RNAi reagents for inhibiting influenza virus gene expression, compositions and methods of use thereof

Abstract

RNAi reagents, compositions comprising RNAi reagents, and methods for inhibiting the genome of influenza A virus are described. The influenza A virus (IAV) RNAi reagents and RNAi reagent conjugates disclosed herein inhibit expression of an influenza A virus genome at a targeting portion that spans a variety of known influenza A virus genome variants that are conserved genomes, and thus are capable of inhibiting expression of a variety of influenza A virus strains. Also described are pharmaceutical compositions comprising one or more IAV RNAi agents, optionally in conjunction with one or more additional therapeutic agents. Delivery of the IAV RNAi agents to lung cells in vivo provides inhibition of influenza A virus genomic expression, which can provide therapeutic benefits to subjects, including human subjects, for the treatment of various diseases, disorders and / or symptoms caused by influenza A virus infection.

Description

Invention Field

[0001] This disclosure relates to RNA interference (RNAi) agents, such as double-stranded RNAi agents like small interfering RNA (siRNA), for inhibiting the expression of influenza A (IAV) virus genome (or genes), including compositions comprising IAV RNAi agents, and methods of using the same.

[0002] sequence list This application contains a sequence list that has been submitted in XML format and is incorporated herein by reference in its entirety. The XML copy is named 30715-WO_SeqListing.xml, created on January 9, 2024, and is 6136kb in size. Background of the Invention Influenza, more commonly known as the flu, is a contagious respiratory illness caused by the influenza virus that infects the nose, throat, and sometimes the lungs. It can cause a broad spectrum of illness, ranging from relatively mild to quite severe, and in some cases, can lead to death. A 2018 study from the Centers for Disease Control and Prevention (CDC) concluded that, on average, about 8% of the U.S. population contracts the flu each season, varying from 3% to 11% depending on the season.

[0004] Influenza viruses belong to the family Orthomyxoviridae and are classified into four types: A, B, C, and D. (Li, X., Gu, M., Zheng, Q. et al. Packaging signal of influenza A virus. Virol J 18, 36 (2021)). Influenza virus particles consist of a viral envelope, matrix proteins, and a viral ribonucleocapsid (vRNP). The genomes of influenza A and B viruses each contain eight negative-sense single-stranded viral RNA (vRNA) segments: M1 / M2, NS1, NA, NP, HA, PA, PB1, and PB2. (Bouvier NM, Palese P. The biology of influenza viruses. Vaccine. 2008 Sep 12; 26 Suppl 4 (Suppl 4): D49-53). Influenza C has a seven-segment genome. These viral segments encode various essential proteins to facilitate the influenza virus cycle, including viral entry, viral RNA synthesis, viral protein synthesis, viral RNA packaging and assembly, and viral budding and release.

[0005] Influenza has been reported to cause 290,000 to 650,000 deaths annually (https: / / www.cdc.gov / media / releases / 2017 / p1213-flu-death-estimate.html, last accessed March 1, 2023). Influenza places a tremendous economic burden and strain on healthcare systems, with estimates of over $3 billion in direct medical costs annually in the United States alone. While influenza vaccines, which can be administered annually, are widely available and can alleviate illness and symptoms in many individuals, they do not prevent influenza-induced mortality in high-risk groups. Furthermore, while there are currently four FDA-approved antiviral compounds indicated for use within 48 hours of symptom onset, they are not recommended for influenza prevention. Additionally, although these products target the NA vRNA segment (oseltamivir), they do not provide protection against influenza. Zanamivir and Peramivir Or PA vRNA segment (marbaloxavir) However, influenza strains resistant to approved antiviral therapies are becoming increasingly common. Therefore, there is an urgent need to develop new and effective alternative therapies for influenza.

[0006] Influenza A viruses are classified into subtypes based on two proteins on their surface: hemagglutinin (H) and neuraminidase (N). (https: / / www.cdc.gov / flu / about / viruses / types.htm, U.S. Centers for Disease Control and Prevention.) There are 18 different hemagglutinin subtypes and 11 different neuraminidase subtypes (H1 to H18 and N1 to N11, respectively). Although more than 130 combinations of influenza A subtypes have been identified in nature (primarily from wild birds), there are potentially many more combinations, given the tendency for viral reassortment. Reassortment is the process by which influenza viruses exchange genetic segments. Reassortment can occur when two influenza viruses simultaneously infect a host and exchange genetic information.

[0007] Influenza A virus spreads and causes seasonal epidemics of the disease. Currently known viruses circulating in humans include the H1N1, H2N2, and H3N2 subtypes of influenza A. (Belser JA, Maines TR, Tumpey TM, Katz JM. Influenza: A virus transmission: contributing factors and clinical implications. Expert Rev. Mol. Med. 12: e39.) In recent years, an increasing number of IAV subtypes have been detected in humans, including H5N1, H7N9, and H10N8. (Rejmanek D, Hosseini PR, Mazet JA, Daszak P, Goldstein T. Evolutionary Dynamics and Global Diversity of Influenza A Virus. JVirol. Nov 2015; 89(21):10993-1001. doi:10.1128 / JVI.01573-15. e.g. Aug 26, 2015. PMID:26311890; PMCID:PMC4621101.) It is worth noting that avian H5N1 virus often causes severe cases when infecting humans. (Wang Y, Song T, Li K, Jin Y, Yue J, Ren H, Liang L. Different Subtypes of Influenza Viruses Target Different Human Proteins and Pathways Leading to Different Pathogenic Phenotypes. Biomed Res Int. 2019 Oct 22; 2019:4794910. doi:10.1155 / 2019 / 4794910.PMID:31772934; PMCID:PMC6854240.) For example, in 1996, the highly pathogenic avian influenza (HPAI) H5N1 virus was first identified in domesticated waterfowl in southern China. In 1997, an H5N1 outbreak occurred in mainland China and Hong Kong, with 18 related human cases (6 deaths) in Hong Kong. This outbreak infected more than 860 people with a mortality rate greater than 50%. (https: / / www.cdc.gov / flu / avianflu / communication-resources / bird-flu-origin-infographic.html, U.S. Centers for Disease Control and Prevention.)The first case of avian influenza A (H5N1) virus in an individual in the United States was reported on April 28, 2022. While the current risk of human infection with H5N1 remains low, individuals with work-related or recreational exposure to birds or infected mammals should take appropriate precautions to protect themselves from H5N1 avian influenza. Currently, the H5N1 avian influenza situation remains primarily an animal health concern. However, the CDC is closely monitoring the situation and implementing routine preparedness and preventative measures in case the virus mutates and poses a greater risk to human health. Invention Overview Novel RNA interference (RNAi) agents (referred to as RNAi agents, RNAi triggers, or triggers), such as double-stranded RNAi agents like small interfering RNA (siRNA), are needed to selectively and effectively inhibit the expression of the influenza A virus genome, including but not limited to selectively and effectively inhibiting the expression of influenza A mRNA, and thus inhibiting the replication of the influenza A virus genome. Furthermore, compositions of novel influenza A genome-specific RNAi agents are needed, which can be used as therapeutic agents or agents for treating influenza A and / or diseases or conditions (including symptom relief) that can be at least partially mediated by the expression of the influenza A virus genome. Although the concept of targeting influenza with RNAi agents such as siRNA, including the advantages of using this approach, has been proposed long ago (see, for example, Sailen Barik, siRNA for Influenza Therapy, Viruses (2010) 2(7):1448-1457), more than a decade later, no anti-influenza A siRNA drug has been approved for marketing in humans.

[0009] The nucleotide sequences and chemical modifications of the influenza A virus (IAV) RNAi reagent disclosed herein, along with their combinations with certain specific targeting ligands suitable for the selective and efficient delivery of the IAV RNAi reagent to lung cells in vivo (including delivery via inhalation), differ from those previously disclosed or known in the art and overcome challenges and obstacles that others have not been able to overcome. The IAV RNAi reagent disclosed herein provides highly potent and effective in vivo inhibition of influenza A mRNA (or transcript) expression, and due to the conserved nature of the antisense strand sequence of the RNAi reagent disclosed herein, it is expected to effectively inhibit the vast majority of the thousands of known and unknown influenza A mRNA (or transcript) variants.

[0010] Generally, this disclosure is characterized by an IAV RNAi reagent that is specific to the influenza A virus genome and targets a conserved portion of the genome that spans other influenza genomes, compositions comprising the IAV RNAi reagent, and a method for inhibiting influenza A virus genome expression in vivo using the IAV RNAi reagent described herein and compositions comprising the IAV RNAi reagent. The IAV RNAi reagent described herein can selectively and effectively reduce the expression of the influenza A virus genome. The IAV RNAi reagent can be used to inhibit the expression of influenza A virus genomes of influenza A subtypes (including but not limited to H1N1, H2N2, H3N2, H5N1, H7N9, and H10N8).

[0011] The IAV RNAi reagent can be used in methods of therapeutic treatment (including potential prevention or prophylactic treatment) of symptoms or diseases associated with influenza A virus infection, including but not limited to infections of the nose, throat, lungs and other parts of the respiratory system.

[0012] The IAV RNAi reagent can be used in methods for the therapeutic treatment (including potential prevention or prophylactic treatment) of symptoms or illnesses associated with influenza A virus infection of influenza A subtypes (including but not limited to H1N1, H2N2, H3N2, H5N1, H7N9 and H10N8).

[0013] Since the IAV RNAi reagent is designed to inhibit the expression of the influenza A virus genome by targeting highly conserved genomic regions in the influenza A virus genome, the IAV RNAi reagent can inhibit the expression of multiple subtypes of influenza A virus (including but not limited to H1N1, H2N2, H3N2, H5N1, H7N9 and H10N8).

[0014] In one aspect, this disclosure features an RNAi reagent for inhibiting the expression of influenza A virus genome, wherein the RNAi reagent comprises a sense strand (also referred to as a guest strand) and an antisense strand (also referred to as a guide strand). The sense strand and antisense strand may be partially complementary, substantially complementary, or completely complementary to each other. The length of the sense strand of the RNAi reagent described herein may each be 15 to 49 nucleotides. The length of the antisense strand of the RNAi reagent described herein may each be 18 to 49 nucleotides. In some embodiments, the lengths of the sense strand and antisense strand are independently 18 to 26 nucleotides. The sense strand and antisense strand may be the same length or different lengths. In some embodiments, the lengths of the sense strand and antisense strand are independently 21 to 26 nucleotides. In some embodiments, the lengths of the sense strand and antisense strand are independently 21 to 24 nucleotides. In some embodiments, both the sense strand and antisense strand are 21 nucleotides in length. In some embodiments, the antisense strand is independently 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long. In some embodiments, the sense strand is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides long. Upon delivery to cells expressing the influenza A virus genome, such as lung cells, the RNAi reagent described herein inhibits the expression of one or more influenza A virus genomes in vivo and / or in vitro via RNA-induced silencing complex (RISC)-mediated cleavage of viral RNA transcripts.

[0015] The IAV RNAi reagents disclosed herein are designed to target regions of the influenza A virus genome (see, for example, SEQ ID NO: 1-6) that are conserved across a variety of different influenza viruses. In some embodiments, the IAV RNAi reagents disclosed herein are designed to target a portion of the influenza A virus gene having any of the sequences disclosed in Tables 1A, 1B, 1C, 1D, 1E, or 1F.

[0016] In another aspect, this disclosure is characterized by compositions, including pharmaceutical compositions, comprising one or more disclosed IAV RNAi agents capable of selectively and effectively reducing influenza A virus gene expression. Compositions comprising one or more IAV RNAi agents described herein may be administered to subjects, such as human or animal subjects, for the treatment (including potential prophylactic treatment or suppression) of symptoms and illnesses associated with influenza A virus infection, including but not limited to infections of the nose, throat, lungs, and other sites of the respiratory system.

[0017] Tables 3A, 3B, 3C, 3D, 3E, 3F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, and 6F provide examples of sense and antisense strands of IAV RNAi reagents that can be used in IAV RNAi reagents. Tables 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F, and 10A, 10B, 10C, 10D, 10E, and 10F provide examples of double-stranded IAV RNAi reagents. Tables 2A, 2B, 2C, 2D, 2E, and 2F provide examples of 19-nucleotide core sequences that may consist of, or may be included in, certain IAV RNAi reagents disclosed herein.

[0018] In another aspect, this disclosure is characterized by a method for delivering an IAV RNAi reagent to lung epithelial cells of a subject (e.g., a mammal) in vivo. Compositions for use in such methods are also described herein.

[0019] In some embodiments, this document discloses methods for delivering IAV RNAi reagents in vivo to lung cells (epithelial cells (including airway epithelial cells, alveolar type I and II lung cells), mesenchymal cells (including smooth muscle cells and fibroblasts), immune cells (including macrophages and mast cells), and endothelial cells) of a subject. In some embodiments, the subject is a human subject.

[0020] The methods disclosed herein include administering one or more IAV RNAi agents to a subject, such as a human or animal subject, using any suitable means known in the art. The pharmaceutical compositions disclosed herein comprising one or more IAV RNAi agents can be administered in a variety of ways, depending on whether local or systemic treatment is required. Administration can be, but is not limited to, intravenous, intra-arterial, subcutaneous, intraperitoneal, subdermal (e.g., via an implanted device), and intraparenchymal administration. In some embodiments, the pharmaceutical compositions described herein are administered by inhalation (e.g., dry powder inhalation or aerosol inhalation), intranasal administration, intratracheal administration, or oropharyngeal aspiration.

[0021] In some implementations, the IAV RNAi reagent described herein is intended to inhibit the expression of the influenza A virus genome in the lung epithelium, for which it is administered by inhalation (e.g., via an inhaler device, such as a metering inhaler, or a nebulizer such as a jet or vibrating mesh nebulizer, or a soft mist inhaler).

[0022] In some embodiments, the IAV RNAi reagent is capable of selectively and effectively inhibiting the expression of the influenza A virus genome. The IAV RNAi reagent described herein can be used to inhibit the expression of the influenza A virus genome (e.g., including but not limited to H1N1, H2N2, H3N2, H5N1, H7N9, and H10N8).

[0023] IAV RNAi reagents can be delivered to target cells or tissues using any oligonucleotide delivery technology known in the art. In some embodiments, IAV RNAi reagents are delivered to cells or tissues by covalently linking the RNAi reagent to a targeting group. In some embodiments, the targeting group may include a cell receptor ligand, such as an integrin targeting ligand. Integrins are a family of transmembrane receptors that promote extracellular matrix (ECM) adhesion. In particular, integrin α-v-β-6 (αvβ6) is an epithelial-specific integrin known as a receptor for ECM proteins and the TGF-β potential related peptide (LAP), and is expressed in a variety of cells and tissues. Integrin αvβ6 is known to be highly upregulated in damaged lung epithelium. In some embodiments, the IAV RNAi reagents described herein are linked to an integrin targeting ligand with affinity for integrin αvβ6. As mentioned herein, an "αvβ6 integrin-targeting ligand" is a compound with affinity for integrin αvβ6 that can be used as a ligand to facilitate the targeting and delivery of an RNAi reagent to which it is attached to to desired cells and / or tissues (i.e., cells expressing integrin αvβ6, such as lung cells). In some embodiments, multiple αvβ6 integrin-targeting ligands or clusters of αvβ6 integrin-targeting ligands are linked to an IAV RNAi reagent. In some embodiments, the IAV RNAi reagent-αvβ6 integrin-targeting ligand conjugate is selectively internalized by lung epithelial cells via receptor-mediated endocytosis or by other means.

[0024] Examples of targeting groups that can be used to deliver IAV RNAi reagents comprising αvβ6 integrin targeting ligands are disclosed, for example, in International Patent Application Publication Nos. WO 2018 / 085415 and WO 2019 / 089765, respectively, granted to Arrowhead Pharmaceuticals, Inc., the contents of which are incorporated herein by reference in their entirety.

[0025] The targeting group can be attached to the 3' or 5' end of the sense or antisense strand of the IAV RNAi reagent. In some embodiments, the targeting group is attached to the 3' or 5' end of the sense strand. In some embodiments, the targeting group is attached to the 5' end of the sense strand. In some embodiments, the targeting group is internally attached to a nucleotide on the sense and / or antisense strand of the RNAi reagent. In some embodiments, the targeting group is attached to the RNAi reagent via a linker.

[0026] In another aspect, this disclosure is characterized by compositions comprising one or more IAV RNAi reagents having the double-stranded structures disclosed in Tables 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F and 10A, 10B, 10C, 10D, 10E and 10F.

[0027] The use of IAV RNAi reagents provides methods for the therapeutic (including prophylactic) treatment of diseases or conditions associated with influenza A virus infection, including but not limited to infections of the nose, throat, lungs, and other sites of the respiratory system caused by the influenza A virus genome. The IAV RNAi reagents disclosed herein can be used to treat various respiratory illnesses and injuries associated with influenza infection. In some embodiments, the IAV RNAi reagents disclosed herein can be used to treat or prevent inflammatory lung diseases or conditions caused by influenza infection. The use of the IAV RNAi reagents described herein can be used for the therapeutic (including prophylactic) treatment of diseases or conditions associated with influenza A virus infection caused by influenza A virus subtypes (e.g., including but not limited to H1N1, H2N2, H3N2, H5N1, H7N9, and H10N8).

[0028] definition.

[0029] As used herein, the terms “oligonucleotide” and “polynucleotide” refer to polymers of linked nucleosides, each of which may be independently modified or unmodified.

[0030] As used herein, “RNAi reagent” (also referred to as “RNAi trigger”) means a chemical composition containing RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules capable of degrading RNA in a sequence-specific manner or inhibiting (e.g., degrading or inhibiting, under appropriate conditions) the translation of viral RNA (including all viral RNA and viral messenger RNA (mRNA) transcripts) of a target influenza virus. As used herein, RNAi reagents may act through RNA interference mechanisms (i.e., by interacting with RNA interference pathways in mammalian cells, such as RNA-induced silencing complexes or RISC) or through any alternative mechanism or pathway. Although it is considered that RNAi reagents act primarily through RNA interference mechanisms as used herein, the disclosed RNAi reagents are not bound to or limited to any particular pathway or mechanism of action. The RNAi reagents disclosed herein consist of sense and antisense strands and include, but are not limited to, small (or short) interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and dicer substrates. The antisense strand of the RNAi reagent described herein is at least partially complementary to the RNA to be targeted (e.g., influenza A virus mRNA). The RNAi reagent may include one or more modified nucleotides and / or one or more non-phosphodiester bonds.

