Nucleic acid combination product, kit and method for detecting a plurality of respiratory pathogens

Abstract

The application discloses a nucleic acid combination product, a kit and a method for detecting multiple respiratory tract pathogenic bacteria. The nucleic acid combination product comprises a primer pair and a probe, wherein the sequences of the primer pair are respectively shown as SEQ ID NO:1-SEQ ID NO:24. The nucleic acid combination product realizes the synchronous detection of multiple pathogenic bacteria through one-tube eight-color fluorescence PCR, freeze-drying and ultrasonic direct extension technology, significantly reduces the experimental operation steps, shortens the detection time, reduces the complexity of result interpretation, and has strong anti-interference ability and high sensitivity.

Description

Technical Field

[0001] This application relates to the field of biodetection technology, specifically to nucleic acid combination products, kits, and methods for detecting various respiratory pathogens. Background Technology

[0002] Respiratory infections pose a significant challenge to global public health. According to the World Health Organization (WHO), lower respiratory tract infections are among the deadliest infectious diseases worldwide. These infections can be caused by various pathogens, including bacteria, viruses, and fungi, with bacterial lower respiratory tract infections being particularly noteworthy. Eight bacteria—Legionella pneumophila (LP), Escherichia coli (E. coli), Enterobacter cloacae (EC), Serratia marcescens (SMar), Klebsiella pneumoniae (KO) / Klebsiella pneumoniae (KA), Burkholderia cepacia (BC), and Stenotrophomonas maltophilia (SMA)—are commonly found in lower respiratory tract infections and pose a significant threat to patient health. Therefore, a rapid, efficient, and low-cost detection method for multiple respiratory pathogens is crucial for clinical applications.

[0003] Currently, detection methods for various respiratory pathogens have been developed to some extent. For example, CN107937578A discloses a primer-probe combination for the combined detection of 15 respiratory pathogens, including Klebsiella pneumoniae, Haemophilus influenzae, Streptococcus pyogenes, Staphylococcus aureus, Escherichia coli, Chlamydia pneumoniae, Mycobacterium tuberculosis, Stenotrophomonas maltophilia, Acinetobacter baumannii, Mycoplasma pneumoniae, Enterococcus faecalis, Legionella pneumophila, Streptococcus pneumoniae, Pseudomonas aeruginosa, and Mycobacterium abscessus. Although this method can detect 15 pathogens, its limitation is that a single system can only detect 4 respiratory pathogens, and it cannot detect combinations of more than 4 pathogens in one tube. In addition, CN120272616A discloses a probe set for detecting respiratory tract infection pathogens, wherein the pathogens include Haemophilus influenzae, Stenotrophomonas maltophilia, Enterobacter cloacae, Streptococcus pyogenes, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Escherichia coli, Pseudomonas aeruginosa, Streptococcus pneumoniae, Haemophilus parainfluenzae, Moraxella catarrhalis, Burkholderia cepacia, Klebsiella acidogenic, Klebsiella pneumoniae, and others. The detection targets include: *Citrobacter lauridis*, *Serratia marcescens*, *Proteus mirabilis*, Mycobacterium tuberculosis complex, *Mycobacterium avium*, *Mycobacterium intracellulare*, *Legionella pneumophila*, and *Listeria monocytogenes*; *Aspergillus fumigatus*, *Candida albicans*, *Cryptococcus neoformans*, and *Candida auris*; influenza A virus, influenza B virus, respiratory syncytial virus, parainfluenza virus, adenovirus, rhinovirus, various coronaviruses, human metapneumovirus, bocavirus, *Mycoplasma pneumoniae*, *Chlamydia pneumoniae*, and *Chlamydia psittaci*. Although this method can detect a variety of common pathogens, it does not employ multiplex fluorescent PCR but rather complex high-throughput sequencing.

[0004] Furthermore, traditional multiplex fluorescent PCR detection methods have poor resistance to interference from meropenem, imipenem, cefoperazone / sulbactam, moxifloxacin, amikacin, linezolid, vancomycin, sodium chloride, anhydrous ethanol, EDTA, human whole blood, purified mucin, and heme in the detection of respiratory pathogens. They also exhibit cross-reactivity with other common pathogens exhibiting similar infection symptoms, including Neisseria meningitidis, Aspergillus flavus, Aspergillus terreus, Candida glabrata, and Candida tropicalis. Summary of the Invention

[0005] Therefore, it is necessary to provide nucleic acid combination products, kits, and methods for detecting a variety of respiratory pathogens.

[0006] The first aspect of this application provides a nucleic acid combination product for detecting multiple respiratory pathogens, comprising the following primer and probe set:

[0007] Primer and probe set 1: The nucleotide sequences are shown in SEQ ID NO: 1~3 for the primer pairs and probes for detecting Burkholderia cepacia;

[0008] Primer and probe set 2: The nucleotide sequences are shown in SEQ ID NO: 4~6 for the primer pairs and probes for detecting Enterobacter cloacae;

[0009] Primer and probe set 3: The nucleotide sequences are shown in SEQ ID NO: 7~9 for the primer pairs and probes for detecting Klebsiella acidogenic bacteria;

[0010] Primer and probe set 4: nucleotide sequences of primer pairs and probes for detecting Klebsiella pneumoniae, as shown in SEQ ID NO: 10-12;

[0011] Primer and probe set 5: nucleotide sequences are shown in SEQ ID NO: 13~15 for primer pairs and probes for detecting Stenotrophomonas maltophilia;

[0012] Primer and probe set 6: nucleotide sequences are shown in SEQ ID NO: 16~18 for primer pairs and probes for detecting Serratia marcescens;

[0013] Primer and probe set 7: The nucleotide sequences are shown in SEQ ID NO: 19-21 for the primer pairs and probes used to detect positive Legionella pneumophila; and,

[0014] Primer and probe set 8: nucleotide sequences of primer pairs and probes for detecting Escherichia coli as shown in SEQ ID NO: 22~24.

