Application of FveABI4 in regulating and controlling sizes of forest strawberry fruits

Abstract

The invention provides application of FveABI4 in regulating and controlling the size of forest strawberry fruits, and belongs to the technical field of genetic engineering. Researches find that overexpression of FveABI4 can increase the size of fruits, promote the ripening process of the fruits, improve accumulation of soluble sugar in the fruits and reduce the content of citric acid in the fruits; and the reverse effect can be achieved by knocking down or knocking out the FveABI4. Therefore, the fruit size is regulated and controlled by intervening the expression of the FveABI4, and the ripening process and the sugar acidity of the fruits can be controlled at the same time, so that the problems that the inherent fruits of the forest strawberries are small and the separation of excellent characters of traditional breeding is serious can be ideally solved, and the application potential of the forest strawberries in the aspects of edible characters, processing characters, ornamental characters and the like is fully released.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of genetic engineering, and particularly relates to application of FveABI4 in regulating size of strawberry fruit. BACKGROUND

[0002] Strawberry includes cultivated strawberry (Fragaria x ananazsa) and forest strawberry (Fragaria vesca), both of which are in the same family and genus level and are two independent species in the genus Fragaria, and the forest strawberry is one of the wild ancestors of the cultivated strawberry. The cultivated strawberry is an octoploid, which is bred by hybridization of multiple wild species, is a perennial herb, has sweet and delicious fruits, high nutritional value, and has health care effects. The forest strawberry, also known as wild strawberry or alpine strawberry, is a diploid wild species.

[0003] The forest strawberry is rich in antioxidant ingredients such as anthocyanins, tannic acid, phenolic substances and vitamin C in the fruit, which are much higher than those of ordinary cultivated strawberries.

[0004] In recent years, with the segmentation and upgrading of the consumer market, the unique commercial value of the forest strawberry has been rediscovered, which makes it show great application potential in the fields of high-end food processing (jam, essential oil, natural pigment extraction), healthy functional food and health product raw materials. Moreover, the forest strawberry has small and delicate plants, excellent ornamental properties, and excellent urban agriculture and courtyard economy values.

[0005] However, the core bottleneck restricting the forest strawberry from "niche boutique" to "wider commercialization" lies in its inherent defects. First, the fruit size of the forest strawberry is small, and the natural fruit weight is usually only 1-3 g, which is much smaller than that of the octoploid strawberry (more than 20-30 g), the picking cost is high, the commodity property is poor, and it is difficult to meet the demand of the fresh food market for large fruit appearance. Second, the excellent traits of the forest strawberry are seriously separated. Although the forest strawberry has the potential genes of high sugar and high anthocyanins, it is difficult to integrate the three key traits of "high sugar", "high anthocyanins" and "large fruit" in the natural germplasm. The existing varieties often have small fruits and low sugar, or have good flavor but poor color, which cannot meet the complex demand of the market for "good-looking (large fruit), good-eating (high sugar) and healthy (high anthocyanins)".

[0006] The current breeding strategy is mainly to introduce the excellent genes (such as flavor and resistance) of the forest strawberry into the octoploid cultivated species through distant hybridization. However, this method has problems such as reproductive isolation, sterility of offspring, extremely long breeding cycle (usually more than 15 years), serious separation of excellent traits (large fruit, high sugar and strong flavor) in offspring, low efficiency and extremely low success rate.

[0007] Therefore, there is an urgent need in the industry for a revolutionary breeding method that targets the genetic improvement of diploid forest strawberry itself, with the goal of efficiently and accurately creating breakthrough new germplasm that combines "high sugar and low acid", "high anthocyanin content", and "large fruit type" beneficial traits without changing its genetic background.

[0008] To solve the above problems of distant hybridization, many researchers seek gene engineering techniques. For example, there have been some research results on the genetic regulation of forest strawberry fruit traits. For example, CN202311270793.4 discloses the application of an RNAi interference vector FvDML-RNAi for obtaining pink forest strawberry fruit, CN202210605652.2 discloses mF3H mutants and related products and uses thereof, both of which relate to anthocyanin content and synthesis regulation of forest strawberry. CN202510119319.4 discloses a gene for regulating the sugar content of strawberry fruit and its application, which relates to the regulation of sugar content in forest strawberry fruit. CN201911206509.0 discloses the application of RAP gene and breeding method for changing the color of strawberry fruit, which relates to the color breeding of forest strawberry fruit. CN202010067127.0 discloses a set of strawberry fruit qRT-PCR internal reference genes, primers and applications, which relates to the development regulation of receptacle in forest strawberry. CN202010003916.8 discloses an Indel marker for strawberry fruit color trait assisted breeding and application, which relates to the color breeding of forest strawberry fruit. CN202210605652.2 discloses mF3H mutants and related products and uses thereof, which relates to the synthesis regulation of anthocyanin in forest strawberry. It has also been found that the ubiquitin E3 ligase constitutive photomorphogenic 1 (COP1) protein is a negative regulator of light signaling. FvCOP1 acts as a "molecular brake" for light-mediated fruit quality improvement in forest strawberry, and has a negative regulatory effect on fruit quality. The fvcop1 knockout mutant was found to have significantly changed fruit color and shape, and compared with the wild type, the mutant had significantly increased sugar, anthocyanin, vitamin, lignin, flavonoid, and phenolic acid content (Xiaoyi Bi et al. The E3 ubiquitin ligase COP1 inhibits sugar and anthocyanin accumulation in Zheng et al. Factor of DNA methylation 1 affects woodland strawberry plant stature and organ size via DNA methylation. Plant Physiology 2023: 191:335-351).

