Rice SNP molecular marker and application thereof
By developing SNP molecular markers and LAMP primer combinations in rice, combined with a chromogenic system, the problem of screening for rice blast resistance genes in rice breeding has been solved, enabling rapid and low-cost genotyping identification, improving breeding efficiency and genetic diversity, and promoting the sustainable development of the rice industry.
Patent Information
- Application Number
- CN202511961826.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-24
- Publication Date
- 2026-04-24
- Estimated Expiration
- 2045-12-24
AI Technical Summary
In existing technologies, the lack of high-throughput and low-cost molecular marker-assisted detection methods in rice breeding makes it difficult to screen for rice blast resistance genes, resulting in long breeding cycles, low breeding efficiency, and shrinking genetic diversity, which affects the sustainable development of the rice industry and national food security.
A rice SNP molecular marker located at 10155410 bp on chromosome 6 was developed. A LAMP primer combination containing 6 primers was designed and combined with a hydroxynaphthol blue colorimetric system to rapidly and conveniently identify the genotype of the rice blast resistance gene Pigm. The amplification result was judged by the color change.
It enables rapid and specific detection of rice blast resistance genotypes, significantly shortens the breeding cycle, improves breeding efficiency, is easy for grassroots personnel to use, and reduces equipment requirements.
Smart Images

Figure CN121380437B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant molecular breeding technology, and in particular to a rice SNP molecular marker and its application. Background Technology
[0002] Rice is one of the world's most important food crops, serving as the staple food for approximately 50% of the global population. Rice blast is a global fungal disease of rice caused by the rice blast fungus (Pyricularia oryzae Cav.), which seriously threatens high and stable rice yields. The most effective, economical, and environmentally friendly strategy to address rice blast damage is to discover and utilize broad-spectrum, durable resistance genes, and to breed and promote disease-resistant varieties. Rice blast resistance plays an extremely important role in the variety approval process; most provinces and regions adopt a veto system for rice blast resistance, and varieties that do not meet the resistance standards cannot participate in subsequent trials.
[0003] Currently, more than 100 genes related to rice blast resistance have been identified, of which more than 30 have been successfully cloned, including Pib, Pi-ta, Pi54, pi21, bsr-d1, Piz-t, Pi9, and Pi50. Pigm PigmR, cloned from Gumei 4, is a gene cluster of 13 NBS-LRR-like genes located on chromosome 6. This cluster mediates broad-spectrum and strong resistance to rice blast. [The text then abruptly shifts to a different topic:] Targeting rice blast resistance genes... PigmR Researchers discovered a single nucleotide variant, A>C, at position 2503 of its coding region, and developed the KASP (Kompetitive Allele-Specific PCR) molecular marker based on this. PigmR -K. PigmR The -K marker system possesses high accuracy and efficiency, effectively assisting in rice blast resistance breeding and providing reliable technical support for genetic improvement of rice disease resistance. However, PigmR -K and similar labeling methods require specialized molecular biology knowledge, expensive equipment, and complex operational procedures to complete the detection and analysis. They also cannot be directly used for field testing, which severely limits their application. Pigm And the application of related important functional genes in rice production.
[0004] The disconnect between molecular breeding and conventional breeding severely restricts the efficiency of rice breeding. Technically, frontline breeders rely excessively on field phenotypic selection and experience-based judgment, lacking the support of molecular markers. This results in a large number of superior genes (such as blast resistance genes and salt tolerance genes) being overlooked. SKC1Favorable allelic variations are diluted or lost during backcrossing, leading to prolonged breeding cycles and low efficiency. In traditional hybridization breeding, phenotypic identification of disease-resistant genes requires multiple generations of field intercropping verification, making it susceptible to environmental fluctuations. Early screening of target genes is difficult due to a lack of molecular marker support. In terms of material innovation, creating new materials through distant hybridization typically requires over 10 years of long-term verification. Without high-throughput and low-cost auxiliary identification technologies (such as specific markers or rapid phenotypic-genotypic association tools), breeders tend to reuse existing core parents. Over time, this leads to a continuous decline in the genetic diversity of breeding materials, a narrowing of the genetic base, and difficulty in developing breakthrough parents and varieties, which seriously affects the sustainable development of the rice industry and national food security. Therefore, it is urgent to develop low-cost functional markers suitable for frontline breeding scenarios to enable direct and rapid detection of relevant functional genes in the field, improve breeding efficiency, shorten generation intervals, promote the sustainable development of the rice industry, and ensure national food security. Summary of the Invention
[0005] This invention provides a rice SNP molecular marker and its application, which is associated with rice resistance to rice blast.