[0031] As used herein, when referring to the expression of a given gene or viral genome, the terms “silence,” “reduction,” “inhibition,” “downregulation,” or “knockdown” mean, as measured by the level of RNA transcribed from the viral gene or genome, the number of viral genomes, or the level of polypeptides, proteins, or protein subunits translated from viral RNA, in cells, cell populations, tissues, organs, or subjects in which the viral gene or genome is transcribed, compared to a second cell, cell population, tissue, organ, or subject who has not been treated in this way, when the cells, cell populations, tissues, organs, or subjects are treated with the RNAi reagents described herein, the expression of the viral gene or genome (including viral genomic RNA or subgenomic RNA).

[0032] As used herein, the terms “sequence” and “nucleotide sequence” refer to a sequence or order of nucleobases or nucleotides described by consecutive letters using standard nomenclature.

[0033] As used herein, “base,” “nucleotide base,” or “nucleobase” is a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, and includes primary purine bases adenine and guanine, and primary pyrimidine bases cytosine, thymine, and uracil. Nucleobases may be further modified to include, but are not limited to, universal bases, hydrophobic bases, hybrid bases, size-extended bases, and fluorinated bases. (See, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed., Wiley-VCH, 2008). The synthesis of such modified nucleobases (including phosphorous amide compounds containing modified nucleobases) is known in the art.

[0034] As used herein, and unless otherwise stated, when used to describe a first nucleobase or nucleotide sequence (e.g., the sense strand or target RNA of an RNAi reagent) relating to a second nucleobase or nucleotide sequence (e.g., the antisense strand or single-stranded antisense oligonucleotide of an RNAi reagent), the term "complementary" means the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize (forming base-pairing hydrogen bonds under mammalian physiological conditions (or otherwise suitable in vivo or in vitro conditions) under certain standard conditions and to form a double-stranded or double-helical structure. Those skilled in the art will be able to select the set of conditions most appropriate for the hybridization assay. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and, at least to the extent that the hybridization requirements described above are met, include native or modified nucleotides or nucleotide mimics. Sequence identity or complementarity is independent of modification. For example, for the purpose of determining identity or complementarity, a and Af, as defined herein, are complementary to U (or T) and identical to A.

[0035] As used herein, “completely complementary” or “perfectly complementary” means that in a hybridization pair of nucleobase or nucleotide sequences, all (100%) bases in the adjacent sequence of the first oligonucleotide hybridize with the same number of bases in the adjacent sequence of the second oligonucleotide. The adjacent sequence may contain all or part of the first or second nucleotide sequence.

[0036] As used herein, "partially complementary" means that in a hybridization pair of nucleobase or nucleotide sequences, at least 70% but not all of the bases in the adjacent sequence of the first oligonucleotide hybridizes with the same number of bases in the adjacent sequence of the second oligonucleotide. The adjacent sequence may contain all or part of the first or second nucleotide sequence.

[0037] As used herein, "substantially complementary" means that in a hybridization pair of nucleobase or nucleotide sequences, at least 85% but not all of the bases in the adjacent sequence of the first oligonucleotide hybridizes with the same number of bases in the adjacent sequence of the second oligonucleotide. The adjacent sequence may contain all or part of the first or second nucleotide sequence.

[0038] As used herein, the terms “complementary,” “fully complementary,” “partially complementary,” and “substantially complementary” refer to the nucleobase or nucleotide matching between the sense and antisense strands of the RNAi reagent, or between the antisense strand of the RNAi reagent and influenza RNA, such as the genomic RNA sequence of influenza A virus.

[0039] As used herein, when applied to nucleic acid sequences, the terms "substantially identical" or "substantially identical" mean that a nucleotide sequence (or a portion thereof) has at least about 85% sequence identity or more, such as at least 90%, at least 95%, or at least 99%, compared to a reference sequence. The percentage of sequence identity is determined by comparing two best-aligned sequences within a comparison window. The percentage is calculated by determining the number of positions in both sequences where the same type of nucleic acid base appears below them to arrive at the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The invention disclosed herein covers nucleotide sequences substantially identical to the nucleotide sequences disclosed herein.

[0040] As used herein, the terms “treat,” “treatment,” etc., refer to a method or procedure taken to provide relief or reduction of the number, severity, and / or frequency of one or more disease symptoms in a subject. As used herein, “treat” and “treatment” may include prevention, management, preventive treatment, and / or suppression or reduction of the number, severity, and / or frequency of one or more disease symptoms in a subject.

[0041] As used herein, when referring to RNAi reagents, the phrase “introduced into cells” means the functional delivery of the RNAi reagent into cells. The phrase “functional delivery” means the delivery of the RNAi reagent into cells in a manner that results in the RNAi reagent having the expected biological activity, such as sequence-specific inhibition of gene or viral genome expression.

[0042] Unless otherwise stated, symbols are used as in this document. The use of "it" means that any one or more groups may be attached to it within the scope of the invention as described herein.

[0043] As used herein, the term "isomer" refers to a compound that has the same molecular formula but differs in the bonding order or properties of its atoms or in the spatial arrangement of its atoms. Isomers with different spatial arrangements of atoms are called "stereoisomers." Stereoisomers that are not mirror images of each other are called "diastereomers," and stereoisomers that are non-overlapping mirror images are called "enantiomers," or sometimes optical isomers. The carbon atom bonded to four different substituents is called a "chiral center."

[0044] As used herein, for each structure containing an asymmetric center and thus producing enantiomers, diastereomers, or other stereoisomers, each structure disclosed herein is intended to represent all such possible isomers, including their optically pure and racemic forms, unless specifically identified as having a particular conformation in the structure. For example, the structures disclosed herein are intended to cover mixtures of diastereomers and single stereoisomers.

[0045] As used in the claims herein, the phrase “consisting of” excludes any element, step, or ingredient not specified in the claims. When used in the claims herein, the phrase “consisting substantially of” limits the scope of the claims to the specified materials or steps, and those materials or steps that do not substantially affect the essential and novel features of the invention.

[0046] It will be readily understood and appreciated by those skilled in the art that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state, depending on the environment in which the compound or composition is placed. Accordingly, as used herein, the structures disclosed contemplate certain functional groups, such as OH, SH, or NH, which may be protonated or deprotonated. As will be readily understood by those skilled in the art, the disclosure herein is intended to cover the disclosed compounds and compositions regardless of their protonated state based on the environment (e.g., pH). Accordingly, compounds described herein having unstable protons or basic atoms should also be understood to represent salt forms of the respective compounds. The compounds described herein may be in the form of free acids, free bases, or salts. Pharmaceutically acceptable salts of the compounds described herein should be understood to be within the scope of this invention.

[0047] As used herein, when referring to a connection between two compounds or molecules, the terms “connected” or “combined” mean that the two compounds or molecules are joined by a covalent bond. Unless otherwise stated, as used herein, the terms “connected” and “combined” may refer to a connection between a first compound and a second compound, with or without any intermediate atoms or groups of atoms.

[0048] As used herein, the term “including” is used to mean the phrase “including but not limited to” and is interchangeable with the phrase “including but not limited to”. Unless the context clearly indicates otherwise, the term “or” is used herein to mean the term “and / or” and is interchangeable with the term “and / or”.

[0049] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While suitable methods and materials are described below, similar or equivalent methods and materials may be used in the practice or testing of this invention. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. In case of conflict, the definitions included in this specification shall prevail. Furthermore, materials, methods, and examples are illustrative only and are not intended to be limiting.

[0050] Other objects, features, aspects, and advantages of the invention will become apparent from the following detailed description, accompanying drawings, and claims. Brief description of the attached diagram Figure 1 The chemical structure of the tridentate αvβ6 epithelial cell targeting ligand referred to in this paper as Tri-SM6.1-αvβ6-(TA14) is represented.

[0052] Figure 2 Immunohistochemical (IHC) staining of mice for antihemagglutinin (antiHA) with saline (without IAV RNAi reagent) and RNAi reagent AC002564 is described more fully in Example 4.

[0053] Figure 3 The bar graph shows the lung viral load of CA07 H1N1 in mice infected with PBS or CA07 and subsequently administered saline, IAV RNAi reagent or oseltamivir, as more fully described in Example 32.

[0054] Figure 4 The bar graph shows the percentage of total inflammation in the lungs of mice infected with PBS or CA07 and subsequently treated with saline, IAV RNAi reagent or oseltamivir, as more fully described in Example 32.

[0055] Figure 5 Histological examination of the lung inflammation in mice infected with PBS or CA07 and subsequently treated with saline, IAV RNAi reagent or oseltamivir, as more fully described in Example 32.

[0056] Figure 6ABefore and after H5N1 infection, mice were tested for lung viral load using IAV RNAi reagents, as described more fully in Example 36.

[0057] Figure 6B The body weight of mice treated with IAV RNAi reagent before and after H5N1 infection was measured, as more fully described in Example 36.

[0058] Figure 6C Clinical scores of mice tested with IAV RNAi reagent before and after H5N1 infection were described more fully in Example 36.

[0059] Figure 7A The weight of mice treated with IAV RNAi reagent prior to H5N1 infection was measured, as more fully described in Example 37.

[0060] Figure 7B Following H5N1 infection, the body weight of mice treated with IAV RNAi reagent was measured, as more fully described in Example 37.

[0061] Figure 7C Clinical scores of mice tested with IAV RNAi reagent before and after H5N1 infection were described more fully in Example 37.

[0062] Figure 7D Survival index of test animals treated with IAV RNAi reagent before and after H5N1 infection, as more fully described in Example 37.

[0063] Figure 7E Before and after H5N1 infection, mice were tested for lung viral load using IAV RNAi reagents, as described more fully in Example 37.

[0064] Figure 8 Lung weight and total lung weight of test animals treated with IAV RNAi reagent, as more fully described in Example 38. Invention Details RNAi reagents This document describes RNAi reagents (referred to herein as IAV RNAi reagents or IAV RNAi triggers) for inhibiting the expression of influenza A virus gene transcripts or genomes. Each IAV RNAi reagent disclosed herein comprises a sense strand and an antisense strand. The sense strand may be 15 to 49 nucleotides in length, and the antisense strand may be 18 to 49 nucleotides in length. The sense strand and antisense strand may be the same length, or they may be different lengths. In some embodiments, the sense strand and antisense strand are each independently 18 to 27 nucleotides in length. In some embodiments, the sense strand and antisense strand are each 19 to 26 nucleotides in length. In some embodiments, the sense strand and antisense strand are each 21 to 24 nucleotides in length. In some embodiments, the sense strand and antisense strand are each independently 19 to 21 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length, and the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length, and the antisense strand is about 23 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides long and the antisense strand is 21 nucleotides long. In some embodiments, both the sense strand and the antisense strand are 21 nucleotides long. In some embodiments, the sense strand of the RNAi reagent is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, or 39 nucleotides long. In some embodiments, the antisense strand of the RNAi reagent is 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, or 39 nucleotides long. In some implementations, the double-stranded RNAi reagent has a double-strand length of about 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides.

[0066] Examples of nucleotide sequences for forming IAV RNAi reagents are provided in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, and 10F. Examples of duplexes of RNAi reagents containing sense and antisense strand sequences in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, and 6F are shown in Tables 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F, and 10A, 10B, 10C, 10D, 10E, and 10F.

[0067] In some embodiments, the length of the region of complete complementarity, substantial complementarity, or partial complementarity between the sense and antisense strands is 15-26 nucleotides (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) and appears at or near the 5' end of the antisense strand (e.g., this region may be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides, which are incompletely complementary, substantially complementary, or partially complementary).

[0068] The sense strand of the IAV RNAi reagent described herein comprises at least 15 consecutive nucleotides that have at least 85% identity with a core segment sequence (also referred to herein as the “core segment” or “core sequence”) of the same number of nucleotides in the influenza A virus genomic RNA (including all viral RNAs and viral mRNAs). In some embodiments, the sense strand core segment sequence is 100% (completely) complementary to or at least about 85% (substantially) complementary to the core segment sequence in the antisense strand, and therefore, the sense strand core segment sequence is generally identical or at least at least 85% identical to a nucleotide sequence of the same length present in the influenza A virus genomic RNA target (sometimes referred to, for example, as the target sequence), which, as elsewhere indicated, is a known conserved target sequence across various influenza A virus genomes. In some embodiments, the length of the sense strand core segment is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. In some embodiments, the length of the sense strand core segment is 17 nucleotides. In some implementations, the length of the sense strand core segment is 19 nucleotides.

[0069] The antisense strand of the IAV RNAi reagent described herein comprises at least 17 consecutive nucleotides having at least 85% complementarity to a core segment of the same number of nucleotides in the influenza A virus genomic RNA or another influenza RNA to be targeted, and at least 15 consecutive nucleotides having at least 85% complementarity to a core segment of the same number of nucleotides in the corresponding sense strand. In some embodiments, the antisense strand core segment is 100% (completely) complementary or at least about 85% (substantially) complementary to a nucleotide sequence of the same length present in the influenza A virus genomic RNA target (e.g., the target sequence). In some embodiments, the length of the antisense strand core segment is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. In some embodiments, the length of the antisense strand core segment is 19 nucleotides. In some embodiments, the length of the antisense strand core segment is 17 nucleotides. The sense strand core segment sequence may be the same length as the corresponding antisense core sequence, or it may be a different length.

[0070] The sense and antisense strands of the IAV RNAi reagent are annealed to form a double helix. The sense and antisense strands of the IAV RNAi reagent can be partially complementary, substantially complementary, or completely complementary to each other. Within the complementary double helix region, the sense core sequence is at least 85% complementary to the antisense core sequence or 100% complementary. In some embodiments, the sense core sequence contains a sequence of at least 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides, which is at least 85% or 100% complementary to the corresponding 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides of the antisense core sequence (i.e., the sense and antisense core sequences of the IAV RNAi reagent have regions of at least 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides, which are at least 85% or 100% base-paired).

[0071] In some embodiments, the antisense strand of the IAV RNAi reagent disclosed herein differs from any antisense strand sequence in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, or 3F by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the IAV RNAi reagent disclosed herein differs from any sense strand sequence in Tables 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F by 0, 1, 2, or 3 nucleotides.

[0072] In some implementations, the sense strand and / or antisense strand may optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extensions) at the 3' end, 5' end, or both 3' and 5' ends of the core sequence. The additional nucleotides of the antisense strand (if present) may or may not be complementary to the corresponding sequence in the influenza A virus genomic RNA. The additional nucleotides of the sense strand (if present) may be identical or different from the corresponding sequence in the influenza A virus genomic RNA. The additional nucleotides of the antisense strand (if present) may or may not be complementary to the corresponding additional nucleotides of the sense strand (if present).

[0073] As used herein, the extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' ends of the sense strand core sequence and / or antisense strand core sequence. The extended nucleotides on the sense strand may or may not be complementary to the corresponding nucleotides in the antisense strand (or core sequence nucleotides or extended nucleotides). Conversely, the extended nucleotides on the antisense strand may or may not be complementary to the corresponding nucleotides in the sense strand (or core sequence nucleotides or extended nucleotides). In some embodiments, both the sense and antisense strands of the RNAi reagent contain 3' and 5' extensions. In some embodiments, one or more 3' extended nucleotides of one strand are base-paired with one or more 5' extended nucleotides of the other strand. In other embodiments, one or more 3' extended nucleotides of one strand are not base-paired with one or more 5' extended nucleotides of the other strand. In some embodiments, the IAV RNAi reagent has an antisense strand containing a 3' extension and a sense strand containing a 5' extension. In some embodiments, the extended nucleotides are unpaired and form overhangs. As used herein, "protruding end" refers to one or more unpaired nucleotide segments located at the end of the sense or antisense strand that do not form part of the hybrid or double-stranded portion of the RNAi reagent disclosed herein.

[0074] In some embodiments, the IAV RNAi reagent comprises a 3' extended antisense strand having a length of 1, 2, 3, 4, 5, or 6 nucleotides. In other embodiments, the IAV RNAi reagent comprises a 3' extended antisense strand having a length of 1, 2, or 3 nucleotides. In some embodiments, one or more antisense extended nucleotides comprise nucleotides complementary to the corresponding influenza A virus genomic RNA sequence. In some embodiments, one or more antisense extended nucleotides comprise nucleotides not complementary to the corresponding influenza A virus genomic RNA sequence.

[0075] In some embodiments, the IAV RNAi reagent comprises a 3' extended sense strand having a length of 1, 2, 3, 4, or 5 nucleotides. In some embodiments, one or more sense strand extending nucleotides comprise adenosine, uracil, or thymidine nucleotides, AT dinucleotides, or nucleotides corresponding to or identical to nucleotides in the influenza A virus genomic RNA sequence. In some embodiments, the 3' sense strand extension comprises, but is not limited to, one of the following sequences: T, UT, TT, UU, UUT, TTT, or TTTT (each listed from 5' to 3').

[0076] The sense strand may have a 3′ extension and / or a 5′ extension. In some embodiments, the IAV RNAi reagent comprises a sense strand with a 5′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more sense strand extension nucleotides comprise nucleotides corresponding to or identical to nucleotides in the influenza A virus genomic RNA sequence.

[0077] Examples of sequences for forming IAV RNAi reagents are provided in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, and 10F. In some embodiments, the antisense strand of the IAV RNAi reagent comprises a sequence of any of the sequences in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F. In some embodiments, the antisense strand of the IAV RNAi reagent comprises, or is composed of, any of the modified sequences in Tables 3A, 3B, 3C, 3D, 3E, or 3F. In some embodiments, the antisense strand of the IAV RNAi reagent comprises nucleotides (5' to 3') 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 from any sequence in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, or 3F. In some embodiments, the sense strand of the IAV RNAi reagent comprises any sequence from the 5' end to the 3' end of any sequence in Tables 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, or 6F. In some embodiments, the sense strand of the IAV RNAi reagent comprises any sequence of nucleotides (5' end → 3' end) 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21 in Tables 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, or 6F. In some embodiments, the sense strand of the IAVRNAi reagent comprises, or is composed of, any of the modified sequences in Tables 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F.