[0009] For fruit size traits, it is generally believed that fruit expansion and ripening are the key processes determining the size, texture, color, flavor, and other traits of fruits. However, compared to the studies on the core regulators of expansion and ripening of the climacteric fruits, the studies on the core regulators of expansion and ripening of the non-climacteric fruits are still very limited. Two transcription factors FvNAC073 and FvERF3 were identified as the master switches of fruit expansion and ripening in strawberry (a typical non-climacteric fruit); FvNAC073 knock-out or FvERF3 silencing both led to smaller fruit shape and delayed ripening, and the mechanisms were to promote fruit expansion by up-regulating the cell wall extension enzyme gene FvXTH3, and to accelerate ripening by activating the anthocyanin synthesis regulator FvMYB10 and the softening-related gene FvPL1; FvERF3 could directly bind to the promoter of FvNAC073 and activate its expression, thereby orchestrating the regulation of strawberry fruit expansion and ripening (Fan et al. A FvERF3-FvNAC073 module regulates strawberry fruit size and ripening. The Plant Journal (2025) 122, e70262).

[0010] ABI4 (Abscisic acid insensitive 4) was initially identified as a key positive regulator in the signal cascade of the plant hormone abscisic acid (ABA), but more and more studies have shown that it is also widely involved in the regulation of other multiple signal pathways, including the biosynthesis and signal transduction of various plant hormones, various development processes (such as seed dormancy and germination, seedling establishment and root development), disease resistance and lipid metabolism. Consistent with its diverse biological functions, it has been reported that ABI4 can both activate and inhibit the transcription of its target genes, reflecting the complexity of ABI4 function (Umashankar Chandrasekaran et al. Multifaceted Signaling Networks Mediated by Abscisic Acid Insensitive 4. Plant Communications. http: / / creativecommons.org / licenses / by / 4.0 / ).

[0011] It has been reported that FaABI4 is involved in the ripening of strawberry fruit, and its expression is regulated by ABA, sucrose and glucose (Lu Chai, Yuan-Yue Shen. FaABI4 is involved in strawberry fruit ripening. Scientia Horticulturae 210 (2016) 34-40).

[0012] At present, the homologous gene of ABI4 has been isolated in forest strawberry, named FveABI4 (see FvH4_7g24760, GDR, https: / / www.rosaceae.org / ; LOC101302022, NCBI, https: / / www.ncbi.nlm.nih.gov / ). The present inventors have found that FveABI4 has a new function, which can be used to regulate the size and maturation process of strawberry fruit (such as regulating the coloring process of fruit), sugar and acid metabolism (such as promoting the accumulation of soluble sugar substances and reducing citric acid), and in particular, can regulate fruit size (such as regulating cell proliferation and expansion), thereby completing the present application. SUMMARY

[0013] In order to solve one or more of the above problems, the present application provides the application of FveABI4 in regulating the size of forest strawberry fruit.

[0014] Preferably, the application is achieved by up-regulating the expression of FveABI4 in forest strawberry to increase the fruit size of forest strawberry; or down-regulating the expression of FveABI4 in forest strawberry to decrease the fruit size of forest strawberry.

[0015] Preferably, the up-regulating the expression of FveABI4 in forest strawberry is achieved by over-expressing FveABI4 in forest strawberry.

[0016] Preferably, the down-regulating the expression of FveABI4 in forest strawberry is achieved by knocking down or knocking out the expression of FveABI4 in forest strawberry.

[0017] Preferably, the nucleotide sequence of FveABI4 is shown as SEQ ID NO. 1.

[0018] Preferably, the amino acid sequence of FveABI4 is shown as SEQ ID NO. 2.

[0019] Preferably, the knocking down is achieved by introducing a mutation of FveABI4.

[0020] Preferably, the mutation is a T29D mutation of FveABI4 gene.

[0021] Preferably, the application further comprises an application in regulating at least one of the following traits of forest strawberry fruit: (1) fruit ripening process; (2) fruit soluble sugar accumulation; (3) fruit citric acid content.

[0022] Preferably, the application is achieved by up-regulating the expression of FveABI4 in forest strawberry to promote the fruit ripening process of forest strawberry; or down-regulating the expression of FveABI4 in forest strawberry to delay the fruit ripening process of forest strawberry.

[0023] More preferably, the application is achieved by up-regulating the expression of FveABI4 in forest strawberry to promote the fruit soluble sugar accumulation of forest strawberry; or down-regulating the expression of FveABI4 in forest strawberry to decrease the fruit soluble sugar accumulation of forest strawberry.

