mL TRizol, vortex vigorously for 1min, and let stand at room temperature for 5min to completely separate the nucleic acid protein complex.

[0056] (4) Centrifuge at 4℃ and 12000rpm for 10min, and transfer the supernatant to a new centrifuge tube.

[0057] (5) Add 200 μL of chloroform to each 1 mL of Trizol, cap the tube, shake vigorously for 15 seconds, and let stand at room temperature for 5-10 minutes.

[0058] (6) Centrifuge at 4℃ and 12000rpm for 10-15min. The sample will separate into three layers: a red organic phase, a middle layer, and an upper aqueous phase. RNA is mainly in the aqueous phase. Transfer the aqueous phase to a new centrifuge tube.

[0059] (7) Add all the liquid and any precipitate that may appear in step ⑥ into the adsorption column and centrifuge at 12,000 rpm for 1 min at room temperature.

[0060] (8) Discard the waste liquid, add 600 μL of washing solution WB to the adsorption column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the waste liquid.

[0061] (9) Add 400 μL of washing solution to the adsorption column, centrifuge at 12,000 rpm for 30 s at room temperature, and discard the waste liquid.

[0062] (10) Place the adsorption column in the collection tube and centrifuge at 12,000 rpm for 1 min at room temperature to remove the washing solution.

[0063] (11) Carefully remove the adsorption column and place it into a sterilized RNase-Free centrifuge tube. Add 30 μL of DEPC-ddH2O to the middle of the adsorption membrane, place at room temperature for 2 min, and centrifuge at 12000 rpm for 1 min.

[0064] Reverse transcription was performed using YESEN's Hifair III 1st Strand cDNA synthesis SuperMix for qPCR kit. The specific procedure is as follows:

[0065] 1) Remove residual genomic DNA. After measuring RNA concentration, adjust the RNA concentration of each group to 500 ng, and add the remaining amount to 6 μL with ddH2O. Then add 1.5 μL of 5×g DNA digesterMix, and finally gently mix with a pipette. Incubate at 42°C for 2 min.

[0066] 2) Prepare the reverse transcription system. Add 2.5 μL of 4×HifairⅢSuperMixplus to the reaction system from step 1, gently mix with a pipette, incubate at 25°C for 5 min, incubate at 55°C for 15 min, and incubate at 85°C for 5 min.

[0067] Specific methods for quantitative PCR (RT-PCR): using qPCR Green Master Mix (NoRox) was used to prepare the reaction system according to the instructions, and the reaction was carried out on a BIO-RAD real-time quantitative PCR instrument.

[0068] Example 3: Detection of Phosphorus Content Changes in Mutants

[0069] The phosphorus content in mutant materials should be detected using the following procedure:

[0070] 1. After taking photos, cut the material at the root-stem junction, dry the roots, and measure the fresh weight of each.

[0071] 2. Cut leaves and roots, weigh them, add phosphorus extraction solution, grind the sample, and incubate in a 42℃ water bath for 30 minutes to extract inorganic phosphorus (phosphate, Pi).

[0072] 3. Take 150 μL of supernatant from each sample and add it to 350 μL of phosphorus colorimetric solution. Incubate in a water bath at 42°C for 30 min to allow for full color development.

[0073] 4. Measure the absorbance at 820 nm using a spectrophotometer or ELISA reader.

[0074] 5. Calculate the phosphorus concentration using the standard curve.

[0075] like Figure 2 As shown, in OsSIZ1 AA In the -Flag, phosphorus absorption-related genes were significantly upregulated.

[0076] Example 4: Detection of rice blast resistance in mutant materials

[0077] 1. Detection of rice blast resistance gene expression

[0078] The method for detecting rice blast resistance genes follows the transcriptional level identification process in Example 2, and the results are shown below. Figure 4 .

[0079] like Figure 4 As shown, in the Ossiz1 mutant and OsSIZ1 AA -In the Flag overexpression material, the rice blast resistance gene was significantly upregulated.