[0078] In some embodiments, the sense and antisense strands of the RNAi reagent described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi reagent described herein contain different numbers of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi reagent form blunt ends. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi reagent form blunt ends. In some embodiments, both ends of the RNAi reagent form blunt ends. In some embodiments, neither end of the RNAi reagent is blunt. As used herein, "blunt end" refers to the end of a double-stranded RNAi reagent in which the terminal nucleotides of the two annealed strands are complementary (forming complementary base pairs).

[0079] In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi reagent form a frayed end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi reagent form a frayed end. In some embodiments, both ends of the RNAi reagent form frayed ends. In some embodiments, neither end of the RNAi reagent is a frayed end. As used herein, a frayed end refers to the end of a double-stranded RNAi reagent where the terminal nucleotides of the two annealed strands form a pair (i.e., no overhang) but are not complementary (i.e., form a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of the double-stranded RNAi reagent form an overhang. The unpaired nucleotides may be on the sense strand or the antisense strand, creating a 3' or 5' overhang. In some implementations, the RNAi reagent contains: a blunt end and a folded end, a blunt end and a 5' overhang, a blunt end and a 3' overhang, a folded end and a 5' overhang, a folded end and a 3' overhang, two 5' overhangs, two 3' overhangs, a 5' overhang and a 3' overhang, two folded ends, or two blunt ends. Typically, when present, the overhangs are located at the 3' end of the sense strand, the antisense strand, or both the sense and antisense strands.

[0080] The IAV RNAi reagents disclosed herein may also consist of one or more modified nucleotides. In some embodiments, substantially all nucleotides of the sense strand and substantially all nucleotides of the antisense strand of the IAV RNAi reagent are modified nucleotides. The IAV RNAi reagents disclosed herein may further comprise one or more modified internucleotide bonds, such as one or more phosphate thioester bonds or phosphate dithioester bonds. In some embodiments, the IAV RNAi reagent contains one or more modified nucleotides and one or more modified internucleotide bonds. In some embodiments, 2'-modified nucleotides are combined with modified internucleotide bonds.

[0081] In some embodiments, the IAV RNAi reagent is prepared or provided as a salt, a mixed salt, or a free acid. In some embodiments, the IAV RNAi reagent is prepared as a pharmaceutically acceptable salt. In some embodiments, the IAV RNAi reagent is prepared as a pharmaceutically acceptable sodium salt. Such forms, well known in the art, are within the scope of the invention disclosed herein.

[0082] Modified nucleotides When used in various oligonucleotide constructs, the modified nucleotides can preserve the activity of the compound in cells, while increasing the serum stability of these compounds, and can also minimize the possibility of activating interferon activity in humans after administration of the oligonucleotide construct.

[0083] In some embodiments, the IAV RNAi reagent contains one or more modified nucleotides. As used herein, a “modified nucleotide” is a nucleotide other than a ribonucleotide (2’-hydroxynucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides may include, but are not limited to, deoxyribonucleotides, nucleotide mimics, debased nucleotides, 2'-modified nucleotides, reverse nucleotides, nucleotides containing modified nucleosides, bridged nucleotides, peptide nucleic acids (PNAs), 2',3'-seco nucleotide mimics (unlocked nucleobase analogs), locked nucleotides, 3'-O-methoxy (2' nucleoside-linked) nucleotides, 2'-F-arabinonucleotides, 5'-Me,2'-fluoronucleotides, morpholinonucleotides, vinylphosphonate deoxyribonucleotides, vinylphosphonate-containing nucleotides, and cyclopropylphosphonate-containing nucleotides. 2'-Modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides (also known as 2'-methoxynucleotides), 2'-fluoronucleotides (also known herein as 2'-deoxy-2'-fluoronucleotides), 2'-deoxynucleotides, 2'-methoxyethyl (2'-O-2-methoxyethyl) nucleotides (also known as 2'-MOE), 2'-aminonucleotides, and 2'-alkylnucleotides. All positions in a given compound need not be uniformly modified. Instead, more than one modification can be incorporated into a single IAV RNAi reagent, or even into a single nucleotide. The sense and antisense strands of an IAV RNAi reagent can be synthesized and / or modified using methods known in the art. Modification at one nucleotide does not depend on modification at another nucleotide.

[0084] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of 2-aminoadenine, adenine, and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) derivatives of adenine and guanine, and other alkyl derivatives, 2-thiouracil, 2- Thiothymine, 2-thiocytosine, 5-halogenated uracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halogenated, 8-amino, 8-mercapto, 8-thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, 5-halogenated (e.g., 5-bromo), 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazoguanine, 7-deazoadenine, 3-deazoguanine and 3-deazoadenine.

[0085] In some embodiments, the 5' and / or 3' ends of the antisense strand may include a debase residue (Ab), which may also be referred to as a "debase site" or "debase nucleotide." A debase residue (Ab) is a nucleotide or nucleoside lacking a nucleotide base at the 1' position of the sugar moiety (see, for example, U.S. Patent No. 5,998,203). In some embodiments, the debase residue may be placed inside the nucleotide sequence. In some embodiments, Ab or AbAb may be added to the 3' end of the antisense strand. In some embodiments, the 5' end of the sense strand may include one or more additional debase residues (e.g., (Ab) or (AbAb)). In some embodiments, UUAb, UAb, or Ab is added to the 3' end of the sense strand. In some embodiments, the debase (deoxyribose) residue may be replaced with a ribitol (debase ribose) residue.

[0086] In some embodiments, all or substantially all nucleotides of the RNAi reagent are modified nucleotides. An RNAi reagent in which substantially all nucleotides present are modified nucleotides, as used herein, is an RNAi reagent in which four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense and antisense strands are ribonucleotides (i.e., unmodified). A sense strand in which substantially all nucleotides present are modified nucleotides, as used herein, is a sense strand in which two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand are unmodified ribonucleotides. An antisense strand in which substantially all nucleotides present are modified nucleotides, as used herein, is an antisense strand in which two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand are unmodified ribonucleotides. In some embodiments, one or more nucleotides of the RNAi reagent are unmodified ribonucleotides. The chemical structures of certain modified nucleotides are described in Table 11 herein.

[0087] Modified internucleotide bonds In some embodiments, one or more nucleotides of the IAV RNAi reagent are linked by non-standard bonding or a backbone (i.e., modified internucleotide bonding or a modified backbone). Modified internucleotide bonding or a backbone includes, but is not limited to, thiophosphate groups (represented herein as lowercase "s"), chiral thiophosphates, thiophosphates, dithiophosphates, phosphate triesters, aminoalkyl-phosphate triesters, alkylphosphonates (e.g., methylphosphonates or 3'-alkylenephosphonates), chiral phosphonates, hypophosphonates, aminophosphates (e.g., 3'-aminoaminophosphates, aminoalkylaminophosphates, or thiocarbonylaminophosphates), thiocarbonylalkylphosphonates, thiocarbonylalkylphosphate triesters, morpholino bonding, borane phosphates with normal 3'-5' bonding, analogs of 2'-5' linked borane phosphates, or borane phosphates with reverse polarity, wherein adjacent nucleoside unit pairs link 3'-5' to 5'-3' or 2'-5' to 5'-2'. In some embodiments, the modified internucleotide bonds or backbone lack phosphorus atoms. Modified internucleotide bonds lacking phosphorus atoms include, but are not limited to, bonds between short-chain alkyl or cycloalkyl sugars, mixed heteroatom and alkyl or cycloalkyl sugar bonds, or bonds between one or more short-chain heteroatoms or heterocyclic sugars. In some embodiments, the modified internucleotide backbone includes, but is not limited to, siloxane backbones, sulfide backbones, sulfone backbones, methylacetyl and thiomethylacetyl backbones, methylenemethylacetyl and thiomethylacetyl backbones, olefin-containing backbones, aminosulfonate backbones, methyleneimino and methylenehydrazine backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2 components.

[0088] In some embodiments, the sense strand of the IAV RNAi reagent may contain 1, 2, 3, 4, 5, or 6 phosphate thioester bonds, and the antisense strand of the IAV RNAi reagent may contain 1, 2, 3, 4, 5, or 6 phosphate thioester bonds, or both the sense and antisense strands may independently contain 1, 2, 3, 4, 5, or 6 phosphate thioester bonds. In some embodiments, the sense strand of the IAV RNAi reagent may contain 1, 2, 3, or 4 phosphate thioester bonds, and the antisense strand of the IAV RNAi reagent may contain 1, 2, 3, or 4 phosphate thioester bonds, or both the sense and antisense strands may independently contain 1, 2, 3, or 4 phosphate thioester bonds.

[0089] In some embodiments, the sense strand of the IAV RNAi reagent contains at least two phosphate-thioester nucleoside bonds. In some embodiments, the phosphate-thioester nucleoside bonds are located between nucleotides at positions 1-3 starting from the 3' end of the sense strand. In some embodiments, one phosphate-thioester nucleoside bond is located at the 5' end of the sense strand nucleotide sequence, and another phosphate-thioester bond is located at the 3' end of the sense strand nucleotide sequence. In some embodiments, two phosphate-thioester nucleoside bonds are located at the 5' end of the sense strand, and another phosphate-thioester bond is located at the 3' end of the sense strand. In some embodiments, the sense strand does not include any phosphate-thioester nucleoside bonds between nucleotides, but contains one, two, or three phosphate-thioester bonds between terminal nucleotides at both the 5' and 3' ends and optionally present reverse debasement residues at the end cap. In some embodiments, the targeting ligand is linked to the sense strand via phosphate-thioester bonds.

[0090] In some embodiments, the antisense strand of the IAV RNAi reagent contains four phosphate-thioester nucleoside bonds. In some embodiments, the four phosphate-thioester nucleoside bonds are between nucleotides at positions 1-3 starting from the 5' end of the antisense strand, and between nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 starting from the 5' end. In some embodiments, three phosphate-thioester nucleoside bonds are located between positions 1-4 starting from the 5' end of the antisense strand, and a fourth phosphate-thioester nucleoside bond is located between positions 20-21 starting from the 5' end of the antisense strand. In some embodiments, the IAV RNAi reagent contains at least three or four phosphate-thioester nucleoside bonds in the antisense strand.

[0091] Capped residues or parts In some embodiments, the sense chain may include one or more capping residues or portions, sometimes referred to in the art as “cap,” “terminal cap,” or “capped residue.” As used herein, a “capped residue” is a nonnucleotide compound or other portion that may be incorporated at one or more ends of the nucleotide sequence of the RNAi reagent disclosed herein. In some cases, the capping residue may be to provide certain beneficial properties to the RNAi reagent, such as protection against exonuclease degradation. In some embodiments, an inverse debasement residue (invAb) (also referred to in the art as a “inverse debasement site”) is added as a capping residue (see Table 11). (See, for example, F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16). Capping residues are generally known in the art and include, for example, inverse debasement residues and carbon chains, such as terminal C3H7 (propyl), C6H 13 (Hexyl) or C 12 H 25 (Dodecyl) group. In some embodiments, the capping residue is present at the 5' end, 3' end, or both the 5' and 3' ends of the sense chain. In some embodiments, the 5' end and / or 3' end of the sense chain may include more than one reverse debased deoxyribose moiety as a capping residue.

[0092] In some embodiments, one or more inverse debase residues (invAbs) are added to the 3' end of the sense strand. In some embodiments, one or more inverse debase residues (invAbs) are added to the 5' end of the sense strand. In some embodiments, one or more inverse debase residues or inverse debase sites are inserted between the nucleotide sequences of the sense strand of the targeting ligand and the RNAi reagent. In some embodiments, one or more inverse debase residues or inverse debase sites are included at or near one or more ends of the sense strand of the RNAi reagent, allowing for enhanced activity or other desired properties of the RNAi reagent.

[0093] In some embodiments, one or more inverse debase residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverse debase residues may be inserted between the nucleotide sequences of the sense strand of the targeting ligand and the RNAi reagent. The inverse debase residues may be linked via phosphate esters, thiophosphate esters (e.g., shown herein as (invAb)s), or other nucleoside-to-nucleotide linkages. In some embodiments, including one or more inverse debase residues at or near one or more ends of the sense strand of the RNAi reagent may allow for enhanced activity or other desired properties of the RNAi reagent. In some embodiments, the inverse debase (deoxyribose) residue may be replaced with an inverse ribitol (debase ribose) residue. In some embodiments, the 3' end of the antisense core sequence or the 3' end of the antisense sequence may include an inverse debase residue. The chemical structures of the inverse debase deoxyribose residues are shown in Table 11 below.

[0094] IAV RNAi reagent The IAV RNAi reagents disclosed herein are designed to target specific locations on the influenza A virus genome (e.g., SEQ ID NO:1 (NC_026431.1) and SEQ ID NO:2-6), and these specific target locations were chosen in part because they also possess conserved sequences across a variety of other influenza genomes. As defined herein, an antisense strand sequence is designed to target the influenza A virus genome at a given location on the genome when the 5' terminal nucleobase of the antisense strand is aligned with a position 21 nucleotides downstream (towards the 3' end) from the location on the genome, provided that it pairs with a base from the genome. For example, as shown in Tables 1A, 1B, 1C, 1D, 1E, 1F, 2A, 2B, 2C, 2D, 2E, and 2F of this document, an antisense strand sequence designed to target the influenza A virus genome at position 150 requires that, when paired with a base from that genome, the 5' terminal nucleobase of the antisense strand is aligned with position 170 on the influenza A virus genome.

[0095] As provided in this article, the IAV RNAi reagent does not require the nucleobases at position 1 (5′→3′) of the antisense strand to be complementary to the viral genome, provided that there is at least 85% complementarity between the antisense strand and the viral genome of the core sequence spanning at least 17 consecutive nucleotides (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% complementarity). For example, for the IAV RNAi reagent disclosed herein designed to target position 150 of the influenza A virus genome, the 5' nucleotide of the antisense strand of the IAV RNAi reagent must be aligned with position 170 of the respective genome; however, the 5' nucleotide of the antisense strand may, but is not required to, be complementary to position 170 of the influenza A virus genome, provided that there is at least 85% complementarity between the antisense strand and the viral genome transcript spanning at least 17 consecutive nucleotides (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity). As demonstrated, particularly through the various examples disclosed herein, the specific binding sites of the antisense strand of the IAV RNAi reagent (e.g., whether the IAV RNAi reagent is designed to target the influenza A virus genome at positions 150, 429, 1217, or some other position) are important factors for the level of repression achieved by the IAV RNAi reagent. (See, for example, Kamola et al., The siRNA Non-seed Region and Its Target Sequences are Auxiliary Determinants of Off-Target Effects, PLOS Computational Biology, 11(12)). Figure 1 (2015)).

[0096] In some embodiments, the IAV RNAi reagent disclosed herein targets the influenza A virus genome at or near the respective influenza A virus genome sequences shown in Tables 1A, 1B, 1C, 1D, 1E, and 1F. In some embodiments, the antisense strand of the IAV RNAi reagent disclosed herein includes a core sequence that is fully complementary, substantially complementary, or at least partially complementary to the target influenza A virus genome 19-mer sequence disclosed in Tables 1A, 1B, 1C, 1D, 1E, and 1F.

[0097] Table 1A. Target sequences of the 19-mer of the influenza A virus genome (target regions of matrix protein 2 (M2) and matrix protein 1 (M1) genes (SEQ ID NO:1) in region 7 of the influenza A virus (A / California / 07 / 2009(H1N1)))

[0098] Table 1B. Target sequences of the 19-mer of the influenza A virus genome (target regions of the nuclear export protein (NEP) and nonstructural protein 1 (NS1) gene (SEQ ID NO:2) in region 8 of the influenza A virus (A / California / 07 / 2009(H1N1)))

[0099] Table 1C. Target sequences of the 19-mer of the influenza A virus genome (target regions of the PB1 (PB1) gene and the nonfunctional PB1-F2 protein (PB1-F2) gene (SEQ ID NO:3) of the 2-segment polymerase of influenza A virus (A / California / 07 / 2009(H1N1)))

[0100] Table 1D. Target sequence of the 19-mer of the influenza A virus genome (target region of the PB2 (PB2) gene (SEQ ID NO:4) of segment 1 polymerase of influenza A virus (A / California / 07 / 2009(H1N1)))

[0101] Table 1E. Target sequence of the 19-mer of the influenza A virus genome (target region of the nucleocapsid protein (NP) gene (SEQ ID NO:5) in segment 5 of the influenza A virus (A / California / 07 / 2009(H1N1)))

[0102] Table 1F. Target sequence of the 19-mer of the influenza A virus genome (target region of the 3-polymerase PA (PA) gene (SEQ ID NO: 6) of influenza A virus (A / California / 07 / 2009(H1N1)))

[0103] Influenza A virus (A / California / 07 / 2009(H1N1)) segment 7 matrix protein 2 (M2) and matrix protein 1 (M1) genes, complete cds (NC_026431.1) (SEQ ID NO:1), viral genome transcript (982 bases):

[0104] Although, as used in this article, the influenza A M genome segment includes both M1 and M2, when referring to the inhibition of expression of the influenza A M1 viral genome segment, it refers to an RNAi agent that targets the viral genome transcript at any location in SEQ ID NO:1.

[0105] The complete cds (NC_026432.1) (SEQ ID NO:2) of the nuclear export protein (NEP) and non-structural protein 1 (NS1) genes of influenza A virus (A / California / 07 / 2009(H1N1)), viral genome transcript (863 bases):

[0106] The complete sequence (cds) of the PB1 (PB1) segment 2 polymerase of influenza A virus (A / California / 07 / 2009(H1N1)); and the complete sequence (NC_026435.1) (SEQ ID NO:3) of the nonfunctional PB1-F2 protein (PB1-F2) transcript (2274 bases):

[0107] Influenza A virus (A / California / 07 / 2009(H1N1)) segment 1 polymerase PB2 (PB2) gene, complete cds (NC_026438.1) (SEQ ID NO:4), viral genome transcript (2280 bases):

[0108] The nucleocapsid protein (NP) gene of segment 5 of the influenza A virus (A / California / 07 / 2009(H1N1)), complete cds (NC_026436.1) (SEQ ID NO:5), viral genome transcript (1497 bases):

[0109] Influenza A virus (A / California / 07 / 2009(H1N1)) segment 3 polymerase PA (PA) gene, complete cds (NC_026437.1) (SEQ ID NO:6), viral genome transcript (2151 bases):

[0110] In some embodiments, the IAV RNAi reagent includes an antisense strand, wherein position 19 of the antisense strand (5′→3′) is capable of forming a base pair with position 1 of the 19-mer target sequence disclosed in Tables 1A, 1B, 1C, 1D, 1E, or 1F. In some embodiments, the IAV RNAi reagent includes an antisense strand, wherein position 1 of the antisense strand (5′→3′) is capable of forming a base pair with position 19 of the 19-mer target sequence disclosed in Tables 1A, 1B, 1C, 1D, 1E, or 1F.