[0024] Preferably, the application is achieved by up-regulating the expression of FveABI4 in forest strawberry to decrease the fruit citric acid content of forest strawberry; or down-regulating the expression of FveABI4 in forest strawberry to increase the fruit citric acid content of forest strawberry.

[0025] The fruits of forest strawberry contain much more anthocyanins, ellagic acid, phenolic substances and vitamin C than common cultivated strawberries, and have high commercial value. Forest strawberry has great application potential in the fields of high-end food processing, healthy functional food and health product raw materials. In addition, forest strawberry has high ornamental value and has great application value in urban agriculture and garden greening. However, forest strawberry has problems such as small fruit size, poor commodity quality and high planting cost. However, the conventional breeding method for forest strawberry has problems such as reproductive isolation, sterility of offspring, extremely long breeding cycle and serious separation of excellent traits in offspring.

[0026] In order to solve these problems, the present inventors found that FveABI4 has a new function, and one or more of the above problems can be solved by artificially interfering with the expression of FveABI4 in forest strawberry, for example, by using genetic engineering means. For example, by overexpressing FveABI4 in forest strawberry, the size of forest strawberry fruit can be increased; for ornamental needs, forest strawberry fruit can also be made smaller by knocking down or knocking out FveABI4, so that forest strawberry hangs a mini fruit with high ornamental value. Moreover, when the size of forest strawberry fruit is regulated by the above means, the maturation progress and sugar acidity of forest strawberry fruit can also be regulated. Similarly, when FveABI4 is overexpressed in forest strawberry to increase the size of forest strawberry fruit, the maturation of forest strawberry fruit can also be promoted, the sweetness of the fruit can be increased, and the acidity of the fruit can be reduced, thereby improving the taste of the fruit. Alternatively, when FveABI4 is knocked down or knocked out to obtain a mini fruit, the sweetness of the fruit can also be reduced, the acidity of the fruit can be maintained, and the fruit can be less damaged by animals or insects, which is very beneficial to the ornamental horticultural application of forest strawberry. Therefore, FveABI4 is expected to have great application potential in the development of the commercial value of forest strawberry. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 FveABI4, FveABI4 T29D Creation of overexpression materials. Wherein, a. Green fluorescent protein and qRT identification in FveABI4-OE fruit; b. FveABI4-OE phenotype observation; c. Protein level of FveABI4 in FveABI4-OE fruit; d. FveABI4 T29D Green fluorescent protein and qRT identification in FveABI4-OE fruit; e. FveABI4 T29D Phenotype observation of FveABI4-OE; f. Protein level of FveABI4 in FveABI4-OE fruit. T29D FveABI4 T29D in FveABI4-OE fruit.

[0028] Figure 2FveABI4-OE fruit development process observation and physiological index determination. Among them, a. FveABI4-OE fruit development process observation; b. FveABI4-OE mature fruit anthocyanin, soluble sugar, citric acid content determination. P≤0.05, error value is standard deviation.

[0029] Figure 3 FveABI4-OE, FveABI4 T29D FveABI4-OE fruit size determination. Among them, a. FveABI4-OE, FveABI4 T29D FveABI4-OE mature fruit trait observation; b. FveABI4-OE, FveABI4 T29D FveABI4-OE fruit longitudinal diameter determination; c. FveABI4-OE, FveABI4 T29D FveABI4-OE fruit toluidine blue staining section; d. Fruit transverse diameter cell number determination; e. Cell area statistics. P≤0.05, error value is standard deviation. DETAILED DESCRIPTION

[0030] The application will be further described below through specific embodiments. It should be understood that these specific embodiments are only for the purpose of example, and the protection scope of the application is not limited to these specific embodiments. Example 1

[0031] This embodiment carries out RNA extraction, reverse transcription and acquisition of target gene sequence, and the specific implementation steps are as follows: First, take strawberry plant tissue as the starting material, and separate and obtain high-integrity total RNA according to the operation rules of the plant total RNA extraction kit (from Omega).

[0032] Subsequently, the total RNA is used as a template, and the first strand complementary DNA (i.e. cDNA) is synthesized by following the instructions of the reverse transcription kit (from Lambolide Company).

[0033] Then, the obtained cDNA is used as a template, and polymerase chain reaction (PCR) amplification is carried out by using P520 high-fidelity DNA polymerase (from Vazyme Company). The primer pair used for amplification is as follows: Upstream primer: sequence is 5'-ATGGACGAAGACGACACTTC-3'(SEQ ID NO. 3) Downstream primer: sequence is 5'-ATCAAATCCTTTAAAATCCA-3'(SEQ ID NO. 4) By the PCR reaction, the complete coding region sequence of the strawberry FveABI4 gene is specifically obtained as an amplification product, as shown in SEQ ID NO. 1. The amino acid sequence encoded by the FveABI4 gene (i.e. the protein sequence of FveABI4) is shown in SEQ ID NO. 2.