[0080] 2. Testing of rice's resistance to rice blast

[0081] (1) In a clean bench, cut a piece of plaque from the rice blast fungus (Zhong 10-8-14) plate and transfer it to a fresh PDA medium plate. Incubate at 25°C until the plaque almost covers the petri dish (about 7 days).

[0082] (2) Use 3 mL of sterile water and a sterile pipette tip to break and collect the mycelium, spread it evenly on fresh tomato oat medium, blow it dry and then seal it. Incubate at 25°C for 2 to 3 days.

[0083] (3) After breaking the hyphae with a sterile cotton swab, rinse the plate with sterile water, dry it, cover it with double gauze, and incubate it under light at 25°C for 2 to 3 days.

[0084] (4) Cut leaf segments from the same part of the rice material that has been cultured in +P and -P nutrient solutions for 30 days. Take 6cm of each leaf segment and put it into a 9cm bacterial culture dish. Prepare about 30mL of 10μg / mL 6-BA solution in advance in the dish.

[0085] (5) On each leaf segment, every 1.5 cm, gently prick it with a sterile 10 μL white transparent pipette tip, and then immediately put it back into the 6-BA solution.

[0086] (6) Break the hyphae with 3-5 mL of sterile water and a sterilizing pipette tip, resuspend the spore solution, and adjust the spore concentration to 3-4 × 10⁻⁴ using a microscope and a hemocytometer. 5 One spore per milliliter.

[0087] (7) Apply 5 μL of rice blast fungus spore solution to each wound, resuspend and mix the solution on three wounds, and continue until the wound is fully covered.

[0088] (8) After 12 hours of dark treatment at 25℃, the leaves were cultured under light at 25℃ for nearly a week. During this period, the disease incidence on the leaves was observed daily, and photos were taken and recorded promptly. The length of the yellowish-brown border of the lesion was used as the indicator of disease resistance. The statistical data required more than 20 lesions. Results are shown in […]. Figure 5 .

[0089] like Figure 5As shown, the in vitro leaf method indicates that the OsSIZ1 mutant and OsSIZ1 AA -Flag material showed a significant increase in rice blast resistance compared to the wild type.

[0090] Finally, it should be noted that the above specific embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to examples, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications and substitutions should be covered within the scope of the claims of the present invention.

Claims

1. An OsSIZ1 mutant, characterized in that, Its amino acid sequence is shown in SEQ ID NO.

1.

2. A nucleic acid encoding the OsSIZ1 mutant of claim 1, characterized in that, Its nucleic acid sequence is shown in SEQ ID NO.

2.

3. A recombinant plasmid, characterized in that, Includes the nucleic acid described in claim 2.

4. A cell line, characterized in that, Includes the nucleic acid as described in claim 2 or the recombinant plasmid as described in claim 3.

5. An engineered bacterium, characterized in that, Includes the nucleic acid as described in claim 2 or the recombinant plasmid as described in claim 3.

6. The application of the OsSIZ1 mutant of claim 1, the nucleic acid of claim 2, the cell line of claim 3, or the engineered bacteria of claim 5 in promoting phosphorus absorption in plants and / or enhancing plant resistance to rice blast.

7. The use of the OsSIZ1 mutant according to claim 1 in the preparation of formulations that promote phosphorus uptake in plants and / or enhance plant resistance to rice blast.

8. An agent that promotes phosphorus uptake in plants and enhances resistance to rice blast, characterized in that, Including the OsSIZ1 mutant as described in claim 1.

9. A method for promoting phosphorus absorption in plants and enhancing resistance to rice blast, characterized in that, The nucleic acid described in claim 2 or the recombinant plasmid described in claim 3 is transferred into a plant and expressed normally.

10. A method for promoting phosphorus absorption in plants and enhancing resistance to rice blast, characterized in that, The amino acids at positions 607 and 609 of the OsSIZ1 protein were mutated from serine to alanine.

Images