[0111] In some embodiments, the IAV RNAi reagent includes an antisense strand, wherein position 2 of the antisense strand (5′→3′) is capable of forming a base pair with position 18 of the 19-mer target sequence disclosed in Tables 1A, 1B, 1C, 1D, 1E, or 1F. In some embodiments, the IAV RNAi reagent includes an antisense strand, wherein positions 2 to 18 of the antisense strand (5′→3′) are each capable of forming a base pair with the corresponding complementary bases located at positions 18 to 2 of the 19-mer target sequence disclosed in Tables 1A, 1B, 1C, 1D, 1E, or 1F.

[0112] For the RNAi reagents disclosed herein, the nucleotide at position 1 of the antisense strand (5' to 3') can be perfectly complementary to the influenza A virus genome, or it can be non-complementary to the target influenza A virus genome. In some embodiments, the nucleotide at position 1 of the antisense strand (5' to 3') is U, A, or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (5' to 3') forms an A:U or U:A base pair with the sense strand.

[0113] In some embodiments, the antisense strand of the IAV RNAi reagent comprises nucleotides (5' to 3') 2-18 or 2-19 of any antisense strand sequence in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, or 3F. In some embodiments, the sense strand of the IAV RNAi reagent comprises nucleotides (5' to 3') 1-17, 1-18, or 2-18 of any sense strand sequence in Tables 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, or 6F.

[0114] In some implementations, the IAV RNAi reagent consists of: (i) an antisense strand containing nucleotide (5' to 3') sequences of 2-18 or 2-19 of any antisense strand sequence in Table 2 or Table 3, and (ii) a sense strand containing nucleotide (5' to 3') sequences of 1-17 or 1-18 of any sense strand sequence in Tables 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, or 6F.

[0115] In some implementations, the IAV RNAi reagent includes the core 19-mer nucleotide sequence shown in Tables 2A, 2B, 2C, 2D, 2E and 2F below.

[0116] The sense and antisense strands of an IAV RNAi reagent comprising or consisting of nucleotide sequences from Tables 2A, 2B, 2C, 2D, 2E, and 2F may be modified or unmodified nucleotides. In some embodiments, the IAV RNAi reagent having any of the nucleotide sequences from Tables 2A, 2B, 2C, 2D, 2E, and 2F, or the sense and antisense strand sequences comprising or consisting of such sequences, is wholly or substantially entirely composed of modified nucleotides.

[0117] In some embodiments, the antisense strand of the IAV RNAi reagent disclosed herein differs from any antisense strand sequence in Tables 2A, 2B, 2C, 2D, 2E, and 2F by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the IAV RNAi reagent disclosed herein differs from any sense strand sequence in Tables 2A, 2B, 2C, 2D, 2E, and 2F by 0, 1, 2, or 3 nucleotides.

[0118] As used herein, each N listed in the sequences disclosed in Tables 2A, 2B, 2C, 2D, 2E, and 2F may be independently selected from any and all nucleobases (including nucleobases found on both modified and unmodified nucleotides). In some embodiments, the N nucleotides listed in the sequences disclosed in Tables 2A, 2B, 2C, 2D, 2E, and 2F have nucleobases complementary to the N nucleotides at the corresponding positions on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Tables 2A, 2B, 2C, 2D, 2E, and 2F have nucleobases non-complementary to the N nucleotides at the corresponding positions on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Tables 2A, 2B, 2C, 2D, 2E, and 2F have the same nucleobases as the N nucleotides at the corresponding positions on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Tables 2A, 2B, 2C, 2D, 2E and 2F have different nucleobases than the N nucleotides at the corresponding positions on the other strand.

[0119] Tables 3A, 3B, 3C, 3D, 3E, 3F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, and 10F provide the sense and antisense strands of certain modified IAV RNAi reagents. Tables 3A, 3B, 3C, 3D, 3E, and 3F provide the antisense strands of certain modified IAV RNAi reagents, along with their potential unmodified nucleotide sequences. Tables 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, and 6F provide the sense strands of certain modified IAV RNAi reagents, along with their potential unmodified nucleotide sequences. When forming IAV RNAi reagents, each nucleotide in each potential base sequence listed in Tables 3A, 3B, 3C, 3D, 3E, 3F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, and Tables 2A, 2B, 2C, 2D, 2E, 2F above can be a modified nucleotide.

[0120] The IAV RNAi reagent described herein is formed by annealing the antisense strand with the sense strand. A sense strand containing a sequence listed in Tables 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, or 6F may hybridize with any antisense strand containing a sequence listed in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, or 3F, provided that the two sequences have regions of at least 85% complementarity on adjacent 16, 17, 18, 19, 20, or 21 nucleotide sequences.

[0121] In some implementations, the antisense strand of the IAV RNAi reagent contains a nucleotide sequence of any sequence in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, or 3F.

[0122] In some embodiments, the IAV RNAi reagent comprises or is composed of a double strand having a sense and antisense nucleobase sequence of any sequence of 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F.

[0123] Examples of antisense strands containing modified nucleotides are provided in Tables 3A, 3B, 3C, 3D, 3E, and 3F. Examples of sense strands containing modified nucleotides are provided in Tables 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, and 6F.

[0124] As used in Tables 3A, 3B, 3C, 3D, 3E, 3F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, and 10F, the following symbols are used to indicate the modified nucleotide, targeting group, and linking group: A = adenosine-3'-phosphate C = cytidine-3'-phosphate G = Guanosine-3'-phosphate U = uridine 3'-phosphate I = Inosine 3'-phosphate α = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-thiophosphate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-thiophosphate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-thiophosphate i = 2'-O-methylinosine-3'-phosphate is = 2'-O-methylinosine-3'-thiophosphate t = 2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-thiophosphate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-thiophosphate Af = 2'-Fluoroadenosine-3'-phosphate Afs = 2'-Fluoroadenosine-3'-Thiophosphate Cf = 2'-Fluorocytidine-3'-phosphate Cfs = 2'-Fluorocytidine-3'-Thiophosphate Gf = 2'-Fluoroguanosine-3'-phosphate Gfs = 2'-Fluoroguanosine-3'-Thiophosphate Tf = 2'-Fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-Fluoro-5'-methyluridine-3'-thiophosphate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorouridine-3'-thiophosphate dT = 2'-deoxythymidine-3'-phosphate A UNA =2',3'-open-ring-adenosine-3'-phosphate A UNA s = 2',3'-open-ring adenosine-3'-thiophosphate C UNA =2',3'-open-ring-cytidine-3'-phosphate C UNA s = 2',3'-open-ring-cytidine-3'-thiophosphate G UNA =2',3'-open-ring-guanosine 3'-phosphate G UNA s = 2',3'-open-ring-guanosine 3'-thiophosphate U UNA =2',3'-open-ring-uridine-3'-phosphate U UNA s = 2',3'-open-ring-uridine-3'-thiophosphate a_2N = See Table 11 a_2Ns = See Table 11 (invAb) = reverse debased deoxyribonucleotide-5'-phosphate, see Table 11 (invAb)s = reverse debased deoxyribonucleotide-5'-thiophosphate ester, see Table 11 s = thiophosphate bond p = terminal phosphate ester (during synthesis) vpdN = vinylphosphonate deoxyribonucleotide cPrpa = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-phosphate (see Table 11) cPrpas = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-thiophosphate (see Table 11) cPrpu = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-phosphate (see Table 11) cPrpus = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-thiophosphate (see Table 11) (Alk-SS-C6) = See Table 11 (C6-SS-Alk) = See Table 11 (C6-SS-C6) = See Table 11 (6-SS-6) = See Table 11 (C6-SS-Alk-Me) = See Table 11 (NH2-C6) = See Table 11 (TriAlk14) = See Table 11 (TriAlk14)s = See Table 11 -C6- = See Table 11 -C6s- = See Table 11 -L6-C6- = See Table 11 -L6-C6s- = See Table 11 -Alk-cyHex- = See Table 11 -Alk-cyHexs- = See Table 11 (TA14) = See Table 11 (Structure of the combined (TriAlk14)s) (TA14)s = See Table 11 (the structure of the combined (TriAlk14)s).

[0125] As will be readily understood by those skilled in the art, unless otherwise indicated by the sequence (e.g., by phosphate thioester bonding "s"), nucleotide monomers in oligonucleotides are interconnected by 5'-3'-phosphodiester bonds. As will be clearly understood by those skilled in the art, as shown in the modified nucleotide sequences disclosed herein, phosphate thioester bonding involves replacing the phosphodiester bonds typically present in oligonucleotides. Further, it will be readily understood by those skilled in the art that the terminal nucleotide at the 3' end of a given oligonucleotide sequence typically has a hydroxyl group (-OH) rather than an isolated phosphate moiety at the corresponding 3' position of the given monomer. Additionally, for the embodiments disclosed herein, when observing the corresponding chain 5'→3', a reverse debasement residue is inserted such that the 3' position of the deoxyribose is connected at the 3' end of the previous monomer on the corresponding chain (see, for example, Table 11). Furthermore, as will be readily understood and appreciated by those skilled in the art, although the thiophosphate chemical structures depicted herein typically show an anion on the sulfur atom, the present invention disclosed herein covers all thiophosphate tautomers (e.g., where the sulfur atom has a double bond and the anion is on the oxygen atom). Unless otherwise expressly stated herein, this understanding is used when describing the IAV RNAi reagents and compositions of IAV RNAi reagents disclosed herein.

[0126] Examples of targeting and linking groups used with the IAV RNAi reagents disclosed herein are included in the chemical structures provided in Table 11 below. Each sense strand and / or antisense strand may have any of the targeting or linking groups listed herein conjugated to the 5' and / or 3' ends of the sequence, as well as other targeting or linking groups.

[0127] The IAV RNAi reagent disclosed herein is formed by annealing the antisense strand with the sense strand. A sense strand containing a sequence listed in Tables 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, or 6F can hybridize with any antisense strand containing a sequence listed in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, or 3F, provided that the two sequences have regions of at least 85% complementarity on adjacent 16, 17, 18, 19, 20, or 21 nucleotide sequences.

[0128] As shown in Tables 5A, 5B, 5C, 5D, 5E, and 5F above, certain example IAV RNAi reagent nucleotide sequences are shown to further include reactive linker groups at one or both of the 5' and 3' ends of the sense strand. For example, many of the IAV RNAi reagents shown in Tables 5A, 5B, 5C, 5D, 5E, and 5F above have a (TriAlk14) linker group at the 5' end of the nucleotide sequence. In some embodiments, other linker groups may also be present or alternatively present, such as (NH2-C6) linker groups or (6-SS-6) or (C6-SS-C6) linker groups. Such reactive linker groups are positioned to facilitate the connection of targeting ligands, targeting groups, and / or PK / PD modulators to the IAV RNAi reagents disclosed herein. Linkage or conjugation reactions are well known in the art and provide for the formation of covalent bonds between two molecules or reactants. Suitable conjugation reactions used within the scope of this invention include, but are not limited to, amide coupling reactions, Michael addition reactions, hydrazone formation reactions, inverse-demand Diels-Alder cycloaddition reactions, oxime linkages, and copper (I)-catalyzed or strain-promoted azide-alkyne cycloaddition reactions.

[0129] In some embodiments, the targeting ligand, such as the integrin targeting ligands disclosed herein and illustrated in the figures, can be synthesized as an activated ester, such as a tetrafluorophenyl (TFP) ester, which can be replaced by a reactive amino group (e.g., NH2-C6) to attach the targeting ligand to the IAV RNAi reagent disclosed herein. In some embodiments, the targeting ligand is synthesized as an azide, which can be conjugated to a propargyl (e.g., TriAlk14) or DBCO group, for example via a copper (I)-catalyzed or strain-promoted azide-alkyne cycloaddition reaction.

[0130] Additionally, certain nucleotide sequences can be synthesized as dT nucleotides with a 3' end of the sense strand followed by a (3'→5') linker (e.g., C6-SS-C6). In some embodiments, the linker can facilitate binding to additional components such as PK / PD modulators or one or more targeting ligands. As described herein, the disulfide bond of C6-SS-C6 is first reduced to remove the dT from the molecule, which can then facilitate conjugation to the desired PK / PD modulator. Therefore, the terminal dT nucleotide is not part of the fully conjugated construct.

[0131] In some embodiments, the antisense strand of the IAV RNAi reagent disclosed herein differs from any antisense strand sequence in Tables 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the IAV RNAi reagent disclosed herein differs from any sense strand sequence in Tables 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F by 0, 1, 2, or 3 nucleotides.

[0132] In some embodiments, the antisense strand of the IAV RNAi reagent comprises the nucleotide sequence of any sequence in Table 2 or Table 3. In some embodiments, the antisense strand of the IAV RNAi reagent comprises the nucleotide (5' to 3') sequences 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any sequence in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F. In some embodiments, the antisense strand of the IAV RNAi reagent comprises, or is composed of, any modified sequence of any modified sequence in Table 3 or Table 10.

[0133] In some embodiments, the sense strand of the IAV RNAi reagent comprises the nucleotide sequence of any sequence in Table 2 or Table 4. In some embodiments, the sense strand of the IAV RNAi reagent comprises the nucleotide sequence (5' end → 3' end) 1-17, 2-17, 3-17, 4-17 of any sequence in Tables 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F. 7, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, or 4-24. In some embodiments, the sense strand of the IAV RNAi reagent comprises, or consists of, any of the modified sequences in Tables 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F.

[0134] For the RNAi reagents disclosed herein, the nucleotide at position 1 of the antisense strand (5' to 3') can be either perfectly complementary to the influenza A virus genome or not complementary to it. In some embodiments, the nucleotide at position 1 of the antisense strand (5' to 3') is U, A, or dT (or a modified form of U, A, or dT). In some embodiments, the nucleotide at position 1 of the antisense strand (5' to 3') forms an A:U or U:A base pair with the sense strand.

[0135] In some embodiments, the antisense strand of the IAV RNAi reagent comprises nucleotides (5' to 3') 2-18 or 2-19 of any antisense strand sequence in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F. In some embodiments, the sense strand of the influenza A virus genome RNAi comprises nucleotides (5' to 3') 1-17 or 1-18 of any sense strand sequence in Tables 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F.

[0136] In some implementations, the IAV RNAi reagent comprises (i) an antisense strand containing nucleotides (5' to 3') 2-18 or 2-19 of any antisense strand sequence in Tables 2, 3, or 10, and (ii) a sense strand containing nucleotides (5' to 3') 1-17 or 1-18 of any sense strand sequence in Tables 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F.

[0137] A sense strand containing sequences listed in Table 2 or Table 4 can hybridize with any antisense strand containing sequences listed in Table 2 or Table 3, provided that the two sequences have regions of at least 85% complementarity on adjacent 16, 17, 18, 19, 20, or 21 nucleotide sequences. In some embodiments, the IAV RNAi reagent has a sense strand consisting of a modified sequence of any of the modified sequences in Tables 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F, and an antisense strand consisting of a modified sequence of any of the modified sequences in Tables 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F. Some representative sequence pairings are illustrated by the doubly linked ID Nos shown in Tables 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, and 9F.

[0138] In some embodiments, the IAV RNAi reagent comprises, consists of, or is substantially composed of a double strand, represented by any of the double strand ID Nos presented herein. In some embodiments, the IAV RNAi reagent consists of any of the double strand ID Nos presented herein. In some embodiments, the IAV RNAi reagent comprises the sense and antisense nucleotide sequences of any of the double strand ID Nos presented herein. In some embodiments, the IAV RNAi reagent comprises the sense and antisense nucleotide sequences of any of the double strand ID Nos presented herein, as well as a targeting group, a linker group, and / or other non-nucleotide groups, wherein the targeting group, linker group, and / or other non-nucleotide groups are covalently linked (i.e., conjugated) to the sense or antisense strand. In some embodiments, the IAV RNAi reagent comprises modified nucleotide sequences of the sense and antisense strands of any of the double strand ID Nos presented herein. In some embodiments, the IAVRNAi reagent comprises a modified nucleotide sequence of the sense and antisense strands of any duplex ID No. presented herein, as well as a targeting group, a linking group, and / or other non-nucleotide groups, wherein the targeting group, linking group, and / or other non-nucleotide groups are covalently linked to the sense or antisense strand.

[0139] In some implementations, the IAV RNAi reagent comprises an antisense strand and a sense strand having a nucleotide sequence of any antisense / sense duplex from Tables 2A, 2B, 2C, 2D, 2E, 2F, 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F, 10A, 10B, 10C, 10D, 10E, or 10F, and contains a targeting group. In some implementations, the IAV RNAi reagent comprises an antisense strand and a sense strand having a nucleotide sequence of any antisense / sense duplex from Tables 2A, 2B, 2C, 2D, 2E, 2F, 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F, 10A, 10B, 10C, 10D, 10E, or 10F, and contains one or more αvβ6 integrin targeting ligands.

[0140] In some implementations, the IAV RNAi reagent comprises an antisense strand and a sense strand having a nucleotide sequence of any antisense / sense duplex from Table 2A, 2B, 2C, 2D, 2E, 2F, 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F, 10A, 10B, 10C, 10D, 10E, or 10F, and contains a targeting group that is an integrin targeting ligand. In some implementations, the IAV RNAi reagent comprises an antisense strand and a sense strand having a nucleotide sequence of any antisense / sense duplex of Table 2A, 2B, 2C, 2D, 2E, 2F, 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F, 10A, 10B, 10C, 10D, 10E, or 10F, and contains one or more αvβ6 integrin targeting ligands or clusters of αvβ6 integrin targeting ligands (e.g., tridentate αvβ6 integrin targeting ligand).

[0141] In some implementations, the IAV RNAi reagent comprises an antisense strand and a sense strand, which are modified nucleotide sequences having any antisense / sense duplex modified by any of the following in Tables 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F, 10A, 10B, 10C, 10D, 10E, and 10F.

[0142] In some implementations, the IAV RNAi reagent comprises an antisense strand and a sense strand having modified nucleotide sequences of any antisense / sense duplex from Tables 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F, 10A, 10B, 10C, 10D, 10E, and 10F, and contains an integrin targeting ligand.

