InDel molecular marker closely linked with high-accumulation synephrine and application of InDel molecular marker

Abstract

The invention discloses an InDel molecular marker closely linked with high-accumulation synephrine and application of the InDel molecular marker. The nucleotide sequence of the InDel molecular marker is shown as SEQ ID No. 1. The kit for identifying the content of synephrine in the citrus germplasm is obtained, the kit is used for identifying high-accumulation and low-accumulation synephrine in the citrus germplasm, and the defects that time and labor are wasted, cost is high and the like when high-accumulation synephrine in the citrus germplasm is judged by means of secondary metabolite content determination in the prior art can be overcome. By utilizing a seedling stage molecular marker diagnosis technology, the dependence of medicinal grapefruit identification on a key period of accumulation of medicinal components can be broken through. The kit can be used for screening a single medicinal grapefruit plant with high synephrine accumulation in pericarp, has the advantages of early screening and low cost, and greatly accelerates the screening efficiency of medicinal grapefruit varieties.

Description

Technical Field

[0001] This invention relates to the field of molecular marker development technology for medicinal fruit metabolism, specifically to an InDel molecular marker closely linked to highly accumulating synephrine and its application. Background Technology

[0002] The Huyou pomelo, mainly produced in Changshan County, Quzhou City, Zhejiang Province, is a local specialty citrus resource in my country, also known as Changshan pomelo orange. Its dried, unripe fruit is called "Quzhi Ke" and has the effects of regulating qi, relieving chest congestion, and promoting digestion. It has been listed as one of the new "Eight Treasures of Zhejiang" and a traditional Chinese medicine, possessing extremely strong medicinal value and economic potential.

[0003] Studies have shown that pomelo peel is rich in various chemical components, mainly including flavonoids, limonenes, coumarins, and phenolic acids, which possess anti-inflammatory and other pharmacological activities. In addition, pomelo peel also contains a wide range of alkaloids, such as synephrine. Synephrine can improve metabolism, accelerate calorie consumption, increase energy levels, and promote fat oxidation; it is currently used in the pharmaceutical and health product industries.

[0004] The pomelo can be used medicinally and eaten fresh; its medicinal value depends on the content of secondary metabolites such as synephrine in its peel. However, the harvesting period for medicinal citrus fruits like the pomelo is from late June to early July when the peel is still green, making early screening during the seedling stage impossible and limiting the efficient selection of high-value medicinal pomelos. Molecular marker-assisted breeding technology, with its advantages of ease of operation, high accuracy, and good reproducibility, is an effective means to solve this problem. This technology can not only identify the target trait at the seedling stage and eliminate individual plants that do not conform to the target trait, but also significantly reduce unnecessary human, material, and financial investment in the breeding process of medicinal pomelos, thereby improving the screening efficiency of new medicinal pomelo varieties.

[0005] Currently, there are no effective molecular markers for identifying citrus germplasm with high synephrine accumulation. Therefore, developing a molecular marker that can rapidly identify synephrine-accumulating citrus germplasm and applying it to the screening of citrus germplasm is of great significance for promoting the screening and dissemination of citrus germplasm. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a rapid identification method for tightly linked InDel molecular markers with high synephrine accumulation and their applications. This allows for rapid identification of citrus germplasm with high synephrine accumulation at the seedling stage, improving the efficiency of screening medicinal citrus germplasm.

[0007] To achieve the above objectives, the technical solution designed by the present invention is as follows: The present invention provides an InDel molecular marker that is closely linked to highly accumulating synephrine, the nucleotide sequence of which is shown in SEQ ID No. 1.

[0008] This invention also provides a primer pair for amplifying the above-mentioned InDel molecular marker, wherein the primer pair is: Upstream primer F: 5'-GTGGGTATATCATTGAACACTCT-3', as shown in SEQ ID No. 2. Downstream primer R: 5'-CCTCAATCAAATTGGCTTGG-3', as shown in SEQ ID No. 3.

[0009] The present invention also provides an application of the above-mentioned primer pair in the identification of germplasm of highly accumulated synephrine citrus.

[0010] The present invention also provides the application of the above-mentioned primer pair in the preparation of a kit for identifying highly accumulated synephrine citrus germplasm.