[0034] The PCR amplification product is inserted into a pEASY-Blunt cloning vector (the vector is from the full style gold bio, and the kit is from the full style gold bio), thereby constructing a recombinant plasmid of the wild type FveABI4 gene (i.e. a wild type plasmid vector).

[0035] In order to further obtain the FveABI4 protein with functional mutations, the present application uses overlap extension PCR technology to introduce site-directed amino acid substitution. The foregoing wild type plasmid is used as a template, and in addition to using the same upstream and downstream primers described above, a pair of intermediate primers carrying predetermined mutations is additionally introduced as follows: Intermediate primer 1: 5'-CACCACCGACCCAACCGCCACAGCATCAGA-3' (SEQ ID NO. 5) Intermediate primer 2: 5'-GGTTGGGTCGGTGGTGGTGGTTTCAGCACC-3' (SEQ ID NO. 6) The design of the primer pair aims to mutate the 29th codon in the gene sequence from "ACC" encoding threonine to "GAC" encoding aspartic acid, i.e. to achieve amino acid substitution of T29D. Through two independent rounds of PCR amplification and fragment overlap extension, the FveABI4 T29D mutant gene sequence is successfully obtained. Finally, the mutant gene sequence is also constructed into a pEASY-Blunt cloning vector to complete the preparation of the recombinant plasmid.

[0036] At this point, the entry vector containing the FveABI4 or its mutant FveABI4 T29D coding sequence is obtained. Example 2: Construction of transformation vector

[0037] On the basis of successfully constructing the entry vector containing the FveABI4 or its mutant FveABI4 T29D coding sequence, in order to further obtain an expression vector for plant transformation, the present application uses Gateway™ recombination cloning technology for subsequent operation.

[0038] Step 1: Construction of entry vector The pEASY vector containing the target gene was used as a template for polymerase chain reaction amplification using high-fidelity DNA polymerase (from Vazyme Company). The primers used for amplification were specially designed, and the attB1 and attB2 recombination linker sequences required by Gateway™ technology were introduced at the 5' end, respectively: attB1 -upstream primer: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTGCATGGACGAAGACGACACTTC-3' (SEQ ID NO. 7) attB2 -downstream primer: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTGATCAAATCCTTTAAAATCCA-3' (SEQ ID NO. 8) Through this PCR reaction, the coding sequences of FveABI4 and FveABI4 T29D were accurately connected on both sides with attB sites, obtaining the corresponding attB-PCR products. Subsequently, under the catalysis of BP Clonase™ enzyme (from Invitrogen Company), the attB-PCR products were in vitro recombined with the entry vector pDONRTM221 (from Invitrogen™) through BP recombination reaction, so as to transfer the target gene sequence to the entry vector, obtaining the "entry clone".

[0039] Second step: construction of expression vector After obtaining the correct entry clone verified by sequencing, LR recombination reaction was carried out. Under the catalysis of LR Clonase™ enzyme (from Invitrogen Company), the target gene expression frame in the entry vector was site-specifically recombined with the target vector pH7WG2D (BioVector NTCC Typical Culture Collection Center (Beijing)). This reaction accurately exchanged the target gene from the pDONRTM221 vector to the plant overexpression vector pH7WG2D, finally constructing the final expression vector of FveABI4 or FveABI4 T29D .

[0040] Third step: Agrobacterium transformation The final expression vector constructed successfully above was introduced into EHA105 Agrobacterium competent cells by freeze-thaw method, obtaining the engineering strain for subsequent plant transgenic operation. Example 3: stable genetic transformation of strawberry

[0041] 1. Preparation of sterile plant explants Mature seeds of the diploid forest strawberry (Fragaria vesca) cultivar 'di Bossco' were used as initial explants. Seeds underwent surface sterilization as follows: first, soaking in 75% (v / v) ethanol solution for 30 seconds, followed by sterilization by soaking in 10% (v / v) sodium hypochlorite solution for 8 minutes, and finally rinsing five times with sterile distilled water to remove residual disinfectant. Sterilized seeds were evenly sown on 1 / 2 MS basal solid medium (composed of: 2.2 g / L MS basal salts, 10 g / L glucose, 7 g / L agar powder, and 0.01 mg / L IBA). The medium was incubated at 25°C and light intensity of 200–300 μmol·m⁻². -2 ·s -1 The tissue cultured seedlings were cultured for 45 days under sterile tissue culture conditions, and the resulting sterile tissue culture seedling leaves were used as recipient materials for subsequent genetic transformation.

[0042] 2. Activation of engineered Agrobacterium and preparation of infection solution The frozen target genetically engineered Agrobacterium (Strain EHA105) was streaked onto LB solid medium containing appropriate amounts of spectinomycin (25 mg / L) and rifampin (50 mg / L) and cultured at 28°C until single colonies appeared. A single positive clone was picked and inoculated into LB liquid medium containing the same antibiotics and cultured overnight at 28°C with shaking at 200 rpm. The cells in the logarithmic growth phase were collected by centrifugation, the supernatant was discarded, and the cells were resuspended in MS liquid suspension medium (composed of: 4.4 g / L MS basal salt, 30 g / L sucrose, and 100 μM acetylsylphenone). The bacterial concentration was adjusted to OD600 of 0.4–0.6 using a spectrophotometer. The adjusted bacterial suspension was incubated at room temperature in the dark for 1 hour to complete pre-infection activation.