[0006] In a first aspect, the present invention provides a rice SNP molecular marker, wherein the polymorphic site of the SNP molecular marker is located at 10155410 bp on rice chromosome 6 (GenBank: CP018162.1), with reference genome version number R498.Genome.version1, GCA_002151415.1, and the polymorphism of the SNP molecular marker is T or A.
[0007] The present invention further provides a rice SNP molecular marker, the SNP molecular marker comprising a nucleotide sequence as shown in SEQ ID NO.1, wherein the nucleotide sequence has a polymorphism of T or A at position 51 from the 5' end.
[0008] SEQ ID NO.1:ATGCCATCGAATACGCGCTGCTTTTAAGATATGCTAC
[0009] CCGATTCGTGCTAATTTTAGAATACGCCATCGGAACACGAATTTTCTTCGTTCCGTGCCACTCC.
[0010] Preferably, if the polymorphism of the above-mentioned SNP molecular marker corresponds to A, then it is rice resistant to rice blast.
[0011] Secondly, the present invention provides a set of LAMP primer combinations, the LAMP primer combination including upstream outer primer F3, downstream outer primer B3, upstream inner primer FIP, downstream inner primer BIP, and loop primers LF and LB, wherein the nucleic acid sequence of upstream outer primer F3 is shown in SEQ ID No. 2, the nucleic acid sequence of downstream outer primer B3 is shown in SEQ ID No. 3, the nucleic acid sequence of upstream inner primer FIP is shown in SEQ ID No. 4, the nucleic acid sequence of downstream inner primer BIP is shown in SEQ ID No. 5, the nucleic acid sequence of loop primer LF is shown in SEQ ID No. 14, and the nucleic acid sequence of LB is shown in SEQ ID No. 15.
[0012] Thirdly, the present invention provides a kit comprising the above-mentioned SNP molecular marker or LAMP primer combination.
[0013] Fourthly, the present invention provides any of the following applications of the above-described SNP molecular markers, LAMP primer combinations, or kits:
[0014] (1) Application in identifying rice varieties resistant to rice blast;
[0015] (2) Application in molecular marker-assisted breeding of rice;
[0016] (3) Identification of rice blast resistance genes Pigm Applications of genotype;
[0017] (4) Application in the cultivation of rice blast-resistant varieties;
[0018] (5) Application in improving rice germplasm resources and improving rice disease resistance.
[0019] Fifthly, the present invention provides a method for identifying rice resistant to rice blast, comprising the following steps:
[0020] Using the DNA of the rice sample to be tested as a template, LAMP amplification was performed on the DNA of the rice sample to be tested using the above-mentioned LAMP primer combination or kit; the resistance phenotype of the rice sample to be tested was determined based on the amplification results.
[0021] Preferably, the LAMP amplification reaction system described above comprises: 6.25 μl 2×HNB ISOAMP Mix, 1 μl 10 μmol / L BIP, 1 μl 10 μmol / L FIP, 0.25 μl 10 μmol / L F3, 0.25 μl 10 μmol / L B3, 0.5 μl 10 μmol / L LF, 0.5 μl 10 μmol / L LB, 0.5 μl DNA template, 2 μl ddH2O, and 0.25 μl Bst2.0 DNAPolymerase;
[0022] And / or the reaction procedure for the LAMP amplification is: react at a constant temperature of 60~65℃ for 10~60 min and then terminate the reaction.