[0143] In some implementations, the IAV RNAi reagent comprises, is composed of, or is substantially composed of, any duplex of Tables 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F, 10A, 10B, 10C, 10D, 10E, and 10F.

[0144] Table 7A-1. Duplexes of IAV RNAi reagents (targeting M1) with corresponding sense and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences (linkers or conjugates not shown).

[0145] Table 7A-2. Double strands of IAV RNAi reagents (targeting NS1) with corresponding sense and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences (linkers or conjugates not shown).

[0146] Table 7A-3. Duplexes of IAV RNAi reagents (targeting PB1) with corresponding sense and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences (linkers or conjugates not shown).

[0147] Table 7A-4. Duplexes of IAV RNAi reagents (targeting PB2) with corresponding sense and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences (linkers or conjugates not shown).

[0148] Table 7A-5. Duplexes of IAV RNAi reagents (targeting NPs) with corresponding sense and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences (linkers or conjugates not shown).

[0149] Table 7A-6. Duplexes of IAV RNAi reagents (targeting PA) with corresponding sense and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences (linkers or conjugates not shown).

[0150] Table 7B-1. Double strands of IAV RNAi reagent (targeting M1) with corresponding sense and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences.

[0151] Table 7B-2. Double strands of IAV RNAi reagent (targeting NS1) with corresponding sense and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences.

[0152] Table 7B-3. Double strands of IAV RNAi reagent (targeting PB1) with corresponding sense and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences.

[0153] Table 7B-4. Double strands of IAV RNAi reagent (targeting PB2) with corresponding sense and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences.

[0154] Table 7B-5. Duplexes of IAV RNAi reagents (targeting NPs) with corresponding sense and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences.

[0155] Table 7B-6. Duplexes of IAV RNAi reagents (targeted PA) with corresponding sense and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences.

[0156] Table 8A. Duplexes of IAV RNAi reagents (targeting M1) with corresponding sense and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences. (Accompanying target ligand conjugates are shown.)

[0157] Table 8B. Duplexes of IAV RNAi reagents (targeting NS1) with corresponding sense and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences. (Accompanying targeting ligand conjugates are shown.)

[0158] Table 8C. Duplexes of IAV RNAi reagents (targeting PB1) with corresponding sense and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences. (Accompanying targeting ligand conjugates are shown.)

[0159] Table 8D. Duplexes of IAV RNAi reagents (targeting PB2) with corresponding sense and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences. (Accompanying targeting ligand conjugates are shown.)

[0160] Table 8E. Duplexes (targeting NPs) of IAV RNAi reagents with corresponding sense and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences. (Accompanying targeting ligand conjugates are shown.)

[0161] Table 8F. Duplexes of IAV RNAi reagents (targeted PA) with corresponding sense and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences. (Accompanying target ligand conjugates are shown.)

[0162] Table 9A. Double-stranded ID numbers of RNAi reagent (targeting M1) conjugates targeting specific sites on the influenza A virus genome.

[0163] Table 9B. Double-strand IDs of RNAi reagent (targeting NS1) conjugates targeting specific sites on the influenza A virus genome.

[0164] Table 9C. Double-stranded ID numbers of RNAi reagent (targeting PB1) conjugates targeting specific sites on the influenza A virus genome.

[0165] Table 9D. Double-stranded ID numbers of RNAi reagent (targeting PB2) conjugates targeting specific sites on the influenza A virus genome.

[0166] Table 9E. Double-stranded ID numbers of RNAi reagent (targeting NP) conjugates targeting sites on the influenza A virus genome.

[0167] Table 9F. Double-stranded ID numbers of RNAi reagent (targeted PA) conjugates targeting sites on the influenza A virus genome.

[0168] In some embodiments, the IAV RNAi reagent is prepared or provided as a salt, a mixed salt, or a free acid. In some embodiments, the IAV RNAi reagent is prepared or provided as a pharmaceutically acceptable salt. In some embodiments, the IAV RNAi reagent is prepared or provided as a pharmaceutically acceptable sodium or potassium salt. Upon delivery to cells expressing influenza A virus genomes, the RNAi reagents described herein inhibit or knock down the expression of one or more influenza A virus genomes in vivo and / or in vitro.

[0169] In some embodiments, the IAV RNAi reagent contains or is conjugated to one or more non-nucleotide groups, including but not limited to targeting groups, linking groups, pharmacokinetic / pharmacodynamic (PK / PD) modulators, delivery polymers, or delivery mediators. Non-nucleotide groups can enhance the targeting, delivery, or attachment of the RNAi reagent. Non-nucleotide groups can be covalently linked to the 3' and / or 5' ends of the sense and / or antisense strands. In some embodiments, the IAV RNAi reagent contains non-nucleotide groups linked to the 3' and / or 5' ends of the sense strand. In some embodiments, non-nucleotide groups are linked to the 5' end of the sense strand of the IAV RNAi reagent. Non-nucleotide groups can be directly or indirectly linked to the RNAi reagent via linker / connector groups. In some embodiments, non-nucleotide groups are linked to the RNAi reagent via unstable, cleavable, or reversible bonds or linkers.

[0170] In some embodiments, the non-nucleotide group enhances the pharmacokinetic or biodistribution properties of the RNAi reagent or conjugate to which it is attached, thereby improving the cell- or tissue-specific distribution and cell-specific uptake of the conjugate. In some embodiments, the non-nucleotide group enhances the endocytosis of the RNAi reagent.

[0171] Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of the conjugates or RNAi reagents to which they are attached, thereby improving cell-specific (in some cases, organ-specific) distribution and cell-specific (or organ-specific) uptake of the conjugates or RNAi reagents. Targeting groups can be monovalent, divalent, trivalent, tetravalent, or have a higher potency for their target. Representative targeting groups include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics (which have affinity for cell surface molecules). In some embodiments, the targeting group is linked to the RNAi reagent using a linker such as a PEG linker, or one, two, or three debased and / or ribitol (debased ribose) residues (which can act as linkers in some cases).

[0172] Targeting groups, with or without connectors, may be attached to the 5' or 3' end of any sense and / or antisense strand disclosed in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, and 10F. The adapter, with or without a targeting group, may be attached to the 5′ or 3′ end of any sense and / or antisense strand disclosed in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, and 10F.

[0173] The IAV RNAi reagents described herein can be synthesized having reactive groups, such as amino groups (also referred to herein as amines), at the 5' and / or 3' ends. These reactive groups can then be used to attach the target moiety using methods conventional in the art.

[0174] For example, in some embodiments, the IAV RNAi reagent disclosed herein is synthesized having an NH2-C6 group at the 5' end of the sense strand of the RNAi reagent. The terminal amino group can then be reacted with a group, for example, including an αvβ6 integrin targeting ligand, to form a conjugate having that group. In some embodiments, the IAV RNAi reagent disclosed herein is synthesized having one or more alkynyl groups at the 5' end of the sense strand of the RNAi reagent. The terminal alkynyl group can then be reacted with a group, for example, including an αvβ6 integrin targeting ligand, to form a conjugate having that group.

[0175] In some embodiments, the targeting group comprises an integrin targeting ligand. In some embodiments, the integrin targeting ligand is an αvβ6 integrin targeting ligand. The use of the αvβ6 integrin targeting ligand facilitates cell-specific targeting of cells having αvβ6 on their respective surfaces, and binding of the integrin targeting ligand can facilitate the entry of therapeutic agents, such as RNAi agents, to which it is attached into cells, such as epithelial cells, including lung epithelial cells and kidney epithelial cells. The integrin targeting ligand can be monomeric or monovalent (e.g., having a single integrin targeting moiety), or polymeric or multivalent (e.g., having multiple integrin targeting moieties). The targeting group can be attached to the 3' and / or 5' ends of RNAi oligonucleotides using methods known in the art. For example, the preparation of targeting groups, such as αvβ6 integrin targeting ligands, is described in International Patent Application Publication No. WO 2018 / 085415 and International Patent Application Publication No. WO 2019 / 089765, the contents of which are incorporated herein by reference in their entirety.

[0176] In some embodiments, the target group is linked to the IAV RNAi reagent without the use of an additional adapter. In some embodiments, the target group is designed to have readily available adapters to facilitate bonding with the IAV RNAi reagent. In some embodiments, when the composition includes two or more RNAi reagents, the same adapter can be used to link the two or more RNAi reagents to their respective target groups. In some embodiments, when the composition includes two or more RNAi reagents, different adapters are used to link the two or more RNAi reagents to their respective target groups.

[0177] In some embodiments, a linker group is conjugated to the RNAi reagent. The linker group facilitates the covalent connection of the reagent to a targeting group, pharmacokinetic modifier, delivery polymer, or delivery medium. The linker group may be attached to the 3' and / or 5' end of the sense or antisense strand of the RNAi reagent. In some embodiments, the linker group is attached to the sense strand of the RNAi reagent. In some embodiments, the linker group is conjugated to the 5' or 3' end of the sense strand of the RNAi reagent. In some embodiments, the linker group is conjugated to the 5' end of the sense strand of the RNAi reagent. Examples of linker groups include, but are not limited to: C6-SS-C6, 6-SS-6, reactive groups such as primary amines (e.g., NH2-C6) and alkynes, alkyl groups, debased residues / nucleotides, amino acids, triyne functionalized groups, ribitols, and / or PEG groups. Examples of certain linker groups are provided in Table 11.

[0178] A linker or connecting group is a connection between two atoms that links one chemical group (e.g., an RNAi reagent) or target segment to another chemical group (e.g., a targeting group, a pharmacokinetic modifier, or a delivery polymer) or target segment via one or more covalent bonds. Unstable bonds contain unstable bonds. Bonding may optionally include spacers that increase the distance between the two linked atoms. The spacers may further increase the flexibility and / or length of the bond. Spacers include, but are not limited to, alkyl, alkenyl, alkynyl, aryl, aralkyl, areneyl, and arynyl groups; each may contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and sugars. Spacer groups are well known in the art, and the preceding list is not intended to limit the scope of this specification. In some embodiments, the IAV RNAi reagent is conjugated to a polyethylene glycol (PEG) moiety or to a hydrophobic group having 12 or more carbon atoms, such as cholesterol or palmitoyl.

[0179] In some embodiments, the IAV RNAi reagent is linked to one or more pharmacokinetic / pharmacodynamic (PK / PD) modulators. PK / PD modulators can increase the circulation time of the conjugated drug and / or increase the activity of the RNAi reagent by improving cell receptor binding, improving cellular uptake, and / or other means. Various PK / PD modulators suitable for RNAi reagents are known in the art. In some embodiments, the PK / PD modulator may be cholesterol or a cholesterol-based derivative, or in some cases, the PK / PD modulator may be composed of alkyl, alkenyl, alkynyl, aryl, aralkyl, areneyl, or arynyl groups, each of which may be linear, branched, cyclic, and / or substituted or unsubstituted. In some embodiments, attachment of these moieties is located at the 5' or 3' end of the sense chain, at the 2' position of the ribosome ring of any given nucleotide of the sense chain, and / or at any position on the sense chain to the phosphate or thiophosphate backbone.

[0180] The nucleotide sequences of any IAV RNAi reagent listed in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, and 10F, whether modified or unmodified, may contain 3' and / or 5' targeting groups, linking groups, and / or PK / PD modulators. Any IAV RNAi reagent sequence containing a 3' or 5' targeting group, linker group, and / or PK / PD modulator, listed in Tables 3A, 3B, 3C, 3D, 3E, 3F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, and 10F or described elsewhere herein, may alternatively not contain a 3' or 5' targeting group, linker group, or PK / PD modulator, or may contain different 3' or 5' targeting groups, linker groups, or pharmacokinetic modulators, including but not limited to those depicted in Table 11. The duplex of any IAV RNAi reagent listed in Tables 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F, 10A, 10B, 10C, 10D, 10E, and 10F, whether modified or unmodified, may further include a targeting group or a linker group, including but not limited to those depicted in Table 11, and the targeting group or linker group may be attached to the 3' or 5' end of the sense or antisense strand of the duplex of the IAV RNAi reagent.

[0181] Examples of certain modified nucleotides, capped moieties, and linker groups are provided in Table 11.

[0182] Table 11. Structures of nucleotides with various modifications, capped moieties, and linker groups (where...) (Indicator connection point)

[0183] Alternatively, other linking groups known in the art may be used. In many cases, the linking group is commercially available, or alternatively, incorporated into a commercially available nucleotide phosphoramide. (See, for example, International Patent Application Publication No. WO 2019 / 161213, which is incorporated herein by reference in its entirety).

[0184] In some implementations, IAV RNAi reagents are delivered without conjugation to a targeting ligand or a pharmacokinetic / pharmacodynamic (PK / PD) modulator (referred to as "naked" or "naked RNAi reagents").

[0185] In some embodiments, the IAV RNAi reagent is conjugated to a targeting group, a linker group, a PK regulator, and / or another non-nucleotide group to facilitate delivery of the IAV RNAi reagent to selected cells or tissues, such as epithelial cells in vivo. In some embodiments, the IAV RNAi reagent is conjugated to a targeting group, wherein the targeting group includes an integrin-targeting ligand. In some embodiments, the integrin-targeting ligand is an αvβ6 integrin-targeting ligand. In some embodiments, the targeting group includes one or more αvβ6 integrin-targeting ligands.

[0186] In some embodiments, a delivery medium may be used to deliver RNAi reagents to cells or tissues. The delivery medium is a compound that improves the delivery of RNAi reagents to cells or tissues. Delivery mediators may include, but are not limited to, polymers such as amphiphilic polymers, membrane-active polymers, peptides, melittin peptides, melittin-like peptides (MLPs), lipids, reversibly modified polymers or peptides, or reversibly modified membrane-active polyamines.

[0187] In some embodiments, RNAi reagents may be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs, or other delivery systems available in the art for nucleic acid delivery. RNAi reagents may also be chemically conjugated to targeting groups, lipids (including but not limited to cholesterol groups and cholesterol derivatives), encapsulated in nanoparticles, liposomes, micelles, conjugated to polymers or DPCs (see, for example, WO 2000 / 053722, WO 2008 / 022309, WO 2011 / 104169 and WO 2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, each incorporated herein by reference), via iontophoresis, or by incorporation into other delivery media or systems available in the art, such as hydrogels, cyclodextrins, biodegradable nanocapsules, bioadhesive microspheres, or protein carriers. In some embodiments, the RNAi reagent can be conjugated to an antibody with affinity for lung epithelial cells. In some embodiments, the RNAi reagent can be linked to a targeting ligand with affinity for lung epithelial cells or a receptor present on lung epithelial cells.

[0188] Pharmaceutical compositions and formulations The IAV RNAi reagents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as "pharmaceuticals"). In some embodiments, the pharmaceutical compositions include at least one IAV RNAi reagent. These pharmaceutical compositions are specifically designed to inhibit the expression of influenza A virus genomic RNA or influenza RNA transcripts in target cells, cell populations, tissues, or organisms. The pharmaceutical compositions can be used to treat subjects suffering from a disease, condition, or status that would benefit from reduced levels of target influenza virus mRNA or RNA transcripts, or inhibition of target virus genomic expression. The pharmaceutical compositions can be used to treat subjects at risk of developing a disease or status that would benefit from reduced levels of target RNA or target virus genome. In one embodiment, the method includes administering an IAV RNAi reagent, as described herein and linked to a target ligand, to a subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including mediators, carriers, diluents, and / or delivery polymers) are incorporated into the pharmaceutical composition including the IAV RNAi reagent to form a pharmaceutical formulation or pharmaceutical agent suitable for in vivo delivery to subjects, including humans.

[0189] The pharmaceutical compositions and methods disclosed herein, including IAV RNAi reagents, reduce the level of target influenza A virus RNA in cells, cell populations, tissues, organs, or subjects. This includes inhibiting the expression of influenza A virus genomic RNA or another influenza RNA or RNA transcript in the subject by administering a therapeutically effective amount of the IAV RNAi reagent described herein. In some embodiments, the subject has previously been identified or diagnosed with an illness or condition associated with influenza infection, including influenza A virus genomic infection, such as symptoms and illnesses associated with influenza A virus infection, including but not limited to infections of the nose, throat, lungs, and other sites of the respiratory system. In some embodiments, the subject has previously been diagnosed with lung inflammation or other lung symptoms consistent with influenza infection.

[0190] Embodiments of this disclosure include pharmaceutical compositions for delivering IAV RNAi reagents to lung epithelial cells in vivo. Such pharmaceutical compositions may include, for example, IAV RNAi reagents conjugated to a targeting group comprising an integrin-targeting ligand. In some embodiments, the integrin-targeting ligand is composed of an αvβ6 integrin ligand.

[0191] In some embodiments, the pharmaceutical composition including an IAV RNAi reagent is used to treat or manage clinical presentations in subjects who would benefit from suppression of influenza A virus genome expression. In some embodiments, a therapeutically or preventively effective amount of one or more pharmaceutical compositions is administered to a subject requiring such treatment. In some embodiments, administration of any disclosed IAV RNAi reagent may be used to reduce the number, severity, and / or frequency of disease symptoms in a subject.

[0192] In some embodiments, the IAV RNAi reagent is optionally combined with one or more additional (i.e., second, third, etc.) therapeutic agents. The second therapeutic agent may be another IAV RNAi reagent (e.g., an IAV RNAi reagent targeting a different sequence within the influenza A virus genome). In some embodiments, the second therapeutic agent may be an RNAi reagent targeting the influenza A virus genome or the genome of a different influenza virus. Additional therapeutic agents may also be small molecule drugs, antibodies, antibody fragments, peptides, vaccines, and / or aptamers. The IAV RNAi reagent, with or without one or more additional therapeutic agents, may be combined with one or more excipients to form a pharmaceutical composition.

[0193] The pharmaceutical composition comprising an IAV RNAi reagent can be used to treat at least one symptom in a subject suffering from a disease or condition caused by influenza virus infection. In some embodiments, a therapeutically effective amount of one or more pharmaceutical compositions comprising an IAV RNAi reagent is administered to the subject to treat the symptoms. In other embodiments, a preventatively effective amount of one or more IAV RNAi reagents is administered to the subject to prevent or suppress at least one symptom by preventing the influenza virus from establishing itself and replicating in the cells of an organism.