[0011] The present invention also provides a kit for identifying highly accumulated synephrine citrus germplasm, the kit comprising the primer pairs described above.

[0012] This invention also provides a method for identifying highly accumulated synephrine in pomelo peel, comprising the following steps: 1) Extract DNA from the pomelo seedling tissue to be tested; 2) Perform PCR using the primer pairs or kits described above; 3) Electrophoresis of amplified products: Based on the band characteristics of the amplified products, determine the level of synephrine accumulation in the peel of the grapefruit to be tested in the future.

[0013] Furthermore, in step 3), the judgment criteria are as follows: When the electrophoresis lane contains two bands, one long and one short, it indicates that the peel of the grapefruit to be tested will have a high accumulation of synephrine. Alternatively, if the electrophoresis lane contains a single band, it indicates that the peel of the grapefruit being tested will have low synephrine accumulation.

[0014] Furthermore, in step 3), the judgment criteria are as follows: When the electrophoresis lane contains a long band of 1,239 bp and a short band of 293 bp, it indicates that the peel of the grapefruit to be tested will have a high accumulation of synephrine. Alternatively, if the electrophoretic lane contains a 293 bp band, it indicates that the peel of the grapefruit being tested will have low synephrine accumulation.

[0015] Furthermore, in step 2), the PCR amplification system, in 20 μL, includes: 10 μL PCR Mix, 100 ng template, 1 μM each of upstream and downstream primers, and the remainder ddH2O.

[0016] Furthermore, in step 2), the PCR amplification program includes: 98 °C pre-denaturation for 3 min; 98 °C denaturation for 20 sec, 55 °C annealing for 20 sec, 72 °C extension for 1 min, 35 cycles; 72 °C further extension for 5 min, and storage at 12 °C.

[0017] The present invention also provides an application of the above-described kit in the identification of highly accumulated synephrine citrus germplasm.

[0018] The beneficial effects of this invention are: 1. This invention provides an InDel molecular marker tightly linked to highly accumulated synephrine. The invention designs a forward primer F upstream of the InDel molecular marker fragment and a reverse primer R downstream, forming primer pair F and R. This invention allows for molecular marker detection using the aforementioned primer pair F and R, and the genotype of each material at that locus can be determined solely from the gel image of the amplification product.

[0019] 2. This invention provides a kit for identifying highly accumulated synephrine citrus germplasm. Using this kit to identify highly accumulated synephrine citrus germplasm can overcome the disadvantages of traditional methods that rely on the determination of secondary metabolite content, such as being time-consuming, labor-intensive, and costly.

[0020] 3. By utilizing molecular marker diagnostic technology at the seedling stage, the dependence of medicinal pomelo identification on the critical period of medicinal component accumulation can be broken. This kit can be used to screen individual medicinal pomelo plants with high synephrine accumulation in the peel, offering advantages of early screening and low cost, significantly accelerating the screening efficiency of medicinal pomelo varieties. Attached Figure Description