[0043] 3. Infection and co-culture of explants Leaves were cut from sterile tissue culture seedlings and trimmed to a size of approximately 0.5 cm. 2 The explants were completely immersed in the supplemented MS liquid suspension medium prepared in step 2, and agitated to ensure contact. The infection time was controlled at 30 to 60 minutes. After infection, excess bacterial solution adhering to the surface of the explants was blotted dry with sterile filter paper. Subsequently, the explants were transferred to co-culture medium (composed of: MS basal salt 4.4 g / L, sucrose 30 g / L, agar powder 8 g / L, with the addition of TDZ 2 mg / L, 6-BA 0.1 mg / L, and 2,4-D 0.01 mg / L) and co-cultured at 25°C in complete darkness for 3 days.

[0044] 4. Callus induction and selection of resistant shoots After co-cultivation, explants were transferred to a selection and differentiation medium (MS basal salts 4.4 g / L, sucrose 30 g / L, agar 8 g / L, supplemented with TDZ 2 mg / L, 6-BA 0.1 mg / L, 2,4-D 0.01 mg / L, Timentin 500 mg / L and Hygromycin Hyg 2 mg / L). The explants were first incubated for 15 days at 25°C in the dark to promote callus formation at the wound site. Once callus formation was observed, cultures were transferred to the same light conditions for further incubation to induce callus differentiation and select for hygromycin-resistant shoot clusters.

[0045] 5. Rooting of resistant plants From the selection medium, resistant shoot clusters were isolated and transferred to a rooting medium (MS basal salts 4.4 g / L, sucrose 30 g / L, agar 8 g / L, supplemented with Timentin 500 mg / L and Hygromycin Hyg 2 mg / L). On this medium, resistant shoot clusters developed into complete adventitious root systems, thus obtaining transgenic strawberry regenerative plants (i.e. regenerative resistant plants) that can be used for further analysis.

[0046] 6. Molecular identification of transgenic plants To confirm the integration and expression of the gene of interest in the regenerative plants, the regenerative resistant plants obtained from the selection were verified at the molecular level. Specifically, total RNA was extracted from the leaves of the regenerative plants and first-strand cDNA was synthesized by reverse transcription according to the methods described above.

[0047] Real-time quantitative PCR was used for expression analysis. The housekeeping gene Actin was used as an internal control, and its specific primer pair (upstream "ATCCCAAGGCCAATCGTGAG" (SEQ ID NO. 9), downstream AGGATGGCATGAGGGAGGG (SEQ ID NO. 10)) was used for amplification to standardize the amount of cDNA template among different samples. At the same time, the specific primer pair for the exogenous target gene FveABI4 (upstream "TGTCTATGTCTTCGCAGC" (SEQ ID NO. 11), downstream "ATCACCGTAGTAGTCCCAG" (SEQ ID NO. 12)) was used to amplify the cDNA of wild-type control and transgenic regenerated seedlings, respectively. The target gene copy number was normalized by the commonly used comparative ΔΔCt method (see Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001 Dec;25(4):402-8. doi:10.1006 / meth.2001.1262. PMID: 11846609.) to quantify the expression with reference to the Actin gene.

[0048] Through comparative analysis, if specific FveABI4 gene transcripts are detected in transgenic regenerated seedlings, but not or at a low level in wild-type controls, it is finally confirmed that the target gene has been successfully integrated into the plant genome and effectively expressed, thereby identifying positive transgenic plants, designated as FveABI4-OE and FveABI4-OE, respectively. T29D

[0049] 7. Seedling, transplanting and greenhouse planting The transgenic plants confirmed as positive by the above molecular identification were selected for pre-transplanting preparation. The medium residues attached to the roots were removed, and the plants were transplanted into mixed substrate with a volume ratio of nutrient soil: grass carbon: vermiculite = 2: 1: 1.

[0050] After transplanting, the plants were immediately covered with a transparent moisture retention device (such as a plastic wrap cover) to maintain a high humidity environment (relative humidity of 40% to 60%) close to the tissue culture conditions for a 3-week seedling process.

[0051] ​After successful hardening, the plants were transferred to a controlled environment nursery (conditions: temperature 22℃, photoperiod 12 hours light / 12 hours dark) for two months of cultivation, and then planted in a greenhouse for subsequent trait observation and experimental sampling. Example 4

[0052] This embodiment performs Western blot analysis of proteins.