[0023] Preferably, in the amplification results, the rice that underwent the LAMP amplification reaction is rice blast-resistant, and the rice that did not undergo the amplification reaction is not rice blast-resistant.
[0024] The amplification reaction occurred when the reaction system turned sky blue, and it did not occur when the reaction system remained violet.
[0025] Hydroxynaphthol blue (HNB) is a metal ion indicator. When it binds to magnesium ions, the initial color of the reaction system is violet. During the LAMP reaction, as DNA amplifies, magnesium ions react with precipitated pyrophosphate ions to form magnesium pyrophosphate precipitate. HNB loses magnesium ions, and the system color turns sky blue. The system that has not undergone amplification remains violet, allowing the amplification result to be determined by visually observing the color change.
[0026] Sixthly, the present invention provides a method for identifying genes that resist rice blast disease. Pigm The genotyping method involves LAMP amplification of the DNA from the rice sample using the aforementioned LAMP primer combination or kit; detection of the polymorphism of the aforementioned SNP molecular marker; if the polymorphism is A, then the rice blast resistance gene is identified. Pigm The genotype is AA, AT, or TA, and if the polymorphism is T, then the rice blast resistance gene is... Pigm The genotype is TT.
[0027] The present invention has the following beneficial effects:
[0028] The SNP molecular markers provided by this invention can effectively identify rice blast resistance genes. Pigm The genotypes of rice can be used in molecular marker-assisted selection to significantly shorten the breeding cycle of rice blast-resistant varieties, and have high application value.
[0029] Based on the aforementioned SNP molecular markers, this invention designs a LAMP primer combination containing six primers. Using this primer combination, the target sequence region can be rapidly, conveniently, and with high specificity amplified to identify genes resistant to rice blast. Pigm Rice.
[0030] The LAMP detection provided by this invention, combined with the HNB hydroxynaphthol blue colorimetric system, can determine whether amplification has occurred by whether the color is sky blue. The effect is obvious, further reducing the need for detection equipment and making it easier for grassroots personnel to use. Attached Figure Description
[0031] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0032] Figure 1 Example 2: LAMP reaction using the first set of primers to detect the presence of [unclear - possibly a specific substance or ingredient] in 8 rice varieties. Pigm The results of agarose gel electrophoresis detection of important allelic variations of genes, including M: 50bp DNA ladder, lanes 1-9: inner 5B, valley B, 02428, ZD150, ZD153, WY37, ZD152, Shuhui527, ddH2O (negative control).
[0033] Figure 2 Example 2: LAMP reaction using the second set of primers to detect the presence of [unclear - possibly a specific substance or ingredient] in 8 rice varieties. pigm The results of agarose gel electrophoresis detection of important allelic variations of genes, including M: 50bp DNA ladder, lanes 1-9: inner 5B, valley B, 02428, ZD150, ZD153, WY37, ZD152, Shuhui527, ddH2O (negative control).
[0034] Figure 3 Example 2: LAMP reaction using the third set of primers to detect the presence of [unclear - possibly a specific substance or ingredient] in eight rice varieties. Pigm The results of agarose gel electrophoresis detection of important allelic variations of genes, including M: 50bp DNA ladder, lanes 1-9: inner 5B, valley B, 02428, ZD150, ZD153, WY37, ZD152, Shuhui527, ddH2O (negative control).
[0035] Figure 4 The image shows the visualization results of the first set of primers and chromogenic reagent hydroxynaphthol blue (HNB) in Example 2. From left to right: 1: Reaction template DNA is Nei5B; 2: Reaction template DNA is Chuan Gu B; 3: Reaction template DNA is O2428; 4: Reaction template DNA is ZD150; 5: Reaction template DNA is ZD153; 6: Reaction template DNA is WY37; 7: Reaction template DNA is ZD152; 8: Reaction template DNA is Shu Hui 527; 9: Reaction template DNA was replaced with ddH2O.