[0021] Figure 1 This is a schematic diagram showing the relative content of synephrine in the peel of 19 pomelo samples. In the picture, 1 is Crispy Red Pomelo; 2 is Changshan Pomelo Orange No. 9; 3 is Pomelo No. 2; 4 is Crispy Treasure Pomelo; 5 is Pear-shaped Pomelo; 6 is Dong'an Red-skinned Pomelo; 7 is Low-acid Large-fruited Pomelo; 8 is 83 Series Pomelo; 9 is Ancestral Tree Pomelo; 10 is Yellow-skinned Pomelo; 11 is Taigongshan (Aijia) Pomelo; 12 is Pomelo from Zhongyou Base; 13 is Pomelo from Haishui Base; 14 is Pomelo from Zhou Jinhua Base; 15 is Pomelo from Sanjian Base; 16 is Pomelo from Tongmensi Base; 17 is Pomelo from Fengjiashan Base; 18 is Pomelo from Zheng Zhongxuan Base; 19 is Pomelo from Xie Yugen Base. Figure 2 This is a diagram showing the amplification results of the primer pairs in 19 pomelo samples. In the picture, Maker is DM 5000 Plus; 1 is Crispy Red Pomelo; 2 is Changshan Pomelo Orange No. 9; 3 is Pomelo No. 2; 4 is Crispy Treasure Pomelo; 5 is Pear-shaped Pomelo; 6 is Dong'an Red-skinned Pomelo; 7 is Low-acid Large-fruited Pomelo; 8 is 83 Series Pomelo; 9 is Ancestral Tree Pomelo; 10 is Yellow-skinned Pomelo; 11 is Taigongshan (Aijia) Pomelo; 12 is Pomelo from Zhongyou Base; 13 is Pomelo from Haishui Base; 14 is Pomelo from Zhou Jinhua Base; 15 is Pomelo from Sanjian Base; 16 is Pomelo from Tongmensi Base; 17 is Pomelo from Fengjiashan Base; 18 is Pomelo from Zheng Zhongxuan Base; 19 is Pomelo from Xie Yugen Base. Figure 3 A diagram showing the sequence differences in high / low synephrine accumulation among 19 pomelo samples. Figure 4 A schematic diagram showing the relative content of synephrine in the peels of two local specialty resources of Zhejiang (Quzhou orange and Guangcheng orange); In the picture, 001 is Xikou Quzhou orange; 002 is Danong Guangcheng orange. Figure 5 The image shows the amplification results of the primer pairs in two local specialty resources of Zhejiang (Quzhou orange and Guangcheng orange). In the picture, Maker is DM 5000 Plus; 001 is Xikou Quzhou orange; 002 is Danong Guangcheng orange; Detailed Implementation The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can understand it.

[0022] Example 1 The specific steps for screening tightly linked InDel molecular markers in highly accumulated synephrine citrus germplasm based on whole-genome sequencing are as follows: In the embodiment, the synephrine content of 19 different pomelo resources was detected, and it was found that the synephrine content of a single pomelo tree (Changshan Youcheng No. 9) reached 10. 5 Other pomelo trees had a synephrine content of less than 10%. 4 .

[0023] Therefore, in this embodiment, the synephrine content in the peel is less than 10%. 4 At that time, it was judged as low accumulation; the synephrine content in the peel was higher than 10. 5 At that time, it was determined that the citrus peel contained high levels of synephrine. In this embodiment, the method for determining the content of secondary metabolites in citrus peel was based on Zheng et al. (2022), which involved grinding the citrus peel into powder, accurately weighing 0.1 g, adding 1 ml of 70% methanol, shaking and mixing thoroughly, and then extracting overnight at 4°C. After centrifugation at 12,000 rpm / min, the supernatant was filtered through a 0.22 μm organic phase microporous membrane; subsequently, liquid chromatography-mass spectrometry was used for determination.

[0024] The results are shown in Table 1 and Figure 1 As shown, the synephrine content in the peels of 19 pomelo samples varied significantly. Among them, the No. 2 pomelo plant (Changshan Pomelo No. 9) had high synephrine accumulation, while the other pomelo plants had low synephrine accumulation.

[0025] Table 1. Identification of synephrine content in the peel of 19 different pomelos. To further identify closely linked genomic loci in highly accumulated synephrine citrus germplasm, Shanghai Paisennuo Biotechnology Co., Ltd. was commissioned to complete whole-genome sequencing (sequencing depth greater than 30×) of 19 different pomelos, obtaining a total of more than 300G of data.