[0015] In some embodiments, primer pairs and probes with nucleotide sequences as shown in SEQ ID NO: 25-27 are also included.

[0016] In some embodiments, the 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group.

[0017] In some embodiments, the fluorescent group includes one or more of FAM, HEX, ROX, CY5, QUSAR705, ATTO425, CY7, and AF405;

[0018] In some embodiments, the quenching group includes one or more of BHQ1, BHQ2, and TAMRA.

[0019] A second aspect of this application provides a kit for detecting multiple respiratory pathogens, comprising the nucleic acid combination product described in the first aspect of this application.

[0020] In some implementations, one or more of nucleic acid extraction reagents and PCR amplification reagents are also included.

[0021] In some embodiments, the PCR amplification reagents include PCR buffer, DNA polymerase, UDG enzyme, dNTPs, dUTPs, and Mg. 2+ One or more of them.

[0022] In some embodiments, the kit further includes a lyophilization protectant, and the nucleic acid combination product and the PCR amplification reagent are packaged in the form of lyophilized reagents.

[0023] In some implementations, one or more of positive and negative control samples are also included.

[0024] A third aspect of this application provides a lyophilized PCR premix, comprising the nucleic acid product, lyophilization protectant, and PCR amplification reagent described in the first aspect of this application, wherein the PCR amplification reagent comprises PCR buffer, DNA polymerase, UDG enzyme, dNTPs, dUTPs, and Mg. 2+ One or more of them.

[0025] The fourth aspect of this application provides a method for nucleic acid amplification for non-diagnostic purposes, comprising the following steps:

[0026] The sample to be tested was mixed with liquefied sputum and subjected to ultrasonic treatment to obtain a nucleic acid solution; and

[0027] The nucleic acid solution was mixed with PCR amplification solution for amplification.

[0028] The sample to be tested includes sputum, and the PCR amplification solution includes the nucleic acid combination product described in the first aspect of this application.

[0029] In some embodiments, the conditions for the ultrasonic treatment include: an ultrasonic frequency of 10kHz to 80kHz and an ultrasonic time of 100s to 150s.

[0030] The fifth aspect of this application provides a method for detecting various respiratory pathogens for non-diagnostic purposes. The method includes performing the following operations in a closed reaction tube: pretreating the sample to be tested in sputum liquefaction solution, and quantitatively mixing the resulting pretreatment product with a lyophilized PCR premix as defined in the third aspect of this application or a nucleic acid combination product as described in the first aspect of this application to achieve nucleic acid detection of the sample to be tested.

[0031] In some implementations, one or more of the following conditions are met:

[0032] (1) In the mixed reaction system, the working concentration of each primer is 200 nM to 400 nM, and the working concentration of each probe is 100 nM to 200 nM;

[0033] (2) The amplification program for the mixed reaction includes: 50℃ UDG enzyme digestion for 2 min to 4 min; 95℃ pre-denaturation for 30 s to 60 s; 95℃ denaturation for 1 s to 3 s; 61℃ annealing, extension and fluorescence detection for 7 s to 9 s; 41 cycles.

[0034] (3) The sample to be tested includes sputum;

[0035] (4) The pretreatment includes ultrasonic treatment, and the conditions of the ultrasonic treatment include: ultrasonic frequency of 10kHz to 80kHz and ultrasonic time of 100s to 150s.

[0036] This application's implementation method designs specific primers and probes for the conserved regions of eight respiratory pathogens. Using one-tube eight-color fluorescent PCR, lyophilization, and ultrasonic direct amplification techniques, it achieves simultaneous detection of multiple pathogens. It exhibits strong resistance to interference from meropenem, imipenem, cefoperazone / sulbactam, moxifloxacin, amikacin, linezolid, vancomycin, sodium chloride, anhydrous ethanol, EDTA, human whole blood, purified mucin, and heme. Furthermore, it does not exhibit cross-reactivity with other common pathogens with similar infection symptoms, including Neisseria meningitidis, Aspergillus flavus, Aspergillus terreus, Candida glabrata, and Candida tropicalis. Attached Figure Description

[0037] To more clearly illustrate the technical solutions in the embodiments and examples of this application, and to more completely understand this application and its beneficial effects, the accompanying drawings used in the description of the embodiments or examples will be briefly introduced below. Obviously, the drawings described below are merely some embodiments of this application. Those skilled in the art can obtain other drawings based on these drawings without any creative effort.

[0038] Figure 1 The results are from the ultrasonic direct amplification method used in Example 3 of this application.

[0039] Figure 2 The detection results are obtained using the magnetic bead method in Example 3 of this application;

[0040] Figure 3 This refers to the sensitivity detection results in Example 4 of this application;

[0041] Figure 4 The results are for the detection using ultrasonic direct amplification with other primers and probes in Comparative Example 1 of this application. Detailed Implementation

[0042] To facilitate understanding of this application, a more complete description will be provided below with reference to the accompanying drawings. Preferred embodiments of this application are shown in the drawings. However, this application can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of this application.

[0043] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0044] In this application, terms such as "preferred," "better," "more suitable," and "ideal" are merely used to describe implementation methods or embodiments that achieve better results, and should be understood not to limit the scope of protection of this application.

[0045] The terms “having,” “containing,” “comprising,” and “including” as used in this application are synonyms and are inclusive or open-ended, not excluding additional, uncited members or features. Members or features include, for example, materials or components, structures, elements, instruments, etc.; non-limiting examples of members or features include actions, conditions under which actions occur, timing, states, etc.