[0194] The pharmaceutical composition including the IAV RNAi reagent can be used to treat at least one symptom in a subject suffering from a disease or condition caused by influenza virus infection (including potential prevention or prophylactic treatment). Influenza virus infection can be caused by influenza A subtypes, including but not limited to H1N1, H2N2, H3N2, H5N1, H7N9, and H10N8.

[0195] In some embodiments, one or more of the IAV RNAi reagents are administered to a mammal in a pharmaceutically acceptable carrier or diluent. In some embodiments, the mammal is a human.

[0196] The route of administration is the path by which the IAV RNAi reagent comes into contact with the body. Generally, methods of administering drugs, oligonucleotides, and nucleic acids for the treatment of mammals are well known in the art and can be applied to the administration of the compositions described herein. The IAV RNAi reagents disclosed herein can be administered via any suitable route in formulations appropriately tailored to a particular route. Thus, in some embodiments, the pharmaceutical compositions described herein are administered via inhalation, intranasal administration, intratracheal administration, or oropharyngeal aspiration. In some embodiments, the pharmaceutical compositions can be administered, for example, via intravenous, intramuscular, intradermal, subcutaneous, intra-articular, or intraperitoneal or local injection.

[0197] Pharmaceutical compositions comprising the IAV RNAi reagent described herein can be delivered to cells, cell populations, tissues, or subjects using oligonucleotide delivery technologies known in the art. Generally, any suitable method recognized in the art for delivering nucleic acid molecules (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery can be made via local administration (e.g., direct injection, implantation, or local application), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intramuscular, percutaneous, airway (aerosol), nasal, oral, rectal, or local (including buccal and sublingual) administration. In some embodiments, the composition is administered via inhalation, intranasal administration, oropharyngeal aspiration administration, or intratracheal administration. For example, in some embodiments, it is desirable for the IAV RNAi reagent described herein to inhibit the expression of the genome of influenza A virus or another influenza virus in the lung epithelium, and its administration via inhalation (e.g., through an inhaler device such as a metered inhaler, or a nebulizer such as a jet or vibrating mesh nebulizer, or a soft mist inhaler) is particularly suitable and advantageous.

[0198] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

[0199] As used herein, a pharmaceutical composition or agent comprises a pharmacologically effective amount of at least one of the said therapeutic compounds and one or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients are substances other than the active pharmaceutical ingredient (API, therapeutic product, such as an IAV RNAi reagent) that are intentionally included in a drug delivery system. Excipients do not exert or are not intended to exert therapeutic effects at the intended dosage. Excipients may act to: a) facilitate the processing of the drug delivery system during manufacturing, b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the API, c) aid in product identification, and / or d) enhance any other property of the overall safety and effectiveness of API delivery during storage or use. Pharmaceutically acceptable excipients may or may not be inert substances.

[0200] Excipients include, but are not limited to: absorption enhancers, anti-adhesion agents, defoamers, antioxidants, adhesives, buffers, carriers, coating agents, pigments, delivery enhancers, delivery polymers, detergents, dextran, glucose, diluents, disintegrants, emulsifiers, extenders, fillers, flavoring agents, flow aids, wetting agents, lubricants, oils, polymers, preservatives, brine, salt, solvents, sugars, surfactants, suspending agents, sustained-release matrices, sweeteners, thickeners, stretching agents, mediators, waterproofing agents, and wetting agents.

[0201] Suitable pharmaceutical compositions for injection include sterile aqueous solutions (when water-soluble) or dispersions, as well as sterile powders for the ad hoc preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, antibacterial water, etc. ELTM (BASF, Parsippany, NJ) or phosphate-buffered saline (PBS). It should be stable under manufacturing and storage conditions and should be preservative against microbial contamination such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Appropriate flowability can be maintained, for example, by using a coating such as lecithin, maintaining the desired particle size in the case of a dispersion, and using a surfactant. In many cases, it is preferable to include an isotonic agent in the composition, such as sugars, polyols such as mannitol, sorbitol, and sodium chloride. Extended absorption of the injectable composition can be achieved by including agents that delay absorption, such as aluminum monostearate and gelatin, in the composition.

[0202] A sterile injectable solution can be prepared by incorporating the desired amount of the active compound with one or a combination of the ingredients listed above as needed into a suitable solvent, followed by filtration and sterilization. Generally, a dispersion is prepared by incorporating the active compound into a sterile medium containing a base dispersion medium and other desired ingredients from those listed above. In the case of sterile powders used to prepare sterile injectable solutions, preparation methods include vacuum drying and freeze-drying, which yields a powder of the active ingredient plus any other desired ingredients from its previously sterile filtered solution.

[0203] Formulations suitable for intra-articular administration can be in the form of sterile aqueous formulations of the drug, which can be in microcrystalline form, such as aqueous microcrystalline suspensions. Liposome formulations or biodegradable polymer systems can also be used to deliver drugs for intra-articular and intraocular administration.

[0204] Formulations suitable for inhalation can be prepared by incorporating the desired amount of active compound into a suitable solvent, followed by sterile filtration. Generally, formulations for inhalation are sterile solutions at physiological pH and have low viscosity (<5 cP). Salts may be added to the formulation to balance tonic tension. In some cases, surfactants or co-solvents may be added to increase the solubility of the active compound and improve aerosol properties. In some cases, excipients may be added to control viscosity to ensure the size and distribution of atomized droplets.

[0205] In some embodiments, a pharmaceutical formulation suitable for inhalation administration can be prepared in water for injection (sterile water) or an aqueous sodium phosphate buffer, including the IAV RNAi reagents disclosed herein (e.g., IAV RNAi reagents prepared in an aqueous solution of 0.5 mM sodium dihydrogen phosphate and 0.5 mM disodium hydrogen phosphate).

[0206] The active compound can be prepared together with a carrier that protects the compound from rapid elimination from the body, such as in controlled-release formulations, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations will be readily apparent to those skilled in the art. Liposome suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, such as those described in U.S. Patent No. 4,522,811.

[0207] IAV RNAi reagents can be formulated in the composition in dose-unit form for ease of administration and uniform dosage. A dose-unit form refers to physically discrete units suitable as a unit dose for a subject to be treated; each unit contains a predetermined amount of the active compound, calculated to produce the desired therapeutic effect when bound to a desired drug carrier. Specifications regarding the dose-unit form of this disclosure are specified and directly depend on the unique characteristics of the active compound and the therapeutic effect to be achieved, as well as the inherent limitations in the field of formulating such active compounds for individualized treatment.

[0208] Pharmaceutical compositions may contain other additional components commonly found in pharmaceutical compositions. These additional components include, but are not limited to, antipruritic agents, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamines, diphenhydramine, etc.). Cells, tissues, or isolated organs expressing or containing RNAi reagents as defined herein are also envisioned as potential candidates for use as “pharmaceutical compositions.” As used herein, “pharmacologically effective amount,” “therapeuticly effective amount,” or simply “effective amount” refers to the amount of RNAi reagent that produces a pharmacological, therapeutic, or preventative outcome.

[0209] In some embodiments, in addition to applying the RNAi reagent disclosed herein, the methods disclosed herein further include the step of applying a second therapeutic agent or treatment. In some embodiments, the second therapeutic agent is another IAV RNAi reagent (e.g., an IAV RNAi reagent targeting a different sequence within the influenza A virus genome). In other embodiments, the second therapeutic agent may be a small molecule drug, antibody, antibody fragment, peptide, vaccine, and / or aptamer.

[0210] In some embodiments, compositions are described herein comprising a combination or cocktail of at least two IAV RNAi reagents having different sequences. In some embodiments, the two or more IAV RNAi reagents are each separately and independently linked to a target group. In some embodiments, the two or more IAV RNAi reagents are each linked to a target group, said target group comprising or consisting of an integrin targeting ligand. In some embodiments, the two or more IAV RNAi reagents are each linked to a target group, said target group comprising or consisting of an αvβ6 integrin targeting ligand.

[0211] This article describes a composition for delivering IAV RNAi reagent to lung epithelial cells.

[0212] Generally, the effective amount of the IAV RNAi reagent disclosed herein is in the range of about 0.0001 to about 30 mg / kg body weight / deposit dose, for example, about 0.001 to about 5 mg / kg body weight / deposit dose. In some embodiments, the effective amount of the IAV RNAi reagent is in the range of about 0.01 mg / kg to about 3.0 mg / kg body weight / deposit dose. In some embodiments, the effective amount of the IAV RNAi reagent is in the range of about 0.03 mg / kg to about 2.0 mg / kg body weight / deposit dose. In some embodiments, the effective amount of the IAV RNAi reagent is in the range of about 0.01 to about 1.0 mg / kg deposit dose / body weight. In some embodiments, the effective amount of the IAV RNAi reagent is in the range of about 0.50 to about 1.0 mg / kg deposit dose / body weight. The amount administered is also likely to depend on such variables as the patient's overall health condition, the relative biological efficacy of the delivered compound, the formulation of the drug, the presence and type of excipients in the formulation, and the route of administration. Additionally, it should be understood that the initial dose may be increased beyond the aforementioned upper limit to rapidly achieve the desired blood or tissue levels, or the initial dose may be less than the optimal dose. In some embodiments, a dose is administered daily. In some embodiments, a dose is administered weekly. In further embodiments, a dose is administered every two weeks, every three weeks, monthly, or quarterly (i.e., every three months).

[0213] For the purpose of treating a disease or for the formation of a pharmaceutical agent or composition for treating a disease, the pharmaceutical composition comprising an IAVRNAi reagent described herein may be combined with an excipient or a second therapeutic agent or treatment, the second therapeutic agent or treatment including but not limited to: a second or other RNAi reagent, a small molecule drug, an antibody, an antibody fragment, a peptide, a vaccine and / or an aptamer.

[0214] When incorporated into pharmaceutically acceptable excipients or adjuvants, the IAV RNAi reagents can be packaged into kits, containers, packages, or dispensers. The pharmaceutical compositions described herein can be packaged into dry powder or aerosol inhalers, other metered-dose inhalers, nebulizers, pre-filled syringes, or vials.

[0215] Treatment and suppression methods for influenza A virus genome The IAV RNAi reagents disclosed herein can be used to treat subjects (e.g., humans or other mammals) suffering from a disease or condition that will benefit from the administration of the RNAi reagent. In some embodiments, the RNAi reagents disclosed herein can be used to treat subjects (e.g., humans) who will benefit from reduced and / or suppressed expression of influenza A virus genomic mRNA and / or viral transcripts, or from reduced and / or suppressed expression of another influenza virus infecting the subject.

[0216] In some embodiments, the RNAi reagents disclosed herein can be used to treat subjects (e.g., humans) suffering from a disease or condition caused by influenza virus infection, including but not limited to lung inflammation or symptoms and diseases associated with influenza A virus infection, including but not limited to infections of the nose, throat, lungs, and other sites of the respiratory system. Treatment of the subject may include therapeutic and / or prophylactic treatment. A therapeutically effective amount of any one or more IAV RNAi reagents described herein is administered to the subject. The subject may be a human, a patient, or a human patient. The subject may be an adult, adolescent, child, or infant. Administration of the pharmaceutical compositions described herein may be for human or animal use.

[0217] In some embodiments, this disclosure provides methods for treating patients in need of a disease, symptom, condition, or pathological state mediated at least in part by influenza A virus genome expression, wherein said methods include administering any of the IAV RNAi reagents described herein to the patient.

[0218] In some embodiments, the IAV RNAi reagent is used to treat or manage a clinical presentation or pathological condition in a subject, wherein the clinical presentation or pathological condition is caused by influenza virus infection. A therapeutically effective amount of one or more of the IAV RNAi reagents described herein, or a composition containing an IAV RNAi reagent, is administered to the subject. In some embodiments, the method includes administering a composition containing an IAV RNAi reagent described herein to the subject to be treated.

[0219] In a further aspect, this disclosure is characterized by a method for treating (including prophylactic or preventative treatment) a disease or symptom that may be addressed by a reduction in influenza mRNA or RNA transcripts, including, for example, a reduction in influenza A virus genomic mRNA or RNA transcripts, the method comprising administering an IAV RNAi reagent to a subject in need, comprising the antisense strand of a sequence comprising any sequence from Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F. Compositions for use in such methods are also described herein.

[0220] In another aspect, this disclosure provides a method for treating (including prophylactic treatment) a pathological condition (e.g., a state or disease) caused by influenza virus infection, said method comprising administering to a subject a therapeutically effective amount of an RNAi reagent comprising an antisense strand of a sequence containing any sequence from Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F.

[0221] In some embodiments, this document discloses a method for suppressing the expression of an influenza A virus genome, wherein the method comprises administering an RNAi reagent to cells comprising an antisense strand of a sequence containing any sequence from Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F.

[0222] In some embodiments, this document discloses methods for treating (including prophylactic treatment) a pathological state at least partially mediated by influenza A virus RNA, wherein the method comprises administering to a subject a therapeutically effective amount of an RNAi reagent comprising a sense strand of a sequence containing any sequence from Tables 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F.

[0223] In some embodiments, this document discloses a method for suppressing the expression of an influenza A virus genome, wherein the method comprises administering an RNAi reagent to cells comprising a sense strand of a sequence containing any sequence from Tables 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F.

[0224] In some embodiments, this document discloses methods for treating (including prophylactic treatment) a pathological state mediated at least in part by influenza A virus genome RNA, wherein the method comprises administering to a subject a therapeutically effective amount of an RNAi reagent comprising a sense strand containing any sequence from Tables 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F, and an antisense strand containing any sequence from Tables 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F.

[0225] In some embodiments, this document discloses a method for inhibiting the expression of influenza A virus genome, wherein the method includes administering an RNAi reagent to cells comprising a sense strand containing any sequence from Tables 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F, and an antisense strand containing any sequence from Tables 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F.

[0226] In some embodiments, this document discloses a method for inhibiting influenza A virus genome expression, wherein the method comprises administering an IAV RNAi reagent to a subject, comprising a sense strand consisting of the nucleobase sequence of any sequence in Tables 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F, and an antisense strand consisting of the nucleobase sequence of any sequence in Tables 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F. In other embodiments, this document discloses a method for inhibiting influenza A virus genome expression, wherein the method comprises administering an IAV RNAi reagent to a subject, comprising a sense strand consisting of a modified sequence of any modified sequence in Tables 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F, and an antisense strand consisting of a modified sequence of any modified sequence in Tables 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F.

[0227] In some embodiments, this document discloses methods for inhibiting influenza A virus genome expression in cells, wherein the methods include administering one or more IAV RNAi reagents comprising a double-stranded structure of one of the double-stranded structures shown in Tables 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, and 9F.

[0228] In some embodiments, this document discloses methods for inhibiting influenza A virus genome expression, wherein the method includes administering one or more IAV RNAi reagents targeting the matrix protein 2 (M2) and matrix protein 1 (M1) genes of region 7 of influenza A virus (A / California / 07 / 2009(H1N1)) (referred to herein as M1). In some embodiments, this document discloses methods for inhibiting influenza A virus genome expression, wherein the method includes administering an IAV RNAi reagent to a subject, comprising a sense strand consisting of a nucleobase sequence of any sequence from Tables 4A, 5A, 6A, or 10A, and an antisense strand consisting of a nucleobase sequence of any sequence from Table 3A or 10A. In other embodiments, this document discloses methods for inhibiting influenza A virus genome expression, wherein the method includes administering an IAV RNAi reagent to a subject, comprising a sense strand consisting of a modified sequence of any modified sequence from Tables 4A, 5A, 6A, or 10A, and an antisense strand consisting of a modified sequence of any modified sequence from Table 3A or 10A.

[0229] In some embodiments, this document discloses a method for inhibiting influenza A virus genome expression, wherein the method includes administering one or more IAV RNAi reagents targeting the nuclear export protein (NEP) and nonstructural protein 1 (NS1) genes of influenza A virus (A / California / 07 / 2009(H1N1)). In some embodiments, this document discloses a method for inhibiting influenza A virus genome expression, wherein the method includes administering an IAV RNAi reagent to a subject, comprising a sense strand consisting of a nucleobase sequence of any sequence from Tables 4B, 5B, 6B, or 10B, and an antisense strand consisting of a nucleobase sequence of any sequence from Table 3B or 10B. In other embodiments, this document discloses a method for inhibiting influenza A virus genome expression, wherein the method includes administering an IAV RNAi reagent to a subject, comprising a sense strand consisting of a modified sequence of any modified sequence from Tables 4B, 5B, 6B, or 10B, and an antisense strand consisting of a modified sequence of any modified sequence from Table 3B or 10B.

[0230] In some embodiments, this document discloses methods for inhibiting influenza A virus genome expression, wherein the method includes administering one or more IAV RNAi reagents targeting the segment 2 polymerase PB1 (PB1) gene and the nonfunctional PB1-F2 protein (PB1-F2) gene of influenza A virus (A / California / 07 / 2009(H1N1)). In some embodiments, this document discloses methods for inhibiting influenza A virus genome expression, wherein the method includes administering an IAV RNAi reagent to a subject, comprising a sense strand consisting of a nucleobase sequence of any sequence from Tables 4C, 5C, 6C, or 10C, and an antisense strand consisting of a nucleobase sequence of any sequence from Tables 3C or 10C. In other embodiments, this document discloses methods for inhibiting influenza A virus genome expression, wherein the method includes administering an IAV RNAi reagent to a subject, comprising a sense strand consisting of a modified sequence of any modified sequence from Tables 4C, 5C, 6C, or 10C, and an antisense strand consisting of a modified sequence of any modified sequence from Tables 3C or 10C.

[0231] In some embodiments, this document discloses a method for inhibiting influenza A virus genome expression, wherein the method includes administering one or more IAV RNAi reagents targeting the segment 1 polymerase PB2 (PB2) gene of influenza A virus (A / California / 07 / 2009(H1N1)). In some embodiments, this document discloses a method for inhibiting influenza A virus genome expression, wherein the method includes administering an IAV RNAi reagent to a subject, comprising a sense strand consisting of a nucleobase sequence of any sequence from Tables 4D, 5D, 6D, or 10D, and an antisense strand consisting of a nucleobase sequence of any sequence from Tables 3D or 10D. In other embodiments, this document discloses a method for inhibiting influenza A virus genome expression, wherein the method includes administering an IAV RNAi reagent to a subject, comprising a sense strand consisting of a modified sequence of any modified sequence from Tables 4D, 5D, 6D, or 10D, and an antisense strand consisting of a modified sequence of any modified sequence from Tables 3D or 10D.