[0026] The sequencing reads of 19 materials were aligned to the sweet orange v3.0 genome (http: / / citrus.hzau.edu.cn / data / Genome_info / SWO.v3.0 / SWO.v3.0.genome.fa) using BWA (v0.7.18) software, resulting in a BAM file containing all variation information. Variation sites among different natural resources were visualized using iGV software. Variation information for high- and low-accumulation synephrine resources was compared and examined individually. Based on the phenotypic characteristics of the materials, the ratios of various bases / haplotypes at the variation sites were statistically analyzed. Sequence polymorphisms with the highest association with the high-accumulation synephrine phenotype were manually examined and screened as candidate sites for molecular marker development. A 943 bp InDel was found to be significantly different between high- and low-accumulation synephrine materials in the peel. This result is a linkage marker predicted based on whole-genome resequencing results for high-accumulation synephrine citrus germplasm. The nucleotide sequence of this marker is shown in SEQ ID No. 1. TAGGGATGGCAATGGGGAGGGGAGGGAAAGGGACCGATCTCCCCGTACCCATCCCCGATATTTTGCGTATGTCTCCATCCCCTCCCCGTCCCCGTCAGAATTACTTGAGAGAATCCACATCCCTTCCCCGAATAATAACAGGGGATCCCCGAGGGTCCCCGATCCCCAAATAACTAATACATTTTTTTTCGATTTTGAGTTAATCATATTAAAATAAAAAATTCAAATAAAAGTAAAGTTCGAAATATATCTTACATTAATATCTATTATATTAAATTAGTAAGTAACGCAACATGCAAGGGATACAAACTTATTTTACAAACTATCATGAACAAATTAATAGTCTAATACAAAATTGTTACAAATAAAATCGACTATTCCCTTTACAACACAATAGTTAAATCGGAGCAAATCAAAAGTAAATATTAGATTAAATTAGATTAGATATTAAAATTGTGATTCGCTGTGGGCAATTATAACATCTAAAATTAAATAAAAAATAGATTTAAGTGTAAAATATTTAAAGAATATCAAAATTAAAAAAAATGTTTGGCTAATAAAATCTACTCGGTCTTTTTAATGTCATAAATAAAAATTTAGAACTTTAATTAGCTAATTAGGCCTAAAAGTTTAATAATATAAATATTTTGATATTTTTTATTTTTACCAATATTTATAATTTTATAATTTAAATTTTATAATTTATTTACTAGTAATTTTAAAAAATTAAAATTAAATTAAAAATTAAAATGGGGAAATGGGGAGGGGATGGGGATTCCACCTCATCCCCGTCCCCTCCCCGAATAAGAAATTGGGTAAAAAAATTTCTCCGTCCCCTCCCCGAATAAGAAATTGAGTATGAAATTATCCTCATACCCTCCCCGAATTGGGAAAATCCCCGAGAGTACCCGTCCCCGTAGGGATTTTTGCCATCCCTAATGTT。

[0027] Example 2 I. Primer pairs F / R were designed based on the InDel molecular markers described above, as follows: Upstream primer F: 5'-CCTCAATCAAATTGGCTTGG-3', as shown in SEQ ID No. 2. Downstream primer R: 5'-CCTCAATCAAATTGGCTTGG-3', as shown in SEQ ID No. 3.

[0028] II. Kit for Identifying Highly Accumulated Sylphrine Citrus Germplasm The kit includes the primer pair F / R described above.

[0029] A method for identifying highly accumulated Synephrine citrus germplasm using a kit includes the following steps: 1) Extract DNA from the pomelo seedling tissue to be tested; 2) Perform PCR using the kit described above; where, The PCR amplification system, in 20 μL increments, includes: 10 μL PCR Mix, 100 ng template, 1 μM each of upstream and downstream primers, and the remainder ddH2O.

[0030] The PCR amplification program included: 98 °C pre-denaturation for 3 min; 98 °C denaturation for 20 sec, 55 °C annealing for 20 sec, 72 °C extension for 1 min, 35 cycles; 72 °C further extension for 5 min, and storage at 12 °C.

[0031] 3) Electrophoresis of the amplified products: Based on the band characteristics of the amplified products, determine the level of synephrine accumulation in the peel of the grapefruit to be tested in the future fruit. When the electrophoresis lane contains a long band of 1,239 bp (as shown in SEQ ID No. 4) and a short band of 293 bp (as shown in SEQ ID No. 5), it indicates that the peel of the grapefruit to be tested will have a high accumulation of synephrine. Alternatively, if the electrophoretic lane contains a 293 bp band (as shown in SEQ ID No. 5), it indicates that the peel of the grapefruit being tested will have low synephrine accumulation; among which, The 1,239 bp long band is shown in SEQ ID No. 4: The 293 bp short band is shown in SEQ ID No. 5: TGTGGGTATATCATTGAACACTCTTTTGAAGTCTTGAGGGTGCTTTTGGCATTTGAGTGGGTTTAATAAACGAAATTTTAATTTTCAAAATTTAATTGTGATTACGGTAATGGGTGTAGAGAATATAATACAGTCTAAATTTTTTATT TTACGATGAATATTTTTTCTACCCATATTATTTTTTCAAGGGAGATGATTCTACTCTCACTGTATGTTTGGGAAGAAGGCAGAGAATTCCATTTTGGAACTCCAACTACTTCCCCCATTTTGCAACCAAGCCAATTTGATTGAGGA.