[0053] 1. Protein Sample Preparation Extracting strawberry WT, FveABI4-OE, and FveABI4 T29D Total protein from fruits grown by -OE plants (kit from Beyotime) was lysed on ice using RIPA lysis buffer (containing 1 mM PMSF protease inhibitor) pre-cooled to 4°C. Subsequently, the mixture was centrifuged at 12,000×g for 15 minutes at 4°C, and the supernatant was collected as the total protein sample. Protein concentration was determined using a BCA protein quantification kit (from Beyotime) to ensure consistent loading. The protein sample was mixed with 5× SDS-PAGE loading buffer and heated at 95°C for 10 minutes in a metal bath to denature the protein.

[0054] 2. SDS-polyacrylamide gel electrophoresis The prepared protein samples and pre-stained protein molecular weight standards (from Huayu Biotechnology) were sequentially loaded into the sample wells. The initial voltage was set to 80V. After the samples were pressed into a straight line, the voltage was switched to 120V, and electrophoresis was continued until the bromophenol blue indicator reached the bottom edge of the gel, at which point the electrophoresis was terminated.

[0055] 3. Protein transfer Wet transfer was used. After electrophoresis, the gel was removed and assembled into a "sandwich" structure with a PVDF membrane pre-equilibrated in transfer buffer (from positive to negative electrode: sponge, filter paper, PVDF membrane, gel, filter paper, sponge). The structure was placed in a transfer tank and transferred to the solid membrane at a constant current of 250 mA–300 mA for 90 minutes under ice bath conditions.

[0056] 4. Blocking and antibody incubation After the transfer was complete, the PVDF membrane was removed and immersed in 5% (w / v) skim milk in TBST (Tris Buffered Saline with Tween) buffer (a commonly used Tris-buffered saline containing Tween). The membrane was blocked on a shaker at room temperature for 1 hour to block non-specific binding sites. After blocking, the membrane was briefly rinsed with TBST buffer. Then, the membrane was incubated overnight at 4°C with a primary antibody solution prepared with the blocking buffer. The next day, the membrane was washed three times with TBST buffer on a shaker for 10 minutes each time to completely remove unbound primary antibody. Then, the membrane was incubated with the corresponding horseradish peroxidase-labeled secondary antibody solution at room temperature for 1 hour. After incubation, the membrane was washed three more times with TBST buffer for 10 minutes each time.

[0057] 5. Chemiluminescence detection and imaging The eECL chemiluminescence kit (from ABclonal) was used according to the manufacturer's instructions. Specifically, equal volumes of ECL chemiluminescence substrate solution A and solution B were mixed and added to the protein surface of the membrane. The mixture was incubated at room temperature for 5 minutes. After blotting off excess substrate solution with filter paper, the membrane was placed in a chemiluminescence imaging system for exposure and detection, and signal images of specific protein bands were acquired. Example 5: Strawberry fruit slices and toluidine blue staining

[0058] This embodiment describes the preparation and staining of histological sections of strawberry fruit, specifically including the following steps: 1. Sample fixation and dehydration WT, FveABI4-OE, and FveABI4 during the green fruit harvesting period T29D -OE strawberry fruit, cut the fruit into pieces no larger than 0.5 cm in volume. 3 And not less than 0.2cm 3 Tissue blocks were immediately immersed in FAA fixative (standard composition: 50% ethanol: glacial acetic acid: formaldehyde = 18:1:1). Vacuum fixation was performed at 4°C until the tissue blocks settled, followed by continued fixation for 24 hours. After fixation, the tissue blocks were sequentially dehydrated using a series of ethanol solutions (50%, 70%, 85%, 95%, 100% I, 100% II), with each concentration treated for 2 hours.

[0059] 2. Transparent, wax-impregnated and embedded After dehydration, the tissue block was sequentially placed in a mixture of ethanol and xylene (1:1 by volume), pure xylene (I), and pure xylene (II) for transparency treatment, each step lasting 2 hours. Subsequently, the tissue block was moved into pre-melted paraffin and immersed in a 60°C constant-temperature oven, during which the pure wax was replaced 3 times, and the total wax immersion time was 48 hours. Finally, the wax-impregnated tissue block was embedded into a regular wax block using a tissue embedding machine.

[0060] 3. Sectioning, unrolling, and drying After trimming the embedded wax block, it was installed on a paraffin microtome. The sectioning thickness was adjusted to 10 pm, and sectioning was performed. The cut wax ribbon was floated in a 40°C unrolling water bath, and after it was flattened, it was lifted with a glass slide. The glass slide with the section was placed on a 45°C drying table to dry the moisture, and then transferred to a 37°C constant-temperature oven overnight.

[0061] 4. De-waxing, rehydrating, and staining The dried section was sequentially immersed in pure xylene (I) and pure xylene (II) for de-waxing, each step lasting 10 minutes. Subsequently, the section was sequentially passed through gradient ethanol (100%, 95%, 85%, 70%, 50%) for rehydration, each step lasting 5 minutes, and finally immersed in distilled water for washing. The rehydrated section was immersed in 0.1% (w / v) toluidine blue O staining solution for 5 minutes.