[0046] In this application, the technical features or solutions described in open-ended language include both closed-ended technical features or solutions consisting of the listed contents and open-ended technical features or solutions that include the listed contents.

[0047] In this application, if the unit of a data range is only followed by the right endpoint, it means that the units of the left and right endpoints are the same.

[0048] In this application, where the method flow involves multiple steps, unless otherwise explicitly stated herein, there is no strict order restriction on the execution of these steps; they can be executed in any order other than those described. Moreover, any step may include multiple sub-steps or multiple stages, which are not necessarily completed at the same time, but can be executed at different times, and their execution order is not necessarily sequential, but can be performed alternately or simultaneously with other steps or parts of the sub-steps or stages of other steps.

[0049] In this application, the exemplary descriptions such as "in some implementations (or embodiments)" and "in one implementation (or embodiment)" may cover, but are not limited to, the following meanings: these solutions can be combined with other solutions in a suitable manner to form new technical solutions.

[0050] In this application, the terms "first aspect," "second aspect," "third aspect," etc., are used for descriptive purposes only and should not be construed as indicating or implying relative importance or quantity, nor should they be construed as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first," "second," "third," etc., serve only as a non-exhaustive enumeration and should be understood not to constitute a closed limitation on quantity.

[0051] In this application, when numerical intervals (i.e., numerical ranges) are involved, unless otherwise specified, the distribution of selectable numerical values ​​within the numerical interval is considered continuous, and includes the two endpoints of the numerical interval (i.e., the minimum and maximum values), as well as every numerical value between these two endpoints. Unless otherwise specified, when a numerical interval refers only to integers within that numerical interval, it includes the two endpoint integers of the numerical range, as well as every integer between the two endpoints, which is equivalent to directly listing every integer. When multiple numerical ranges are provided to describe features or characteristics, these numerical ranges can be merged. In other words, unless otherwise specified, the numerical ranges disclosed herein should be understood to include any and all subranges included therein. The "numerical value" in the numerical interval can be any quantitative value, such as a number, percentage, ratio, etc. The term "numerical interval" can be broadly included to include numerical interval types such as percentage intervals, ratio intervals, and proportion intervals.

[0052] Unless otherwise specified, the temperature parameters in this application are permitted to be either constant-temperature treatment or variations within a certain temperature range. It should be understood that the constant-temperature treatment allows temperature fluctuations within the precision range of the instrument control, such as ±5℃, ±4℃, ±3℃, ±2℃, or ±1℃.

[0053] The field of respiratory pathogen diagnostics is undergoing rapid technological change, exhibiting several clear development trends, with the iterative upgrade of multiplex detection technologies becoming the most significant development theme. Traditional single-channel, single-target detection methods can no longer meet clinical needs, and the industry is rapidly moving towards high-throughput, multi-target testing. This epidemiological characteristic has spurred market demand for efficient tools capable of simultaneously detecting multiple pathogens. Currently, technological evolution follows two paths: one is the optimization of PCR-based technologies, such as single-channel multi-target fluorescent PCR; the other is the application of emerging sequencing technologies, such as targeted next-generation sequencing (tNGS). However, considering operational complexity, cost-effectiveness, and clinical acceptance, multiplex fluorescent PCR-based detection schemes will remain the mainstream choice for medical institutions in the next 5-10 years, especially optimized systems capable of simultaneously detecting 8-12 targets, which have a vast market potential.

[0054] Respiratory multiplex PCR detection technology involves adding specific primers and probes targeting multiple pathogens to a single reaction tube, enabling simultaneous detection of multiple pathogens. It primarily relies on TaqMan probes labeled with fluorescent reporter groups (FAM, HEX, ROX, CY5, QUSAR705, ATTO425, CY7, AF405, etc.) at the 5' end and fluorescent quencher groups (BHQ1, BHQ2, etc.) at the 3' end. When the probe is intact, fluorescence is quenched due to the FRET effect; during PCR amplification, Taq enzymes exert their 5'→3' exonuclease activity, hydrolyzing the probe and releasing the fluorescent signal, thus achieving simultaneous detection of multiple targets in a single amplification.

[0055] Nucleic acid detection technology for multiplex respiratory bacteria is in a phase of rapid development. Based on current technological bottlenecks and clinical needs, future technological evolution will include single-tube multiplex detection, reagent lyophilization, and reagent-compatible direct amplification methods.

[0056] In multi-pathogen nucleic acid co-detection technologies, the reaction system contains a large number of primers and probes, which are prone to dimerization or non-specific binding, leading to non-specific amplification. Although this can be predicted and mitigated to some extent during the design phase, the design difficulty increases significantly under the practical conditions of multiplex detection. The core challenge lies in ensuring the conservation of primer and probe sequences to guarantee detection accuracy while minimizing their mutual interference. This design difficulty often manifests in practical applications as incomplete amplification curves, low amplification efficiency, poor repeatability, and missed detection of some targets, severely impacting the overall detection effect and reliability.

[0057] Based on this, embodiments of this application provide at least nucleic acid combination products, kits, and methods for detecting a variety of respiratory pathogens.

[0058] In this application, the term "direct amplification" refers to the nucleic acid release and direct amplification technology without sample extraction, which means that the nucleic acid of the sample is directly amplified and detected without the need for nucleic acid extraction or purification.

[0059] In a first aspect of this application, a nucleic acid combination product for detecting a variety of respiratory pathogens is provided, comprising primer pairs and probes with nucleotide sequences as shown in SEQ ID NO: 1-24, respectively.