[0032] Example 3 The above-mentioned kit and method were used to identify 19 pomelo samples: 1) Genomic DNA was extracted from 19 pomelo samples using a modified CTAB method. 2) Using each genomic DNA as a template, PCR was performed using a kit to obtain amplification products, among which, The PCR reaction system is as follows: 10 μL PCR Mix (purchased from Yisheng Company), 100 ng DNA, 1 μM each of forward and reverse primers (synthesized by Tianyi Company), and ddH2O added to a final volume of 20 μL.

[0033] The thermal cycling parameters were: 98 °C for 3 min; 98 °C for 20 sec, 55 °C for 20 sec, 72 °C for 1 min, 35 cycles; 72 °C for 5 min, and storage at 12 °C. The reaction was performed on a BIOCENER instrument.

[0034] 3) The amplified products were detected by 1.0% agarose gel electrophoresis on a horizontal electrophoresis tank of the Beijing 61 Electrophoresis System. The electrophoresis was performed using 1xTAE buffer (0.04M Tris-acetate, 0.001M EDTA, pH 8.0), at a voltage of 120 V / cm and a current of 400 mA for 20 min. After electrophoresis, images were taken and stored using a BIO-RAD gel imaging system (UVP).

[0035] like Figure 3As shown: The high accumulation of synephrine in the peel of Changshan Youcheng No. 9 (lane 2) (a long band of 1,239 bp and a short band of 293 bp) and the low accumulation of synephrine in the peel of 18 other pomelo resources (only a band of 293 bp) both meet the criteria. Figure 1 and Figure 2 Further statistical analysis of the amplification results of 19 pomelo resources revealed that the molecular marker bands of the 19 pomelo resources were consistent with the phenotypic expression (Table 1). Overall, the consistency of the markers reached (19 / 19)×100%=100%, indicating that the markers have a high explanatory power for the high accumulation of synephrine in pomelo peel.

[0036] Therefore, the use of the above-mentioned kit provides a simple, rapid, and effective screening method for the early diagnosis and hybridization breeding of high synephrine accumulation in pomelo peel, thereby improving breeding efficiency.

[0037] Table 2. Molecular marker validation of synephrine content in the peel of 219 different pomelos. Note: "√" means it meets the requirements, and "×" means it does not meet the requirements.

[0038] Example 4 The kit developed above for identifying highly and low-accumulating synephrine in the peel of two Zhejiang local specialty resources (Quzhou orange and Guangcheng orange) includes the following steps: 1) Genomic DNA was extracted from two local specialty resources in Zhejiang Province using a modified CTAB method. 2) Using each genomic DNA as a template, PCR was performed using a kit to obtain amplification products, among which, The PCR reaction system is as follows: 10 μL PCR Mix (purchased from Yisheng Company), 100 ng DNA, 1 μM each of forward and reverse primers (synthesized by Tianyi Company), and ddH2O added to a final volume of 20 μL.

[0039] The thermal cycling parameters were: 98 °C for 3 min; 98 °C for 20 sec, 55 °C for 20 sec, 72 °C for 1 min, 35 cycles; 72 °C for 5 min, and storage at 12 °C. The reaction was performed on a BIOCENER instrument.

[0040] 3) The amplified products were detected by 1.0% agarose gel electrophoresis on a horizontal electrophoresis tank of the Beijing 61 Electrophoresis System. The electrophoresis was performed using 1xTAE buffer (0.04M Tris-acetate, 0.001M EDTA, pH 8.0), at a voltage of 120 V / cm and a current of 400 mA for 20 min. After electrophoresis, images were taken and stored using a BIO-RAD gel imaging system (UVP).

[0041] Meanwhile, in the examples, the synephrine content of two Zhejiang local specialty resources (Quzhou orange and Guangcheng orange) was determined by liquid chromatography-mass spectrometry. It was found that the synephrine content of a single plant (Quzhou orange) reached 10. 5 Another sample of a single plant (Guangcheng orange) had a synephrine content of less than 10. 4 .