[0036] Figure 5The effect of different LAMP reaction temperatures on amplification efficiency is shown. Lanes from left to right are: 1: 60℃; 2: 61℃; 3: 62℃; 4: 63℃; 5: 64℃; 6: 65℃; 7: 66℃; 8: 67℃; 9: Water; M: Marker.
[0037] Figure 6 The effect of different LAMP reaction times on amplification efficiency is shown. Lanes from left to right are: 1: reaction time 20 min; 2: reaction time 30 min; 3: reaction time 40 min; 4: reaction time 50 min; 5: reaction time 60 min; M: Marker.
[0038] Figure 7 The required reaction times for adding loop primers LF and LB during the LAMP reaction are shown in the following lanes from left to right: 1: 5 min reaction time; 2: 10 min reaction time; 3: 20 min reaction time; M: Marker. Detailed Implementation
[0039] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.
[0040] Example 1. Rice blast resistance gene Pigm Discovery of relevant SNP molecular markers
[0041] This invention uses BLAST sequence alignment analysis technology. pigm-R6 The sequence was compared and analyzed with the whole genome sequences of more than 600 published rice varieties, and differential position searches were performed. It was found that the sequence was located in... pigm-R6 A specific T / A allelic variant exists at position 10155410 bp on chromosome 6. Allelic variant A is found only in a few rice varieties, such as "Digu" and "Liuxu," thus exhibiting high specificity. Digu possesses excellent resistance to rice blast, and allelic variant A is located at the 10155410 bp position on chromosome 6. pigm-R6 On the introns, therefore allelic variation A can be used to indicate and detect origins from valleys. Pigm Genes and resistance to rice blast.
[0042] Example 2. Rice blast resistance gene Pigm Related SNP molecular marker applications
[0043] Primers were designed using the online primer design software PrimerExplorer Version 5 (http: / / primerexplorer.jp / lampv5e / index.html). After primer design, online BLAST analysis was performed. Three sets of LAMP primers (F3, B3, FIP, BIP) were designed for a 387bp region within the intron region of the pigm-R6 gene on chromosome 6 (10155203-10155589bp). These primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The sequence of the first set of primers is as follows:
[0044] F3 (SEQ ID NO.2):GAGCTGCAACCACCACTAC;
[0045] B3 (SEQ ID NO.3): CGTGTTCCGATGGCGTATT;
[0046] FI (SEQ ID NO.4): GGAGAGGTTCTGACCCAGCCTAGAGC
[0047] GTTATCCACCCTGC;
[0048] BIP (SEQ ID NO.5): GTCCCGGCCAGCGCTTGAATTTTAGCAC
[0049] GAATCGGGTAGCA.
[0050] The second set of primer sequences is as follows:
[0051] F3 (SEQ ID NO.6): CGCTGCTTTTAAGATATGC;
[0052] B3 (SEQ ID NO.7): GTGGACGACGGCGATGGC;
[0053] FI (SEQ ID NO.8)TGGCACGGAACGAAGAAAATCCG
[0054] ATTCGTGCTAA;
[0055] BIP (SEQ ID NO.9)CAGCACTGTCGTCGTCAGTCACGACGG
[0056] CGCAGCTGAAC.
[0057] The third set of primer sequences is as follows:
[0058] F3 (SEQ ID NO.10): AGCTGCAACCACCACTAC;
[0059] B3 (SEQ ID NO. 11): GTGTTCCCGATGGCGTATT;
[0060] FI (SEQ ID NO.12)AGGTTCTGACCCAGCCGGAGATCGATCGT
[0061] CTAGAGCGTTA;
[0062] BIP (SEQ ID NO.13)GTCCCGGCCAGCGCTTGAATTTAGCACG
[0063] AATCGGGTAGCA.
[0064] The universal circular primer sequence is as follows:
[0065] LF (SEQ ID NO. 14): TGCAAGTAATGGGGCAG;
[0066] LB (SEQ ID NO. 15): ATACGCGCTGCTTTTAAGA.