[0232] In some embodiments, this document discloses a method for inhibiting influenza A virus genome expression, wherein the method includes administering one or more IAV RNAi reagents targeting the nucleocapsid protein (NP) gene of segment 5 of influenza A virus (A / California / 07 / 2009(H1N1)). In some embodiments, this document discloses a method for inhibiting influenza A virus genome expression, wherein the method includes administering an IAV RNAi reagent to a subject, comprising a sense strand consisting of a nucleobase sequence of any sequence from Tables 4E, 5E, 6E, or 10E, and an antisense strand consisting of a nucleobase sequence of any sequence from Table 3E or 10E. In other embodiments, this document discloses a method for inhibiting influenza A virus genome expression, wherein the method includes administering an IAV RNAi reagent to a subject, comprising a sense strand consisting of a modified sequence of any modified sequence from Tables 4E, 5E, 6E, or 10E, and an antisense strand consisting of a modified sequence of any modified sequence from Table 3E or 10E.

[0233] In some embodiments, this document discloses a method for inhibiting influenza A virus genome expression, wherein the method includes administering one or more IAV RNAi reagents targeting the segment 3 polymerase PA (PA) gene of influenza A virus (A / California / 07 / 2009(H1N1)). In some embodiments, this document discloses a method for inhibiting influenza A virus genome expression, wherein the method includes administering an IAV RNAi reagent to a subject, comprising a sense strand consisting of a nucleobase sequence of any sequence from Tables 4F, 5F, 6F, or 10F, and an antisense strand consisting of a nucleobase sequence of any sequence from Table 3F or 10F. In other embodiments, this document discloses a method for inhibiting influenza A virus genome expression, wherein the method includes administering an IAV RNAi reagent to a subject, comprising a sense strand consisting of a modified sequence of any modified sequence from Tables 4F, 5F, 6F, or 10F, and an antisense strand consisting of a modified sequence of any modified sequence from Table 3F or 10F.

[0234] In some embodiments, this document discloses methods for inhibiting influenza A virus genome expression, wherein the methods include administering one or more IAV RNAi reagents targeting a single influenza A virus gene selected from the following: M1 (including M2), NEP, NS1, PB1, PB1-F2, PB2, NP, and PA.

[0235] In some embodiments, this document discloses methods for inhibiting influenza A virus genome expression, wherein the methods include administering one or more IAV RNAi reagents targeting a combination of two or more influenza A virus genomes selected from the following: M1 (including M2), NEP, NS1, PB1, PB1-F2, PB2, NP, and PA.

[0236] In some implementations, compared to subjects who had not received the IAV RNAi reagent or who had not received the IAV RNAi reagent, the level of influenza A virus RNA in certain epithelial cells of subjects to which the IAV RNAi reagent was administered was reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%. In some implementations, compared to subjects who had not received the IAV RNAi reagent or who had not received the IAV RNAi reagent, the level of influenza A virus subgenomic RNA in certain epithelial cells of subjects to whom the IAV RNAi reagent was administered was reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%. The levels of viral RNA transcripts, mRNA, and / or subgenomic RNA in the subjects may be reduced in the subjects' cells, cell populations, and / or tissues. In some implementations, compared to subjects who had not received the IAV RNAi reagent or who had not received the IAV RNAi reagent, the level of influenza mRNA in certain epithelial cells of subjects to whom the IAV RNAi reagent had been administered was reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%.

[0237] The reduction of viral RNA can be evaluated by any method known in the art, and is collectively referred to herein as a reduction, decrease, or suppression of the influenza A virus genome. The examples described herein illustrate known methods for evaluating the suppression of viral RNA in the influenza A virus genome.

[0238] Cells, tissues, organs and non-human organisms Cells, tissues, organs, and non-human organisms, including at least one IAV RNAi reagent described herein, are considered. Cells, tissues, organs, or non-human organisms are prepared by delivering the RNAi reagent to the cell, tissue, organ, or non-human organism.

[0239] Other illustrative implementation schemes This document provides certain additional illustrative embodiments of the disclosed technology. These embodiments are illustrative only and do not limit the scope of this disclosure or the appended claims.

[0240] 1. An RNAi reagent for inhibiting the expression of influenza A virus genome, comprising: The antisense strand comprises at least 17 adjacent nucleotides that differ from any of the sequences provided in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, or 3F by 0 or 1 nucleotide; and A sense strand contains a nucleotide sequence that is at least partially complementary to the antisense strand.

[0241] 2. The RNAi reagent of embodiment 1, wherein the antisense strand comprises nucleotides 2-18 of any sequence provided in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E or 3F.

[0242] 3. The RNAi reagent of embodiment 1 or embodiment 2, wherein the sense strand comprises a nucleotide sequence of at least 17 adjacent nucleotides differing from any one of the sequences provided in Tables 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E or 4F by 0 or 1 nucleotide, and wherein the sense strand has a region on the 17 adjacent nucleotides that is at least 85% complementary to the antisense strand.

[0243] 4. The RNAi reagent of any one of embodiments 1-3, wherein at least one nucleotide of the IAV RNAi reagent is a modified nucleotide or includes a modified internucleotide bond.

[0244] 5. An RNAi reagent for any of the implementation schemes 1-4, wherein all or substantially all nucleotides are modified nucleotides.

[0245] 6. An RNAi reagent according to any one of embodiments 4-5, wherein the modified nucleotide is selected from: 2'-O-methyl nucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2',3'-cleaved nucleotide mimic, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, debased nucleotide, ribitol, reverse nucleotide, reverse 2'-O-methyl nucleotide, reverse 2'-deoxynucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholinonucleotide, vinylphosphonate-containing nucleotide, cyclopropylphosphonate-containing nucleotide, and 3'-O-methyl nucleotide.

[0246] 7. The RNAi reagent of embodiment 5, wherein all or substantially all nucleotides are modified with 2'-O-methylnucleotides, 2'-fluoronucleotides, or combinations thereof.

[0247] 8. An RNAi reagent of any of embodiments 1-7, wherein the antisense strand comprises a nucleotide sequence of any of the modified sequences provided in Tables 3A, 3B, 3C, 3D, 3E and 3F.

[0248] 9. An RNAi reagent of any of embodiments 1-8, wherein the sense strand comprises a nucleotide sequence of any of the modified sequences provided in Tables 4A, 4B, 4C, 4D, 4E and 4F.

[0249] 10. The RNAi reagent of embodiment 1, wherein the antisense strand comprises a nucleotide sequence of any of the modified sequences provided in Tables 3A, 3B, 3C, 3D, 3E and 3F, and the sense strand comprises a nucleotide sequence of any of the modified sequences provided in Tables 4A, 4B, 4C, 4D, 4E and 4F.

[0250] 11. An RNAi reagent according to any one of embodiments 1-10, wherein the sense strand is 18 to 30 nucleotides in length and the antisense strand is 18 to 30 nucleotides in length.

[0251] 12. The RNAi reagent of embodiment 11, wherein the sense strand and antisense strand are each 18 to 27 nucleotides in length.

[0252] 13. The RNAi reagent of embodiment 12, wherein the sense strand and antisense strand are each 18 to 24 nucleotides in length.

[0253] 14. The RNAi reagent of embodiment 13, wherein the sense strand and antisense strand are each 21 nucleotides in length.

[0254] 15. The RNAi reagent of embodiment 14, wherein the RNAi reagent has two blunt ends.

[0255] 16. An RNAi reagent of any one of embodiments 1-15, wherein the sense strand comprises one or two end caps.

[0256] 17. An RNAi reagent of any one of embodiments 1-16, wherein the sense strand contains one or two reverse debasement residues.

[0257] 18. The RNAi reagent of embodiment 1, wherein the RNAi reagent comprises a sense strand and an antisense strand, the sense strand and the antisense strand forming a double strand having a structure having any one of the double strands in Tables 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F, 10A, 10B, 10C, 10D, 10E or 10F.

[0258] 19. The RNAi reagent of implementation scheme 18, wherein all or substantially all nucleotides are modified nucleotides.

[0259] 20. The RNAi reagent of embodiment 1, comprising an antisense strand, said antisense strand consisting of, substantially consisting of, or containing a nucleotide sequence, said nucleotide sequence differing from the following nucleotide sequence (5'→3') by 0 or 1 nucleotide: UUACGUUUCGACCUCGGUUAG (SEQ ID NO: 1590).

[0260] 21. The RNAi reagent of embodiment 20, wherein the sense strand consists of, is substantially composed of, or contains a nucleotide sequence, said nucleotide sequence differing from the following nucleotide sequence (5'→3') by 0 or 1 nucleotide: CUAACCGAGGUCGAAACGUAA (SEQ ID NO: 1706).

[0261] 22. The RNAi reagent of implementation scheme 20 or 21, wherein all or substantially all nucleotides are modified nucleotides.

[0262] 23. The RNAi reagent of embodiment 1, comprising an antisense strand, said antisense strand comprising, consisting of, or substantially consisting of a modified nucleotide sequence, said modified nucleotide sequence differing from one of the following nucleotide sequences (5'→3') by 0 or 1 nucleotide: cPrpusUfsascguUfucgaCfcUfcGfguuasg (SEQ ID NO:1176); or cPrpusUfsascGfuuucgaCfcUfcGfguuasg (SEQ ID NO:1175); Where a represents 2′-O-methyladenosine, c represents 2′-O-methylcytidine, g represents 2′-O-methylguanosine, and u represents 2′-O-methyluridine; Af represents 2′-fluoroadenosine, Cf represents 2′-fluorocytidine, Gf represents 2′-fluoroguanosine, and Uf represents 2′-fluorouridine; cPrpu represents 5′-cyclopropylphosphonate-2′-O-methyluridine; s represents thiophosphate bond; and all or substantially all nucleotides on the sense chain are modified nucleotides.

[0263] 24. The RNAi reagent of embodiment 1, wherein the sense strand comprises, consists of, or is substantially composed of a modified nucleotide sequence, said modified nucleotide sequence differing from one of the following nucleotide sequences (5'→3') by 0 or 1 nucleotide: csuaaccgaGfgUfcGfaaacguaa(SEQ ID NO:1373); or csuaaccgaGfgUfcgaaacguaa(SEQ ID NO:1374); Where a represents 2′-O-methyladenosine, c represents 2′-O-methylcytidine, g represents 2′-O-methylguanosine, and u represents 2′-O-methyluridine; Af represents 2′-fluoroadenosine, Cf represents 2′-fluorocytidine, Gf represents 2′-fluoroguanosine, and Uf represents 2′-fluorouridine; cPrpu represents 5′-cyclopropylphosphonate-2′-O-methyluridine; s represents thiophosphate bond; and all or substantially all nucleotides on the antisense strand are modified nucleotides.

[0264] 25. An RNAi reagent of any one of embodiments 20-24, wherein the sense strand further comprises a reverse debasement residue at the 3' end of the nucleotide sequence, at the 5' end of the nucleotide sequence, or at both.

[0265] 26. An RNAi reagent of any one of embodiments 1-25, wherein the RNAi reagent is linked to a target ligand.

[0266] 27. The RNAi reagent of embodiment 26, wherein the targeting ligand has an affinity for a cell receptor expressed on epithelial cells.

[0267] 28. The RNAi reagent of embodiment 27, wherein the targeting ligand comprises an integrin targeting ligand.

[0268] 29. The RNAi reagent of embodiment 28, wherein the integrin targeting ligand is the αvβ6 integrin targeting ligand.

[0269] 30. The RNAi reagent of embodiment 29, wherein the targeting ligand comprises the following structure: Or its pharmaceutically acceptable salt, or Or its pharmaceutically acceptable salt. in Indicates the connection point with the RNAi reagent.

[0270] 31. An RNAi reagent according to any one of embodiments 26-29, wherein the targeting ligand has a structure selected from the following: in Indicates the connection point with the RNAi reagent.

[0271] 32. The RNAi reagent of embodiment 31, wherein the RNAi reagent is conjugated to a targeting ligand having the following structure:

[0272] 33. An RNAi reagent according to any one of embodiments 26-32, wherein the targeting ligand is conjugated to the sense strand.

[0273] 34. The RNAi reagent of embodiment 33, wherein the targeting ligand is conjugated to the 5' end of the sense strand.

[0274] 35. An RNAi reagent of any one of embodiments 1-34, wherein the influenza A virus genome is selected from the following viral genomes: H1N1 virus genome; H2N2 virus genome; H3N2 virus genome; H5N1 virus genome; H7N9 virus genome; and H10N8 virus genome.

[0275] 36. A composition comprising an RNAi reagent of any one of embodiments 1-35, wherein the composition further comprises a pharmaceutically acceptable excipient.

[0276] 37. The composition of embodiment 36, further comprising a second RNAi agent capable of inhibiting the expression of influenza A virus genome.

[0277] 38. The composition of embodiment 37, wherein the influenza A virus genome is selected from the following viral genomes: H1N1 virus genome; H2N2 virus genome; H3N2 virus genome; H5N1 virus genome; H7N9 virus genome; and H10N8 virus genome.

[0278] 39. The composition of any one of embodiments 36-38, further comprising one or more additional therapeutic agents.

[0279] 40. The composition of any one of embodiments 36-39, wherein the composition is formulated for administration by inhalation.

[0280] 41. The composition of embodiment 40, wherein the composition is delivered by a metering inhaler, a jet sprayer, a vibrating mesh sprayer, or a soft mist inhaler.

[0281] 42. A composition of any one of embodiments 36-41, wherein the RNAi reagent is a sodium salt.

[0282] 43. The composition of embodiment 36, wherein the pharmaceutically acceptable excipient is water for injection.

[0283] 44. The composition of embodiment 36, wherein the pharmaceutically acceptable excipient is a buffered saline solution.

[0284] 45. A method for inhibiting influenza A virus genome expression in cells and / or treating one or more symptoms or diseases associated with influenza A virus infection, the method comprising introducing an effective amount of an RNAi reagent into cells and / or administering it to a subject, wherein the RNAi reagent targets an M1 influenza A virus genome segment transcript having an antisense strand comprising at least 15 adjacent nucleotides complementary to a segment of at least 15 adjacent nucleotides of SEQ ID NO. 1, differing by 0, 1, 2, or 3 nucleotides, and wherein the RNAi reagent is optionally linked to a targeting ligand, preferably wherein the targeting ligand has an affinity for a cellular receptor expressed on epithelial cells, and most preferably wherein the targeting ligand is an αvβ6 integrin targeting ligand.

[0285] 46. ​​A method for inhibiting the expression of influenza A virus genome in cells, the method comprising introducing an effective amount of the RNAi reagent of any one of embodiments 1-35 or the composition of any one of embodiments 36-44 into the cells.

[0286] 47. The method of embodiment 45 or 46, wherein the influenza A virus genome is selected from the following viral genomes: H1N1 virus genome; H2N2 virus genome; H3N2 virus genome; H5N1 virus genome; H7N9 virus genome; and H10N8 virus genome.

[0287] 48. The method of any one of embodiments 45-47, wherein the cells are within the subject.

[0288] 49. The method of implementation scheme 48, wherein the subject is a human subject.

[0289] 50. The method of any one of embodiments 45-49, wherein the influenza A virus genome is suppressed by at least about 30% after the application of the RNAi reagent.

[0290] 51. A method for treating one or more symptoms or diseases associated with influenza A virus infection, the method comprising administering to a human subject in need a therapeutically effective amount of a composition of any one of embodiments 36-44.

[0291] 52. The method of implementation scheme 45 or implementation scheme 51, wherein the disease is a respiratory disease.

[0292] 53. The method of implementation scheme 52, wherein the respiratory disease is lung inflammation.

[0293] 54. The method of implementation scheme 52, wherein the disease is influenza A virus infection.

[0294] 55. The method of embodiment 54, wherein the influenza A virus infection is caused by a subtype of influenza A virus selected from: H1N1; H2N2; H3N2; H5N1; H7N9; and H10N8.

[0295] 56. The method of any one of embodiments 45-55, wherein the RNAi reagent is administered at a deposition dose of about 0.01 mg / kg to about 5.0 mg / kg of the subject's body weight.

[0296] 57. The method of any one of embodiments 45-56, wherein the RNAi reagent is administered at a deposition dose of about 0.03 mg / kg to about 2.0 mg / kg of the subject's body weight.

[0297] 58. The method of any one of embodiments 45-57, wherein the RNAi reagent is administered in two or more doses.

[0298] 59. The use of any one of the RNAi reagents in Implementation Schemes 1-35 for the treatment of diseases, conditions or symptoms mediated at least in part by influenza A virus genome activity and / or influenza A virus genome expression.

[0299] 60. Use of a composition according to any one of embodiments 36-44 for the treatment of at least part of a disease, condition or symptom mediated by influenza A virus genomic activity and / or influenza A virus genomic expression.

[0300] 61. Use of a composition according to any one of embodiments 36-44 for manufacturing a pharmaceutical agent for treating at least a portion of a disease, condition, or symptom mediated by influenza A virus genome and / or influenza A virus genome expression.

[0301] 62. The use of any one of implementation schemes 59-61, wherein the disease is influenza infection.

[0302] 63. A method for manufacturing an RNAi reagent according to any one of embodiments 1-35, comprising annealing the sense strand and antisense strand to form a double-stranded ribonucleic acid molecule.

[0303] 64. The method of implementation scheme 63, wherein the sense chain comprises a targeting ligand.

[0304] 65. The method of implementing 64, which includes conjugating a target ligand to a sense chain.

[0305] The implementation schemes and projects provided above will now be illustrated by the following non-limiting examples. Example

[0306] Example 1. Synthesis of IAV RNAi reagent.