[0060] In some implementations, the following primer-probe set is included:

[0061] Primer and probe set 1: The nucleotide sequences are shown in SEQ ID NO: 1~3 for the primer pairs and probes for detecting Burkholderia cepacia;

[0062] Primer and probe set 2: The nucleotide sequences are shown in SEQ ID NO: 4~6 for the primer pairs and probes for detecting Enterobacter cloacae;

[0063] Primer and probe set 3: The nucleotide sequences are shown in SEQ ID NO: 7~9 for the primer pairs and probes for detecting Klebsiella acidogenic bacteria;

[0064] Primer and probe set 4: nucleotide sequences of primer pairs and probes for detecting Klebsiella pneumoniae, as shown in SEQ ID NO: 10-12;

[0065] Primer and probe set 5: nucleotide sequences are shown in SEQ ID NO: 13~15 for primer pairs and probes for detecting Stenotrophomonas maltophilia;

[0066] Primer and probe set 6: nucleotide sequences are shown in SEQ ID NO: 16~18 for primer pairs and probes for detecting Serratia marcescens;

[0067] Primer and probe set 7: The nucleotide sequences are shown in SEQ ID NO: 19-21 for the primer pairs and probes used to detect positive Legionella pneumophila; and,

[0068] Primer and probe set 8: nucleotide sequences of primer pairs and probes for detecting Escherichia coli as shown in SEQ ID NO: 22~24.

[0069] In some embodiments, primer pairs and probes for detecting internal standards are also included, with nucleotide sequences shown in SEQ ID NO: 25-27, respectively.

[0070] In some embodiments, the 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group. Exemplarily, all of the above probes use dual quenching groups to enhance the quenching effect and improve detection sensitivity and signal-to-noise ratio.

[0071] In some embodiments, the fluorescent group includes one or more of FAM, HEX, ROX, CY5, QUSAR705, ATTO425, CY7 and AF405.

[0072] In some embodiments, the quenching group includes one or more of BHQ1, BHQ2, and TAMRA.

[0073] It should be noted that in the embodiments of this application, both Klebsiella acidogenic (KO) and Klebsiella gasogenic (KA) probes are synthesized into ROX channels without distinction, thereby enabling the simultaneous detection of 8 respiratory pathogens in one tube.

[0074] In a second aspect of this application, a kit for detecting multiple respiratory pathogens is provided, comprising the aforementioned nucleic acid combination product.

[0075] In some implementations, the kit also includes one or more of nucleic acid extraction reagents and PCR amplification reagents.

[0076] In some embodiments, the PCR amplification reagents include PCR buffer, DNA polymerase, UDG enzyme, dNTPs, dUTPs, and Mg. 2+ One or more of them.

[0077] In some embodiments, the kit also includes a lyophilization protectant, and the nucleic acid combination product and PCR amplification reagent are packaged in lyophilized form. It should be noted that the lyophilization protectant can be a conventional lyophilization protectant in the art, including trehalose, mannitol, BSA, Tris-HCl, sterile purified water, etc.

[0078] In some implementations, the kit also includes one or more positive and negative controls.

[0079] In a third aspect of this application, a lyophilized PCR premix is ​​provided, comprising the aforementioned nucleic acid product, lyophilization protectant, and PCR amplification reagents, wherein the PCR amplification reagents include PCR buffer, DNA polymerase, UDG enzyme, dNTPs, dUTPs, and Mg. 2+ One or more of them.

[0080] In a fourth aspect of this application, a nucleic acid amplification method is provided, comprising the following steps:

[0081] S100: The sample to be tested is mixed with sputum liquefaction solution and subjected to ultrasonic treatment to obtain a nucleic acid solution; and

[0082] S200: Mix the nucleic acid solution with the PCR amplification solution for amplification;

[0083] The samples to be tested include sputum, and the PCR amplification solution includes the aforementioned nucleic acid combination product.

[0084] In some embodiments, the conditions for ultrasonic treatment include: an ultrasonic frequency of 10 kHz to 80 kHz and an ultrasonic time of 100 s to 150 s. Non-limitingly, the ultrasonic frequency can be, but is not limited to, 10 kHz, 20 kHz, 30 kHz, 40 kHz, 50 kHz, 60 kHz, 70 kHz, 80 kHz, or any value or range between two of the above values; the ultrasonic time can be, but is not limited to, 100 s, 110 s, 120 s, 130 s, 140 s, 150 s, or any value or range between two of the above values.

[0085] In this application, the nucleic acid amplification method provided above does not require nucleic acid purification. The method uses ultrasonic treatment of the sample, and all operations can be completed and amplification can be performed directly in the PCR reaction tube. The operation is simple and time-saving.

[0086] In a fifth aspect of this application, a method for detecting multiple respiratory pathogens is provided, comprising the following operations in a closed reaction tube: placing the sample to be tested in sputum liquefaction solution for pretreatment, and quantitatively mixing the resulting pretreatment product with the lyophilized PCR premix defined above to achieve nucleic acid detection of the sample to be tested.

[0087] In some implementations, the methods described above for detecting multiple pathogens are not for diagnostic purposes. It is understood that they can be used for public health and food safety monitoring, as well as animal and plant quarantine and healthy aquaculture.

[0088] In some implementations, the above-described methods for detecting multiple pathogens are for diagnostic purposes.

[0089] In some implementations, the sample to be tested includes sputum.

[0090] In some embodiments, the pretreatment includes ultrasonic treatment, and the conditions for ultrasonic treatment include: ultrasonic frequency of 10kHz to 80kHz and ultrasonic time of 100s to 150s.