[0067] The LAMP reaction system was prepared using the above primers: 6.25 μl 2×HNB ISOAMP Mix, 1 μl 10 μmol / L LBIP, 1 μl 10 μmol / L FIP, 0.25 μl 10 μmol / L F3, 0.25 μl 10 μmol / L B3, 0.5 μl 10 μmol / L LF, 0.5 μl 10 μmol / L LB, 0.5 μl DNA template, 2 μl ddH2O, and 0.25 μl Bst2.0 DNA Polymerase. The reaction program was 63℃ for 10 min.
[0068] The DNA of eight rice breeding resources was detected using the LAMP reaction system and procedure described above. After the reaction, the results were observed by 3% agarose gel electrophoresis. The results of the first set of primers are as follows: Figure 1 As shown, the results of the second set of primers are as follows: Figure 2 As shown, the results of the third set of primers are as follows: Figure 3 As shown:
[0069] All rice experimental materials were provided by the Rice Research Institute of Sichuan Agricultural University. Among them, Nei5B and Chuangu B are known to contain resistance to rice blast. PigmAllelic variations, excluding 02428, ZD150, ZD153, WT37, ZD152, and Shuhui527.
[0070] Depend on Figure 1 It can be seen that, except for lane 1 (5B) and lane 2 (Kawagu B), which showed amplification, the other varieties did not show LAMP amplification, indicating that the varieties that did show amplification contain the key gene for rice resistance to rice blast. Pigm This is an important allelic variation.
[0071] Depend on Figure 2 It can be seen that although lane 1 5B contains key genes for rice resistance to rice blast, Pigm The target allelic variant was detected, but no amplification signal was found; lane 6: WT37 and lane 8: Shuhui 527 did not contain the key gene for rice blast resistance. Pigm However, all samples tested positive for amplification. These results indicate that this set of LAMP primers cannot specifically recognize the target gene. Pigm The target allelic variant exhibits nonspecific amplification, meaning its detection specificity does not meet experimental expectations.
[0072] Depend on Figure 3 It can be seen that lane 3:02428, lane 4:ZD150, and lane 6:WT37 do not contain the key gene for rice resistance to rice blast. Pigm The negative control materials all tested positive for amplification signals. These results indicate that this set of LAMP primers cannot specifically recognize the target gene. Pigm The target allelic variant exhibits nonspecific amplification, meaning its detection specificity does not meet experimental expectations.
[0073] The first set of primer reaction products that met the requirements were directly photographed for observation of the results. Figure 4 As shown:
[0074] Depend on Figure 4 It can be seen that, except for lane 1 (inner 5B) and lane 2 (valley B), which show a sky-blue color indicating amplification, the remaining lane numbers are distinctly violet, indicating no amplification. This is further verified by agarose gel electrophoresis results, indicating that lane 1 (inner 5B) and lane 2 (valley B) have amplified and contain the key gene for rice blast resistance. Pigm Allelic variations of this type; 3: 02428; 4: ZD150; 5: ZD153; 6: WT37; 7: ZD152; 8: Shuhui 527; 9: Water (blank control) showed no amplification products and did not contain the key gene for rice blast resistance. Pigm This type of allelic variation.
[0075] Example 3. Optimization Experiment of LAMP Reaction Conditions
[0076] The components were added to the LAMP reaction system, and LAMP isothermal amplification was performed under optimal reaction conditions. The amplified products were detected by colorimetric reaction using hydroxynaphthol blue (HNB). If the reactant turned sky blue, the variety contained the gene. Pigm The genotype is an allelic mutation of AT; if it is violet, it does not contain this mutation.
[0077] Reference reaction system and reaction procedure:
[0078] 6.25μl 2×HNB ISOAMP Mix, 1μl 10μmol / L BIP, 1μl 10μmol / L FIP, 0.25μl 10μmol / L F3, 0.25μl 10μmol / L B3, 0.5μl 10μmol / L LF, 0.5μl 10μmol / L LB, 0.5μl DNA template, 2μl ddH2O, and 0.25μl Bst2.0 DNA Polymerase.