[0062] 5. Color separation, dehydration, and mounting The section was rinsed with water to remove the floating color until the background was colorless. Subsequently, the section was dehydrated through gradient ethanol (70%, 85%, 95%, 100%), each step lasting 1 minute. After dehydration, the section was transparentized in xylene for 5 minutes. Finally, neutral gum mounting agent was added dropwise, and a cover glass was placed for mounting.

[0063] 6. Microscopy and image acquisition The prepared section was observed under an optical microscope and images were acquired. After toluidine blue staining, the cell nuclei in the strawberry fruit tissue appeared blue, and the cell walls showed characteristic coloration from blue-green to purple-blue according to their chemical composition differences, clearly showing the cell morphology and tissue structure of the fruit.

[0064] 7. Cell number and size statistics To analyze the causes of fruit phenotype differences from the perspective of tissue cytology, the present application performs quantitative analysis of fruit microsections at the cellular level, with the specific steps as follows: 7.1 Cell number statistics The paraffin sections of strawberry fruits of each genotype were used as samples, and their digital images were imported into the image analysis software ImageJ. A straight line was drawn along the maximum transverse diameter of the fruit section, and the total number of cells passing through the line was counted. At least 3 independent biological replicates (i.e. sections from different fruits) were analyzed for each genotype, and the final results were expressed as the arithmetic mean of all statistical values within each genotype. This index was used to assess whether the final size of the fruit was dominated by cell proliferation or cell expansion.

[0065] 7.2 Cell area measurement Under different fields of view of the same batch of fruit sections, a field of view was randomly selected in the pulp area for image acquisition. Using the measurement tool in Image J software, the cross-sectional areas of the 20 largest cells in the field of view were outlined and measured. Three different fields of view were randomly selected for repeated measurement for each fruit sample, and at least 3 independent fruit samples were analyzed for each genotype. Finally, the cell area data of each genotype was statistically compared by the arithmetic mean of all measured values, which directly reflects the degree of cell swelling. Example 6: Measurement of strawberry morphological index and victory index

[0066] To systematically evaluate the effects of FveABI4 or its mutant FveABI4 T29D on fruit development and quality, the following methods were used for comparative analysis: 1. Fruit development process observation Fully expanded flowers located in the same canopy were selected on WT, FveABI4-OE, FveABI4 T29D -OE plants, and labeled on the day of flowering, recorded as 0 days after flowering. The labeled fruits on the plants of each genotype were regularly imaged, and the fruit coloring time and the number of days required for complete coloring were recorded by visual comparison and image analysis, thereby qualitatively evaluating the effects of different genotypes on fruit development and maturation process.

[0067] 2. Measurement of fruit morphological index At the ripe stage of the fruit, 3 biological replicate plants were randomly selected from WT, FveABI4-OE, FveABI4 T29D -OE genotype plants. From each plant, 10 fruits of uniform size and maturity were randomly collected. A vernier caliper with a precision of 0.01 mm was used to measure the maximum longitudinal diameter and maximum transverse diameter of each fruit one by one, and the data were recorded and the average value of the fruits of each genotype was calculated to evaluate the potential effects of transgenesis on fruit size and shape.

[0068] 3. Analysis of fruit quality components To accurately evaluate the intrinsic quality of mature fruits, the following steps were taken for measurement: Sample preparation: 3 plants of each genotype were randomly selected, and 10 fruits with consistent maturity were randomly collected from each plant. All fruit samples were immediately used for determination or frozen for later use.

[0069] Anthocyanin content screening: First, the total anthocyanin content of all samples was determined by spectrophotometry to ensure that the fruit samples used for subsequent precise analysis had a consistent maturity background, excluding the influence of maturity differences on the results.

[0070] Sugar and acid content determination: Within the sample group with consistent anthocyanin content, the following quantitative analysis was performed: Soluble sugar content: Determined by anthrone colorimetry, with the result expressed in milligrams per gram of fresh weight.

[0071] Citric acid content: Determined by NAD-coupled enzyme meter method, with the result expressed in milligrams per gram of fresh weight.

[0072] All determinations were set with technical repeats, and the data were finally expressed as the average value ± standard error of all determination results within each genotype.

[0073] Results analysis 1. Molecular identification of FveABI4 and its functional gain-of-function mutant overexpression lines To clarify the biological function of FveABI4 and its phosphorylation mimic mutant FveABI4 T29D in strawberries, the present application successfully created stable overexpression transgenic materials of the gene. The molecular identification results show that in the obtained FveABI4-OE and FveABI4 T29D -OE independent transgenic lines, real-time fluorescent quantitative PCR analysis detected that the transcription level of the FveABI4 gene was statistically significantly up-regulated compared with the wild type control. This result was verified by in vivo imaging of the green fluorescent protein reporter gene carried by the expression vector (see Figure 1 a and Figure 1 d).

[0074] Phenotype observation confirmed that the overexpression of FveABI4 or FveABI4 T29D did not cause obvious developmental defects or growth abnormalities in transgenic plants, indicating that the overexpression of the gene had good biocompatibility in the genetic background (see Figure 1 b and 1e).