[0091] In some embodiments, in the mixed reaction system, the working concentration of each primer is 200 nM to 400 nM, and the working concentration of each probe is 100 nM to 200 nM. Non-limitingly, the working concentration of each primer can be, but is not limited to, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, or any value or range between two of the above values; the working concentration of each probe can be, but is not limited to, 100 nM, 150 nM, 200 nM, or any value or range between two of the above values.

[0092] In this application, "working concentration" refers to the actual effective concentration of the indicator or probe in the total reaction system of quantitative real-time PCR.

[0093] In some embodiments, the amplification program for the mixed reaction includes: UDG enzyme digestion at 50°C for 2-4 minutes; pre-denaturation at 95°C for 30-60 seconds; denaturation at 95°C for 1-3 seconds; annealing, extension, and fluorescence detection at 61°C for 7-9 seconds; 41 cycles. Some examples are provided below.

[0094] The embodiments of this application will be described in detail below with reference to examples. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of this application. For experimental methods in the following embodiments where conditions are not specified, reference should be made to the guidelines given in this application, or to experimental manuals or conventional conditions in the art, or to the conditions recommended by the manufacturer, or to experimental methods known in the art.

[0095] In the following examples, the measurement parameters of the raw material components may have slight deviations within the weighing accuracy range unless otherwise specified. Temperature and time parameters are subject to acceptable deviations due to instrument testing accuracy or operational precision.

[0096] Unless otherwise specified, all test materials used in the following examples are commercially available products.

[0097] Example 1 Primer and probe design

[0098] This application designs specific primers and probes for the conserved regions of eight respiratory pathogens, as well as primers and probes for the RNaseP gene. It adopts one-tube eight-color fluorescent PCR technology + PCR reagent lyophilization + direct amplification technology to realize the simultaneous detection of eight respiratory pathogens in one tube, which greatly shortens the detection time.

[0099] 1) Gene Sequence Alignment: Gene sequences (fasta format files) of *Legionella pneumophila* (LP), *Escherichia coli* (E. coli), *Enterobacter cloacae* (EC), *Serratia marcescens* (SMar), *Klebsiella pneumoniae* (KO) / *Klebsiella oxytocinata* (KA), *Burkholderia cepacia* (BC), and *Stenotrophomonas maltophilia* (SMA) were downloaded from the NCBI nucleic acid database (https: / / www.ncbi.nlm.nih.gov / ). Online gene sequence alignment was performed using MAFFT version 7 (https: / / mafft.cbrc.jp / ) to identify conserved regions for each bacterial target, which were then used for subsequent primer and probe design. This application identified the following conserved sequences for each bacterium using the above method:

[0100] The conserved regions of Legionella pneumophila are as follows:

[0101] AGTACCGAAAAAACTGGTAAGCCAGCAACTTTTCAGGTTTCACAAGTTATCCCAGGATGGACAGAAGCTTTGCAATTGATGCCAGCTGGATCAACTTGGGAAATTTATGTTCCCTCAGGTCTTGCATAT GGCCCACGTAGCGTTGGCGGACCTATTGGCCCAAATGAAACTTTAATATTTAAAATTCACTTAATTTCAGTGAAAAAAATCATCTTAAGTTTTTTGAATTAAAGTCATACAAAACGCATCCCTCT (SEQ ID NO: 28)

[0102] The conserved regions of Escherichia coli are as follows:

[0103] GTAGAGCATTACGCTGCGATGGATCCCGGCATAGTTAAAGAAATCATGGAAGTAAGACTGCTTTTTCTTGCCGTTTTCGTCGGTAATCACCATTCCCGGCGGGATAGTCTGCCAGTTCAGTTCGTTGTTCAC ACAAACGGTGATACGTACACTTTTCCCGGCAATAACATACGGCGTGACATCGGCTTCAAATGGCGTATAGCCGCCCTGATGCTCCATCACTTCCTGATTATTGACCCACACTTTGCCGTAATGAGTGA (SEQ ID NO: 29)

[0104] The conserved regions of Enterobacter cloacae are as follows:

[0105] AGCTGAATGTTTCACCGCTCTCTTCCTGCAGCGGCAGGGCGTCGATATCAGCACGCAGTGCCCACATCGGGCCGGGTTTTTCACCCTGTAATACCGCCACCACGCTGTTCTCCAGCGGGCGGCTAATCGTCAGCTCCGGCAGATTCGCCAGTTCACGGGCGATAAAATCTGCGGTCGGCTTTTCCTGAAATGAGAGATCCGGGTTGGCATGAATATGCCTGCGCCAGCGGATCACCTCGTCGTGAACGTCGCGGATAAGGTTTTCAGTGCTACTTTTCATGACAGTCTCCTTCAGTCAGTCACCGGCAGTGAGGGCGCAGGTTTTTTTATCAGTGGCACTATCGCCACGC (SEQ ID NO: 30)

[0106] The conserved region of Serratia marcescens is as follows:

[0107] ATGCCATTGCTGGATAGCTTTACCGTCGATCATACCCGTATGGCAGCCCCGGCTGTCCGCGTTGCGAAAACCATGAAAACGCCTCATGGCGATACCATCACGGTATTTGATCTGCGCTTTTGCCGCCCGAACCTGGAAGTGATGCCCGAACGCGGCATTCACACGCTGGAACACCTGTTCGCCGGCTTTATGCGCGACCC (SEQ ID NO: 31)

[0108] The conserved region of Klebsiella oxytoca is as follows:

[0109] AGCTTGCTTATAGTTTGCATGAATTCTGGTTTCAGTTTTCATATCGCTATCGGGATCGCCATACACAAAGTGAACTCTTTCTCCATTCAACACGTAATGTGGCTAAACATGCACACGCTTTTGCTAGAATCTACCGGTGACAACTGCTTAAGTTTTATCACAGCGTATCCTGATTTTTCCCCTTCATGACATGAATAGACCGTGCGCAGGTAAACTGACCTTAACGATCTGGTGAACTAACGTAATGAAATTAAAGAATAAATTACTTCGTCATTTGATTTCGGCTGGGGTAGTGGTCCTGACCTCTTCATTCCTGGTCTATGAGTTAGTCGTCAGCCATCGGGATATGTCGGAATATATGCACTATATTGTCGAAAAAGGCGAGTACGCTTTTCTCTACGATAAATATCAAAATCAGCT (SEQ ID NO: 32)

[0110] The conserved regions of Klebsiella pneumoniae are as follows:

[0111] ATGGGCACCTTTCTGACCTTTTTCACAGCTCTGCTACTCTGTGTCTTGCTTATCGGGTGGTGGTATCGATCTCATGCCAGACGTCGTCGCCTCCCCTTACTGCAAGCCTTTAGCGACGCGACGACCCGCAAGCTTTCTGATGATGAACGCCAGGCGGTCGAAAAGTATCTCGATGGCCTCAGCCAGTCGCAACAGGTACCGGCGACCGGCGCCAGCGTCGCGCCTGTCGCCCTGAAACTGAATGAGCAGAGCGACACCGTTTATACCATCACCCGCGCCGTCACCCGCTATGGCATTTCGTCTGATGAGCCCAACAAATGGCGATACTTCCTCGACTCGGTGGAGGTTCA (SEQ ID NO: 33)

[0112] The conserved regions of Burkholderia cepacia are as follows:

[0113] GGCCAGCGTCAGCAGCGCAGTCGTACGCGCAGCCGCTAAACACATATTGGCGCACGGCGGCACAAAGCCGCCGGCGTGCCGGCCCGATCGGCATCCCGCCGATTTTTGCCGGCACGGCGTATTGCGCCGATGGCTTTCGACTATATATAGGTCGCGTGCCGCTGCGTCGCAGCCGGCATGACCGATCTCCGGCCTGGCAGGATGGTGCCGGCTGATCGGATAACCCGATTTCGCATTTTTGGGTCGGTAAAGGCCACGTGAGGACGTTTCCACGGCTACCGCGCCGCGAATCGAGAGGTACCTCACCCGGCAATCGCGCGCTTTATGCGCATAAACCAACCGACGTACGACGCAACCGCCTCCCCGCCCCCTTTCCGGTCAGAAACGCCCATCGTATTGATCCGGCGTACGGCACCTCGATCCGTCATCCCGTGACAGAAAGAAAACAGGCTCACCTTTATGCGCATAAACACATCAACGCAACGCCGTGAAGCACATCCCGAACAGCACTCCC (SEQ ID NO:34)

[0114] The conserved regions of Stenotrophomonas maltophilia are as follows:

[0115] GGATGGCGAAGTGGTCACGGTGGGCGGCATCGCATTCACCGCGCACTTCATGCCAGGGCACACCCCGGGCAGCACCGCCTGGACCTGGACCGACACCCGCGATGGCAAGCCGGTGCGCATCGCCTACGCCGACAGCCTGAGTGCACCGGGTTACCAGCTGAAGGGCAATCCCCGTTATCCGCGCCTGATCGAGGACTACAAGCGCAGCTTCGCAACGGTACGGGCGCTGCCCTGCGATCTGCTGCTCACCCCGCATCCGGGCGCCAGCAACTGGAACTATGCCGCCGGCAGCAAGGCCAGCGCCGAGGCACTGACCTGCAACGCCTACGCGGATGCGGCCGAGAAGAAGTTCGACGCGCAGTTGGCCAGGGAAACGGCCGGGACCCGCTGA (SEQ ID NO: 35)

[0116] The Rnase P gene sequence is as follows:

[0117] GAATTCGGCACGAGGTGGGACTTCAGCATGGCGGTGTTTGCAGATTTGGACCTGCGAGCGGGTTCTGACCTGAAGGCTCTGCGCGGACTTGTGGAGACAGCCGCTCACCTTGGCTATTCAGTTGTTGCTATCAATCATATCGTTGACTTTAAGGAAAAGAAACAGGAAATTGAAAAACCAGTAGCTGTTTCTGAACTCTTCACAACTTTGCCAATTGTACAGGGAAAATCAAGACCAATTAAAATTTTAACTAGATTAACAATTATTGTC (SEQ ID NO: 36)

[0118] 2) Primer and probe design: Primers and probes were designed according to primer and probe design principles, and primer specificity analysis was performed. High-performing primers and probes were manually selected as target primers and probes. Simultaneously, following the same procedure, primers and probes for the human housekeeping gene RNase P were designed as internal standard primers and probes. The 5' end of the probe was labeled with a fluorescent reporter group (FAM, HEX, ROX, CY5, QUSAR705, ATTO425, CY7, AF405), and the 3' end was labeled with a non-fluorescent double-quencher group to reduce background interference. The designed primers and probes are shown in Table 1 below. The fluorescent reporter group for BC-P is FAM; for EC-P, it is VIC; for KO-P / KA-P, it is ROX; for SMA-P, it is CY5; for SMar-P, it is QUASAR705; for LP-P, it is ATTO425; for E. coli-P, it is CY7; and for IC-P, it is AF405. All probes use double-quenched groups.