[0079] 3.1 Effect of different reaction temperatures on LAMP amplification efficiency:
[0080] The reaction temperature X was sequentially set to 60℃, 61℃, 62℃, 63℃, 64℃, 65℃, 66℃, and 67℃ for LAMP reactions to determine the optimal reaction temperature. The results are shown in [Figure number missing]. Figure 5 .
[0081] The LAMP reaction ultimately synthesizes stem-loop DNA of various sizes, and the amplification products appear as typical ladder-like bands on a 3% agarose gel. The fluorescent dye SYBR Green I (Solebio Technology Co., Ltd., Beijing) binds to the DNA and emits fluorescence under ultraviolet light. The fluorescence intensity is directly proportional to the amount of DNA amplified, which is used to detect the LAMP reaction products.
[0082] Depend on Figure 5 It can be seen that amplification can occur at various temperatures from 60℃ to 67℃, and the amplification efficiency is better at reaction temperatures from 60℃ to 63℃. The amplification efficiency is low at reaction temperatures of 64℃ and 67℃. Therefore, 63℃ is selected as the appropriate reaction temperature.
[0083] 3.2 Effect of different reaction times on LAMP amplification efficiency:
[0084] The LAMP reaction was conducted at five time points: 20 min, 30 min, 40 min, 50 min, and 60 min, to determine the optimal reaction time. The results are shown in [Figure number missing]. Figure 6 .
[0085] Depend on Figure 6It can be seen that no specific bands appeared at a reaction time of 20 min, while specific bands were produced at 30 min, 40 min, 50 min and 60 min. The band at 60 min was clear. Therefore, 60 min was selected as the optimal reaction time.
[0086] Depend on Figure 7 It can be seen that when the loop primers LF and LP are added to the LAMP reaction system, specific bands are generated within 10 minutes. Therefore, 10 minutes is the shortest time for adding loop primers to the LAMP reaction.
[0087] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. The application of primer sets for detecting rice SNP molecular markers in the identification of rice blast-resistant varieties, characterized in that, The polymorphic site of the SNP molecular marker is located at 10155410 bp on chromosome 6 of rice. The polymorphism of the SNP molecular marker is T or A. Referring to the genome version number R498.Genome.version1, if the polymorphism of the SNP molecular marker corresponds to A, then it is rice resistant to rice blast.
2. The application of a set of LAMP primer combinations or a kit containing such primer combinations, characterized in that, The LAMP primer combination includes upstream outer primer F3, downstream outer primer B3, upstream inner primer FIP, downstream inner primer BIP, and loop primers LF and LB. The nucleic acid sequence of upstream outer primer F3 is shown in SEQ ID No. 2, the nucleic acid sequence of downstream outer primer B3 is shown in SEQ ID No. 3, the nucleic acid sequence of upstream inner primer FIP is shown in SEQ ID No. 4, the nucleic acid sequence of downstream inner primer BIP is shown in SEQ ID No. 5, the nucleic acid sequence of loop primer LF is shown in SEQ ID No. 14, and the nucleic acid sequence of LB is shown in SEQ ID No.
15. The application is any one of the following: (1) Application in identifying rice varieties resistant to rice blast; (2) Application in the cultivation of rice blast-resistant rice.
3. A method for identifying rice resistant to rice blast, characterized in that, Includes the following steps: Using the DNA of the rice sample to be tested as a template, LAMP amplification of the DNA of the rice sample to be tested is performed using the LAMP primer combination described in claim 2 or a kit containing the primer combination. The rice blast resistance phenotype of the tested rice samples was determined based on the amplification results; In the amplification results, rice that underwent LAMP amplification was resistant to rice blast, while rice that did not undergo amplification was not resistant to rice blast. The amplification reaction occurred when the reaction system turned sky blue, and it did not occur when the reaction system remained violet.
Citation Information
Patent Citations
Device for spreading fragment at rear part of lorry tilting body
CN1408955A
Clone and molecular markers of rice broad-spectrum blast-resistance genes
CN102633870A