[0075] For confirmation at the protein level, the present application prepared specific antibodies for FveABI4 and its T29D mutant, respectively, and used Western blotting technology for detection. The results confirmed that FveABI4 protein specifically accumulated in FveABI4-OE materials, while FveABI4 T29DMutant proteins in FveABI4 T29D Specific accumulation in OE materials, both of which were significantly higher than the wild type background level (see Figure 1 c and 1f).

[0076] 2. FveABI4 positively regulates the ripening process and sugar acid metabolism of strawberry fruits Systematic observation of the fruit development dynamics of FveABI4-OE plants found that the gene plays a key role in regulating fruit ripening timing: Compared with the wild type, overexpression of FveABI4 significantly promotes the fruit coloring process, resulting in a significant advance in the ripening period (see Figure 2 a).

[0077] To exclude the interference of maturity difference on the analysis of internal quality, the present application selects fruits with consistent anthocyanin content for precise measurement. The results show that under the same maturity, overexpression of FveABI4 effectively promotes the accumulation of soluble sugar substances in fruits, while significantly reducing the content of citric acid (see Figure 2 b), proving that FveABI4 is a key regulatory factor for coordinating the sugar acid metabolism balance of strawberry fruits.

[0078] 3. FveABI4 and its mutant FveABI4 T29D Influence fruit size by regulating cell proliferation and expansion The present application further found that FveABI4 and its gain-of-function mutant FveABI4 T29D have opposite regulatory effects on the final size of fruits: Macroscopic phenotype observation shows that overexpression of FveABI4 leads to an increase in fruit volume, while overexpression of its mutant FveABI4 T29D leads to a decrease in fruit volume (see Figure 3 a).

[0079] Accurate metrological analysis of the longitudinal and transverse diameters of fruits confirmed that the transverse diameter of FveABI4-OE fruits significantly increased, while the longitudinal and transverse diameters of FveABI4 T29D -OE fruits significantly decreased (see Figure 3 b).

[0080] To analyze the cellular basis of the above phenotypes, fruit tissue sections and toluidine blue staining analysis were performed (see Figure 3 c). The results of cytometric analysis showed that the number of cells per unit transverse diameter in FveABI4-OE fruits was significantly more than that in the wild type, and the average cell area was also significantly increased; on the contrary, the number of cells per unit transverse diameter in FveABI4 T29D -OE fruits was significantly reduced, and the average cell area was also significantly reduced (seeFigure 3 d, 3e). This demonstrates that FveABI4 increases fruit size by synergistically promoting cell proliferation and cell expansion, while its T29D mutant can interfere with this pathway and exhibit the opposite cell phenotype, ultimately leading to smaller fruits.

[0081] Finally, it should be noted that the above examples are only intended to illustrate the technical solutions of the present application, and are not intended to limit the same; although the present application has been described in detail with reference to the foregoing examples, those of ordinary skill in the art will understand that they can still modify the technical solutions recorded in the foregoing examples, or make equivalent replacements for some of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present application.

Claims

1. Use of FveABI4 in regulating fruit size of forest strawberry.

2. Use according to claim 1, characterized in that, The use is achieved by: up-regulating expression of FveABI4 in forest strawberry to increase fruit size of forest strawberry; or down-regulating expression of FveABI4 in forest strawberry to decrease fruit size of forest strawberry.

3. The use of claim 2, wherein: the up-regulating expression of FveABI4 in forest strawberry is achieved by over-expressing FveABI4 in forest strawberry; or the down-regulating expression of FveABI4 in forest strawberry is achieved by knocking down or knocking out expression of FveABI4 in forest strawberry.

4. The use of claim 3, wherein: the nucleotide sequence of FveABI4 is shown as SEQ ID NO. 1; and / or the amino acid sequence of FveABI4 is shown as SEQ ID NO.

2.

5. Use according to claim 3, characterized in that, the knocking down is achieved by introducing a mutation of FveABI4.

6. Use according to claim 5, characterized in that, the mutation is a T29D mutation of FveABI4 gene.

7. The use according to claim 1, characterized in that, The use is further applied in regulating at least one of the following traits of fruit of forest strawberry: (1) fruit ripening process; (2) fruit soluble sugar accumulation; (3) fruit citric acid content.

8. Use according to claim 7, characterized in that, The use is achieved by:

9. Use according to claim 7, characterized in that, up-regulating expression of FveABI4 in forest strawberry to promote fruit ripening process of forest strawberry; or 10. Use according to claim 7, characterized in that, down-regulating expression of FveABI4 in forest strawberry to delay fruit ripening process of forest strawberry. The use is achieved by: up-regulating expression of FveABI4 in forest strawberry to promote fruit soluble sugar accumulation of forest strawberry; or down-regulating expression of FveABI4 in forest strawberry to decrease fruit soluble sugar accumulation of forest strawberry. The use is achieved by: up-regulating expression of FveABI4 in forest strawberry to decrease fruit citric acid content of forest strawberry; or down-regulating expression of FveABI4 in forest strawberry to increase fruit citric acid content of forest strawberry.

Images