[0119] Table 1

[0120]

[0121] Example 2 Detection Method

[0122] Based on real-time PCR technology, a common reaction system typically contains at least the following components: PCR buffer, Taq polymerase, UDG enzyme, dNTPs, dUTPs, primer-probe mix, and Mg2+ required for catalyzing DNA polymerase. 2+ Since the reagents used in this application are lyophilized, the PCR reaction system also contains a lyophilization protectant. All the above raw materials were purchased from Hunan Kangde Biotechnology Co., Ltd. PCR buffer: 2.5 μL–5 μL; Taq enzyme: 5 U–20 U; UDG enzyme: 0.1 U–1 U; dNTPs: 50 μM–400 μM; each target primer and probe: 0.1 μM–1 μM. The primer and probe combination mixture of this application was tested using orthogonal experiments to obtain the final optimal scheme (see Table 2 below).

[0123] Table 2

[0124]

[0125] The PCR reaction solution formulation for this application is shown in Table 3 below:

[0126] Table 3

[0127]

[0128] Sample processing and loading:

[0129] The sample type was sputum sample. To simulate positive sputum samples with co-infection by multiple bacteria, seven bacterial quality control products purchased from Beina were added to negative sputum samples to make the final concentration of each target 1.0E+05 copies / mL.

[0130] Simulated positive sputum samples were liquefied using sputum liquefaction fluid Y1002 produced by Sansure Biotech. Nucleic acid was extracted from the liquefied sputum samples using magnetic bead extraction. Simultaneously, the liquefied sputum samples were diluted 5 times with pure water and extracted using direct ultrasonic amplification.

[0131] The magnetic bead extraction method was performed using Sansure Biotech's nucleic acid extraction and purification reagent S10015.

[0132] For the direct ultrasonic amplification method, an ultrasonic instrument with an ultrasonic frequency of 10kHz-80kHz is used. The ultrasonic treatment lasts for 120 seconds. After the ultrasonic treatment is completed, the sample is left to stand for 3 minutes to cool down before use.

[0133] The PCR reaction solution with the samples added was placed on a Macroblock 48S amplification instrument for amplification, and PCR amplification was performed according to a specific temperature and time program. The amplification program for this application is shown in Table 4 below.

[0134] Table 4

[0135]

[0136] After the reaction is complete, the results are automatically saved, and the amplification curves of the target and internal standard are analyzed separately. Based on the analyzed images, adjust the Start, End, and Threshold values ​​of the Baseline (the Start value can be set between 3 and 15, and the End value between 5 and 20, depending on the actual situation; adjust the amplification curve of the negative control to make it flat or below the threshold line), click Analyze to analyze, and ensure that all parameters meet the requirements in the "Quality Control" section below. Then, record the qualitative results in the Plate window.

[0137] Quality control:

[0138] Negative controls: FAM, HEX / VIC, ROX, CY5, QUSAR705, ATTO425, CY7, and AF405 channels all had no Ct value or Ct > 40;

[0139] Positive controls: Ct≤35 for all channels of FAM, HEX / VIC, ROX, CY5, QUSAR705, ATTO425, CY7, and AF405;

[0140] All of the above requirements must be met simultaneously in the same experiment; otherwise, the experiment is invalid and must be repeated.

[0141] Positive diagnostic value:

[0142] Based on the study of reference values, the reference value for Ct of the target gene detected by this kit is determined to be 40, and the reference value for Ct of the internal standard is also 40.

[0143] Interpretation of test results:

[0144] First, analyze whether the internal standard has an amplification curve and Ct≤40. If so, it indicates that the test is effective and subsequent analysis can be carried out. The test results are shown in Table 5 below.

[0145] Table 5

[0146]

[0147] NEG indicates negative and POS indicates positive.

[0148] Example 3: Detection results of the test sample in this application

[0149] The primers and probes shown in Example 1 were used to perform comparative detection on the simulated positive sputum samples from Example 2 using both magnetic bead and direct ultrasound amplification methods, following the method described in Example 2. The results are as follows: Figure 1 and Figure 2 As shown, both the magnetic bead method and the direct ultrasound amplification method can detect eight bacterial targets normally. This indicates that after liquefaction of sputum samples by Y1002, the direct ultrasound amplification method can obtain detection results comparable to the magnetic bead method, and eliminates the magnetic bead extraction process, thus reducing the detection time.

[0150] Example 4: Sensitivity of this application

[0151] Pretreatment of test samples: Positive test samples were the 8 bacterial control samples from BeiNa after digital PCR determination. They were diluted to 200 copies / mL with TE-SDS (0.01%) and added to artificial sputum samples, then mixed thoroughly. The above LOD concentration of simulated positive samples was tested using the direct ultrasonic amplification method described in Example 2, repeated 20 times. The number of detected samples was counted, and the detection rate was calculated. The test results showed that the 200 copies / mL simulated positive sputum sample could still detect 100% of the 8 targets, proving that the sensitivity of this application can reach 200 copies / mL. The detection results are as follows: Figure 3 As shown.

[0152] Example 5, Specificity of this application

[0153] Bacterial samples were purchased from third-party bacterial quality control products, while viral samples were collected from real clinical pharyngeal swabs. The processing method was as follows: bacterial / viral specific samples were added to artificial simulated sputum samples, mixed thoroughly, and diluted to E6 copies / mL before detection using the ultrasonic direct amplification method described in Example 2. Multiplex PCR was performed on the Hongshi 48S fully automated medical PCR instrument to detect pathogens (including Staphylococcus aureus, Acinetobacter baumannii, Enterococcus faecalis, Candida albicans, Streptococcus pyogenes, Listeria monocytogenes, Haemophilus parainfluenzae, Mycoplasma pneumoniae, Chlamydia pneumoniae, Neisseria meningitidis, Mycobacterium tuberculosis, influenza A virus, influenza B virus, Aspergillus flavus, Aspergillus terreus, Aspergillus fumigatus, Candida glabrata, and Candida tropicalis) that commonly cause the same or similar clinical symptoms. Examples of the detection results are shown in Table 6 below. The results indicate that the method described in this application has no cross-reactivity with the above-mentioned pathogens.