[0042] The results are shown in Table 3: There was a significant difference in synephrine content in the peels of the two local specialty fruit samples from Zhejiang.

[0043] Table 3. Identification of synephrine content in the peel of two local specialty resources from Zhejiang Province like Figure 4 As shown: The high accumulation of synephrine in the peel of Quzhou orange (lane 001) (a long band of 1,239 bp and a short band of 293 bp) and the low accumulation of synephrine in the peel of Guangcheng orange (lane 002) (only a band of 293 bp), both meet the criteria of Zhejiang's characteristic resource. Figure 2 and Figure 3 Further analysis of the synephrine content in two samples of Zhejiang local specialty resources was conducted, as shown in Table 3. The synephrine content in the peels of the two samples of Zhejiang local specialty resources showed significant differences. Furthermore, the molecular marker bands of the two samples of Zhejiang local specialty resources were found to be consistent with the phenotypic expression (Table 4). Overall, the consistency of the markers reached (2 / 2)×100%=100%, indicating that the markers have a high explanatory power for the high accumulation of synephrine in the peels of Zhejiang local specialty resources.

[0044] Therefore, the use of the above-mentioned kit provides a simple, rapid, and effective screening method for early diagnosis and hybridization breeding of medium- and high-accumulation synephrine citrus germplasm, thereby improving breeding efficiency.

[0045] Table 4. Molecular marker validation of synephrine content in the peel of two local specialty resources from Zhejiang. Note: "√" means it meets the requirements, and "×" means it does not meet the requirements.

[0046] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An InDel molecular marker tightly linked to highly accumulating synephrine, characterized in that: The nucleotide sequence of the InDel molecular marker is shown in SEQ ID No.

1.

2. A primer pair for amplifying the InDel molecular marker of claim 1, characterized in that: The primer pair is Upstream primer F: 5'-GTGGGTATATCATTGAACACTCT-3', as shown in SEQ ID No.

2. Downstream primer R: 5'-CCTCAATCAAATTGGCTTGG-3', as shown in SEQ ID No.

3.

3. The application of the primer pair according to claim 2 in the identification of germplasm of highly accumulated synephrine citrus.

4. The use of the primer pair of claim 2 in the preparation of a kit for identifying highly accumulated synephrine citrus germplasm.

5. A kit for identifying highly accumulated synephrine citrus germplasm, characterized in that: The kit includes the primer pair as described in claim 2.

6. A method for identifying high accumulations of synephrine in pomelo peel, characterized in that: Includes the following steps: 1) Extract DNA from the pomelo seedling tissue to be tested; 2) Perform PCR using the primer pair described in claim 2 or the kit described in claim 5; 3) Electrophoresis of amplified products: Based on the band characteristics of the amplified products, determine the level of synephrine accumulation in the peel of the grapefruit to be tested in the future.

7. The method according to claim 6, characterized in that: In step 3), the judgment criteria are as follows: When the electrophoresis lane contains two bands, one long and one short, it indicates that the peel of the grapefruit to be tested will have a high accumulation of synephrine. Alternatively, if the electrophoresis lane contains a single band, it indicates that the peel of the grapefruit being tested will have low synephrine accumulation.

8. The method according to claim 6 or 7, characterized in that: In step 3), the judgment criteria are as follows: When the electrophoresis lane contains a long band of 1,239 bp and a short band of 293 bp, it indicates that the peel of the grapefruit to be tested will have a high accumulation of synephrine. Alternatively, if the electrophoresis lane contains a 293 bp band, it indicates that the peel of the grapefruit being tested will have low synephrine accumulation.

9. The method according to claim 6, characterized in that: In step 2), the PCR amplification system, in 20 μL, includes: 10 μL PCR Mix, 100 ng template, 1 μM each of upstream and downstream primers, and the remainder ddH2O. In step 2), the PCR amplification program includes: 98 °C pre-denaturation for 3 min; 98 °C denaturation for 20 sec, 55 °C annealing for 20 sec, 72 °C extension for 1 min, 35 cycles; 72 °C further extension for 5 min, and storage at 12 °C.

10. An application of the kit according to claim 5 in the identification of highly accumulated synephrine citrus germplasm.

Images