[0154] Table 6

[0155]

[0156] Example 6: Anti-interference and stability of this application

[0157] Potential interfering substances in sputum samples include: 100 μg / mL meropenem, 100 μg / mL imipenem, 100 mg / mL cefoperazone / sulbactam, 100 pg / mL moxifloxacin, 100 mg / mL amikacin, 100 μg / mL linezolid, 100 μg / mL vancomycin, 60 μg / mL sodium chloride, 20% (v / v) anhydrous ethanol, 10 μg / mL EDTA, 20% (v / v) human whole blood, 20 μg / mL purified mucin, and 10 μg / mL heme. Each interfering substance was first diluted to its working concentration, and then the positive control was diluted to the LOD concentration (200 copies / mL) before PCR detection.

[0158] After testing and verification, the above-mentioned interfering substances have no significant impact on the LOD concentration sample detection results of this application, as shown in Table 7 below.

[0159] Table 7

[0160]

[0161] Comparative Example 1, Other Primers and Probes

[0162] The inventors also designed additional primers and probes for each target (sequences are shown in Table 8), and selected the multiplex primer detection system composed of Table 9 below for the same purpose of multiplex detection of 8 pathogens in this application.

[0163] Table 8

[0164]

[0165]

[0166] Table 9

[0167]

[0168] The detection was performed according to the detection method in Example 2, and the results are shown below. Figure 4 The results show that, following the method in Example 2 and using the primer-probe combination in Table 9, it is possible to detect eight pathogens simultaneously. However, the detection effect of each target is slightly worse than that in Example 2 (mainly manifested in a decrease in Ct value and fluorescence intensity).

[0169] The detection specificity of the primers and probes in Table 9 was verified according to the method in Example 5, and the results are shown in Table 10 below. The results show that the detection results for Neisseria meningitidis, Aspergillus flavus, Aspergillus terreus, Candida glabrata, and Candida tropicalis were positive.

[0170] Table 10

[0171]

[0172] The anti-interference ability of the primers and probes in Table 9 was verified using the method described in Example 6, and the results are shown in Table 11 below. The results indicate that the aforementioned interfering substances have a significant impact on the detection results.

[0173] Table 11

[0174]

[0175] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0176] The embodiments described above are merely illustrative of several implementation methods of this application, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the protection scope of this application. Therefore, the protection scope of this patent application should be determined by the appended claims, and the specification and drawings can be used to interpret the content of the claims.

Claims

1. A nucleic acid combination product for detecting multiple respiratory pathogens, characterized in that, It includes the following primer and probe set: Primer and probe set 1: The nucleotide sequences are shown in SEQ ID NO: 1~3 for the primer pairs and probes for detecting Burkholderia cepacia; Primer and probe set 2: The nucleotide sequences are shown in SEQ ID NO: 4~6 for the primer pairs and probes for detecting Enterobacter cloacae; Primer and probe set 3: nucleotide sequences of primer pairs and probes for detecting Klebsiella acidogenic bacteria, as shown in SEQ ID NO: 7~9; Primer and probe set 4: nucleotide sequences of primer pairs and probes for detecting Klebsiella pneumoniae, as shown in SEQ ID NO: 10-12; Primer and probe set 5: nucleotide sequences are shown in SEQ ID NO: 13~15 for primer pairs and probes for detecting Stenotrophomonas maltophilia; Primer and probe set 6: nucleotide sequences are shown in SEQ ID NO: 16~18 for primer pairs and probes for detecting Serratia marcescens; Primer and probe set 7: The nucleotide sequences are shown in SEQ ID NO: 19-21 for the primer pairs and probes used to detect positive Legionella pneumophila; and, Primer and probe set 8: nucleotide sequences of primer pairs and probes for detecting Escherichia coli as shown in SEQ ID NO: 22~24.

2. The nucleic acid combination product for detecting multiple respiratory pathogens as described in claim 1, characterized in that, It also includes primer pairs and probes with nucleotide sequences as shown in SEQ ID NO: 25~27, respectively.

3. The nucleic acid combination product for detecting multiple respiratory pathogens as described in claim 1 or 2, characterized in that, The probe is labeled with a fluorescent group at its 5' end and a quenching group at its 3' end.

4. The nucleic acid combination product for detecting multiple respiratory pathogens as described in claim 3, characterized in that, One or more of the following conditions must be met: The fluorescent group includes one or more of FAM, HEX, ROX, CY5, QUSAR705, ATTO425, CY7 and AF405; The quenching group includes one or more of BHQ1, BHQ2 and TAMRA.

5. A kit for detecting multiple respiratory pathogens, characterized in that, It includes the nucleic acid combination product as described in any one of claims 1 to 4, and further includes one or more of nucleic acid extraction reagents and PCR amplification reagents.

6. The kit for detecting multiple respiratory pathogens as described in claim 5, characterized in that, One or more of the following conditions must be met: (1) The PCR amplification reagents include PCR buffer, DNA polymerase, UDG enzyme, dNTPs, dUTPs and Mg 2+ One or more of the following; (2) The kit also includes a lyophilization protectant, and the nucleic acid combination product and the PCR amplification reagent are packaged in the form of lyophilized reagents; (3) The kit also includes one or more positive control and negative control.

7. A lyophilized PCR premix, characterized in that, It includes the nucleic acid combination product according to any one of claims 1 to 4, a lyophilization protectant, and PCR amplification reagents, wherein the PCR amplification reagents include PCR buffer, DNA polymerase, UDG enzyme, dNTPs, dUTPs, and Mg. 2+ One or more of them.

Images