[0307] The double strands of the IAV RNAi reagent disclosed herein were synthesized as follows: A. Synthesis. The sense and antisense strands of the IAV RNAi reagent are synthesized using the solid-phase phosphoramide technique employed in oligonucleotide synthesis. Depending on scale, the following steps are taken: (Bioautomation) (Bioautomation), or OP Pilot 100 (GE Healthcare). Synthesis is carried out using controlled-porosity glass (CPG). or The procedure was performed on a solid support prepared from Prime Synthesis (Aston, PA, USA). All RNA and 2'-modified RNA phosphoramide were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the 2'-O-methylphosphoramide used comprised the following: (5'-O-dimethoxytriphenylmethyl-N... 6 -(benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide, 5'-O-dimethoxy-triphenylmethyl-N 45'-(acetyl)-2'-O-methylcytidine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide, 5'-O-dimethoxytriphenylmethyl-N2-(isobutyryl)-2'-O-methylguanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide, and 5'-O-dimethoxytriphenylmethyl-2'-O-methyluridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide. 2'-Deoxy-2'-fluorophosphamide carries the same protecting group as 2'-O-methylRNAphosphamide (amidite). 5'-Dimethoxytriphenylmethyl-2'-O-methylinosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide was purchased from Glen. Research (Virginia). Reverse debasing (3'-O-dimethoxytriphenylmethyl-2'-deoxyribose-5'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide was purchased from ChemGenes (Wilmington, MA, USA). The following UNA phosphoramid was used: 5'-(4,4'-dimethoxytriphenylmethyl)-N6-(benzoyl)-2',3'-open-ring-adenosine, 2' -benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramide, 5'(4,4'-dimethoxytriphenylmethyl)-N-acetyl-2',3'-open-ring-cytosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramide, 5'-(4,4'-dimethoxytriphenylmethyl)-N-isobutyryl-2',3'-open-ring-guanosine, 2'-benzoyl-3'-[(2- [(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramide and 5'-(4,4'-dimethoxytriphenylmethyl)-2',3'-open-ring-uridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramide. The TFA-linked phosphoramide was also commercially available (ThermoFisher). The linker L6, as propargyl-PEG5-NHS, was purchased from BroadPharm (catalog #BP-20907) and coupled to the NH2-C6 group from the amino-linked phosphoramide using standard coupling conditions to form -L6-C6-. Similarly, the linker Alk-cyHex, as a propargyl-containing phosphoramide compound, was commercially available from Lumiprobe (alkyne phosphoramide, 5'-terminal) to form the linker -Alk-cyHex-. In each case, the conditions described herein for introducing thiophosphate bonds were used.Cyclopropylphosphonate phosphoramide was synthesized according to International Patent Application Publication No. WO 2017 / 214112 (see also Altenhofer et al., Chem. Communications (Royal Soc. Chem.), 57(55):6808-6811 (July 2021)). The (NAG37)s targeting ligand phosphoramide compound used to synthesize the RNAi reagent disclosed herein for performing certain SEAP studies described below was synthesized according to International Patent Application Publication No. WO 2018 / 044350 granted to Arrowhead Pharmaceuticals, Inc.; the phosphoramide compound containing the targeting ligand was added during the solid-phase oligonucleotide synthesis process described herein.

[0308] The triacetylene-containing phosphoramide was dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other phosphoramides were dissolved in anhydrous acetonitrile (50 mM), and molecular sieves were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM acetonitrile solution) or 5-ethylthio-1H-tetrazole (ETT, 250 mM acetonitrile solution) was used as the activating agent solution. Coupling times were 10 minutes (RNA), 90 seconds (2'O-Me), and 60 seconds (2'F). To introduce thiophosphate bonding, a 100 mM solution of 3-phenyl-1,2,4-dithioazolin-5-one (POS, from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.

[0309] Alternatively, a triyne moiety is introduced post-synthesis (see section E below). For this pathway, the sense chain is functionalized with a 5' and / or 3' terminal nucleotide containing a primary amine. The TFA-linked phosphoramidite is dissolved in anhydrous acetonitrile (50 mM), and a molecular sieve is added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM acetonitrile solution) or 5-ethylthio-1H-tetrazole (ETT, 250 mM acetonitrile solution) was used as the activating agent solution. Coupling times were 10 minutes (RNA), 90 seconds (2'O-Me), and 60 seconds (2'F). To introduce thiophosphate bonding, a 100 mM solution of 3-phenyl-1,2,4-dithioazolin-5-one (POS, from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.

[0310] B. Cleavage and deprotection of support-bound oligomers. After solid-phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40% by weight aqueous methylamine and 28% to 31% ammonium hydroxide solution (Aldrich) at 30°C for 1.5 hours. The solution was evaporated, and the solid residue was reconstituted in water (see below).

[0311] C. Purification. Crude oligomers were purified by anion-exchange HPLC using a TSKgel SuperQ-5PW 13μm column and a Shimadzu LC-8 system. Buffer A consisted of 20 mM Tris, 5 mM EDTA, pH 9.0, and 20% acetonitrile, while buffer B was identical to buffer A with the addition of 1.5 M sodium chloride. UV traces were recorded at 260 nm. Appropriate fractions were combined and run on size-resistance HPLC using a GE Healthcare XK 16 / 40 column packed with Sephadex G25 Fine, with a run buffer of 100 mM ammonium bicarbonate, pH 6.7, and 20% acetonitrile. Alternatively, the combined fractions were desalted and exchanged via tangential flow filtration into a suitable buffer or solvent system.

[0312] D. Annealing. Complementary strands were mixed to form an RNAi reagent by combining equimolar amounts of RNA solutions (sense and antisense) in 1×PBS (phosphate-buffered saline, 1×, Corning, Cellgro). Some of the RNAi reagent was lyophilized and stored at -15 to -25°C. The duplex concentration was determined by measuring the absorbance of the solution in 1×PBS on a UV-Vis spectrometer. The duplex concentration was then determined by multiplying the absorbance at 260 nm by a conversion factor (0.050 mg / (mLcm)) and a dilution factor.

[0313] E. Conjugation of the triyne linker. In some embodiments, the triyne linker serves as a sense chain conjugation of the phosphorus amide to the RNAi reagent on the resin (see Example 1G for the synthesis of the exemplary triyne linker phosphorus amide, and Example 1A for the conjugation of the phosphorus amide). In other embodiments, the triyne linker may be conjugated to the sense chain after cleavage from the resin as described below: before or after annealing, in some embodiments, a 5' or 3' amine-functionalized sense chain is conjugated to the triyne linker. Exemplary triyne linker structures that can be used to form the constructs disclosed herein are as follows: To conjugate the triyne linker with the annealed duplex, the amine-functionalized duplex was dissolved at a concentration of ~50-70 mg / mL in 90% DMSO / 10% H2O. 40 equivalents of triethylamine were added, followed by 3 equivalents of triyne-PNP. After completion, the conjugate was precipitated twice in a 1x phosphate-buffered saline / acetonitrile (1:14 ratio) solvent system and dried.

[0314] F. Synthesis of the targeting ligand SM6.1 ((S)-3-(4-(4-((14-azido-3,6,9,12-tetraoxatetradecyl)oxy)naphth-1-yl)phenyl)- 3-(2-(4-((4-methylpyridin-2-yl)amino)butyramido)acetamido)propionic acid) Compound 5 (tert-butyl(4-methylpyridin-2-yl)carbamate) (0.501 g, 2.406 mmol, 1 equivalent) was dissolved in DMF (17 mL). NaH (0.116 mg, 3.01 mmol, 1.25 equivalent, 60% dispersion in oil) was added to the mixture. The mixture was stirred for 10 minutes, and then compound 20 (ethyl 4-bromobutyrate (0.745 g, 3.82 mmol, 0.547 mL)) (Sigma 167118) was added. After 3 hours, the reaction was quenched with ethanol (18 mL) and concentrated. The concentrate was dissolved in DCM (50 mL), washed with a saturated aqueous solution of NaCl (1 x 50 mL), dried over Na₂SO₄, filtered, and concentrated. The product was purified on a silica gel column using a DCM solution with a gradient of 0–5% methanol.

[0315] Compound 21 (0.80 g, 2.378 mmol) was dissolved in 100 mL of acetone: 0.1 M NaOH [1:1]. The reaction was monitored by TLC (5% ethyl acetate in hexane solution). The organic matter was concentrated away, and the residue was acidified to pH 3–4 with 0.3 M citric acid (40 mL). The product was extracted with DCM (3 x 75 mL). The organic matter was combined, dried over Na₂SO₄, filtered, and concentrated. The product was used without further purification.

[0316] At 0 °C, diisopropylethylamine (2.06 mL, 11.85 mmol, 3 equivalents) was added to anhydrous DMF (10 mL) containing compound 22 (1.1 g, 3.95 mmol, 1 equivalent), compound 45 (595 mg, 4.74 mmol, 1.2 equivalents), and TBTU (1.52 g, 4.74 mmol, 1.2 equivalents). The reaction mixture was heated to room temperature and stirred for 3 hours. The reaction was quenched with saturated NaHCO3 solution (10 mL). The aqueous phase was extracted with ethyl acetate (3 x 10 mL), and the organic phases were combined, dried over anhydrous Na2SO4, and concentrated. Silica gel was used as the stationary phase. Separate products. LC-MS: calculated as [M+H]+366.20, found to be 367.

[0317] At 0 °C, K₂CO₃ (2.48 g, 17.93 mmol, 2 equivalents) was added to an anhydrous DMF (10 mL) solution of compound 61 (2 g, 8.96 mmol, 1 equivalent) and compound 62 (2.13 mL, 17.93 mmol, 2 equivalents). The reaction mixture was heated to room temperature and stirred overnight. The reaction was quenched with water (10 mL). The aqueous phase was extracted with ethyl acetate (3 x 10 mL), and the organic phases were combined, dried over anhydrous Na₂SO₄, and concentrated. Silica gel was used as the stationary phase. Separation products.

[0318] At 0 °C, lithium hydroxide monohydrate (0.61 g, 14.53 mmol, 3 equivalents) was added aliquoted to a solution of compound 60 (1.77 g, 4.84 mmol, 1 equivalent) in THF (5 mL) and H₂O (5 mL). The reaction mixture was heated to room temperature. After stirring at room temperature for 3 hours, the reaction mixture was acidified to pH 3.0 with HCl (6N). The aqueous phase was extracted with ethyl acetate (3 x 20 mL), and the organic layers were combined, dried over Na₂SO₄, and concentrated. LC-MS: calculated as [M + H] + 352.18, found to be 352.

[0319] At 78 °C, a hexane solution of n-BuLi (3.6 mL, 9.0 mmol, 1.5 equivalence) was added dropwise to an anhydrous THF (20 mL) solution of compound 63 (1.88 g, 6.0 mmol, 1.0 equivalence). The reaction was maintained at -78 °C for 1 hour. Then, triisopropyl borate (2.08 mL, 9.0 mmol, 1.5 equivalence) was added to the mixture at -78 °C. The reaction was then heated to room temperature and stirred for another hour. The reaction was quenched with a saturated NH4Cl solution (20 mL) and the pH was adjusted to 3. The aqueous phase was extracted with EtOAc (3 x 20 mL), and the organic phases were combined, dried over Na2SO4, and concentrated.

[0320] Compound 12 (300 mg, 0.837 mmol, 1.0 equivalent), compound 65 (349 mg, 1.256 mmol, 1.5 equivalent), XPhos Pd G2 (13 mg, 0.0167 mmol, 0.02 equivalent), and K3PO4 (355 mg, 1.675 mmol, 2.0 equivalent) were mixed in a round-bottom flask. The flask was sealed with a screw-top diaphragm and then evacuated and backfilled with nitrogen (this process was repeated a total of 3 times). Then, THF (8 mL) and water (2 mL) were added via syringe. The mixture was bubbled with nitrogen for 20 minutes and the reaction was kept overnight at room temperature. The reaction was quenched with water (10 mL), and the aqueous phase was extracted with ethyl acetate (3 × 10 mL). The organic phase was dried on Na2SO4, concentrated, and purified using silica gel as the stationary phase via... Purification was performed, and the sample was eluted with a 15% EtOAc solution in hexane. LC-MS: calculated value was [M+H]+ 512.24, observed value was 512.56.

[0321] Compound 66 (858 mg, 1.677 mmol, 1.0 equivalent) was cooled in an ice bath. A dioxane solution of HCl (8.4 mL, 33.54 mmol, 20 equivalent) was added to the flask. The reaction was heated to room temperature and stirred for 1 hour. The solvent was removed by rotary evaporator, and the product was used directly without further purification. LC-MS: calculated value of [M+H]+ 412.18, found value of 412.46.

[0322] At 0 °C, diisopropylethylamine (0.744 mL, 4.268 mmol, 3 equivalents) was added to an anhydrous DMF (15 mL) solution of compound 64 (500 mg, 1.423 mmol, 1 equivalent), compound 67 (669 mg, 1.494 mmol, 1.05 equivalents), and TBTU (548 mg, 0.492 mmol, 1.2 equivalents). The reaction mixture was heated to room temperature and stirred for another 1 hour. The reaction was quenched with a saturated aqueous solution of NaHCO3 (10 mL), and the product was extracted with ethyl acetate (3 x 20 mL). The organic phases were combined, dried over Na2SO4, and concentrated. The product was extracted using silica gel as the stationary phase. Purification was performed, and elution was carried out with a 3-4% methanol-DCM solution. The yield was 96.23%. LC-MS: calculated value was [M+H]+745.35, found value was 746.08.

[0323] At room temperature, 10% Pd / C (0.15 g, 50% H2O) was added to a 10 mL solution of compound 68 (1.02 g, 1.369 mmol, 1 equivalent) in ethyl acetate. The reaction mixture was heated to room temperature, and the reaction was monitored by LC-MS. The reaction was maintained overnight at room temperature. The solid was filtered and the solvent was removed by rotary evaporator. The product was used directly without further purification. LC-MS: [M+H]+655.31, detection 655.87.

[0324] At 0 °C, K₂CO₃ (42 mg, 0.305 mmol, 2 equivalents) was added to an anhydrous DMF (2 mL) solution of compound 69 (100 mg, 0.152 mmol, 1 equivalent) and azide-PEG5-OTs (128 mg, 0.305 mmol, 2 equivalents). The reaction mixture was stirred at 80 °C for 6 h. The reaction was quenched with saturated NaHCO₃ solution, and the aqueous layer was extracted with ethyl acetate (3 x 10 mL). The organic phases were combined, dried over Na₂SO₄, and concentrated. LC-MS: calculated as [M+H] + 900.40, found as 901.46.

[0325] At room temperature, lithium hydroxide (5 mg, 0.197 mmol, 3.0 equivalent) was added to a solution of compound 72 (59 mg, 0.0656 mmol, 1.0 equivalent) in THF (2 mL) and water (2 mL). The mixture was stirred for another 1 hour at room temperature. The pH was adjusted to 3.0 with HCl (6N), and the aqueous phase was extracted with EtOAc (3 x 10 mL). The organic phases were combined, dried over Na2SO4, and concentrated. TFA (0.5 mL) and DCM (0.5 mL) were added to the residue, and the mixture was stirred for another 3 hours at room temperature. The solvent was removed by rotary evaporator. LC-MS: calculated as [M+H]+786.37, found as 786.95.

[0326] Synthesis of G. TriAlk 14 TriAlk14 and (TriAlk14)s, as shown in Table 11 above, may be synthesized using the synthetic routes shown below. Compound 14 may be added to the sense chain as a phosphoramidite using standard oligonucleotide synthesis techniques, or compound 22 may be conjugated to the sense chain containing an amine in an amide coupling reaction.

[0327] 500 mL of DCM and 4 (75.0 g, 0.16 mol) were added to a 3-L jacketed reactor. The internal temperature of the reaction was cooled to 0 °C and TBTU (170.0 g, 0.53 mol) was added. The suspension was then treated dropwise with amine 5 (75.5 g, 0.53 mol) while maintaining the internal temperature below 5 °C. The reaction was then slowly treated with DIPEA (72.3 g, 0.56 mol) while maintaining the internal temperature below 5 °C. After the addition was complete, the reaction was heated to 23 °C over 1 hour and stirred for 3 hours. A kicker charge of 10% of all three reagents was added and stirred for another 3 hours. The reaction was considered complete when <1% of 4 remained. The reaction mixture was washed with saturated ammonium chloride solution (2 x 500 mL) and once with saturated sodium bicarbonate solution (500 mL). The organic layer was then dried on sodium sulfate and concentrated into an oil. The crude oil weighed 188 g and contained 72% 6 by QNMR. The crude oil is then carried over to the next step. Regarding C... 46 H 60 N4O 11 The calculated mass is 845.0 m / z. The discovered [M+H] is 846.0.

[0328] 121.2 g of crude oil containing 72 wt% compound 6 (86.0 g, 0.10 mol) was dissolved in DMF (344 mL) and treated with TEA (86 mL, 20 v / v%) while maintaining an internal temperature below 23 °C. The solution was then analyzed by HPLC method 1 (…). Figure 2 The formation of dibenzo-fullene (DBF) consumed relative to Fmoc-amine 6 was monitored, and the reaction was completed within 10 hours. Glutaric anhydride (12.8 g, 0.11 mol) was added to the solution, and intermediate amine 7 was converted to compound 8 within 2 hours. After completion, DMF and TEA were removed under reduced pressure at 30 °C to give 100 g of crude oil. Due to the high solubility of compound 7 in water, aqueous post-treatment could not be used, and chromatography was the only way to remove DBF, TMU, and glutaric anhydride. Crude oil (75 g) was processed at Teledyne ISCO. Purification was performed in triplicate on the purification system. The crude oil (25 g) was loaded onto a 330 g silica gel column and eluted from 0–20% methanol / DCM over 30 minutes to give 42 g of compound 8 (54% yield after 3 steps). Regarding C... 36 H 55 N4O 12 The calculated mass is 736.4 m / z. The discovered [M+H] is 737.0.

[0329] Compound 8 (42.0 g, 0.057 mol) was co-stripped with 10 volumes of acetonitrile prior to use to remove any residual methanol from the chromatography solvent. The oil was redissolved in DMF (210 mL) and cooled to 0 °C. The solution was treated with 4-nitrophenol (8.7 g, 0.063 mol), followed by EDC-hydrochloride (12.0 g, 0.063 mol), and the reaction was found to be complete within 10 hours. The solution was cooled to 0 °C, and 10 volumes of ethyl acetate, followed by 10 volumes of saturated ammonium chloride solution, were added, keeping the internal temperature below 15 °C. The layers were allowed to separate, and the ethyl acetate layer was washed with brine. The combined aqueous layers were extracted twice with 5 volumes of ethyl acetate. The combined organic layers were dried on sodium sulfate and concentrated to oil. Crude oil (55 g) was obtained at Teledyne ISCO. Purification was performed in triplicate on the purification system. The crude oil (25 g) was loaded onto a 330 g silica gel column and eluted from 0–10% methanol / DCM over 30 minutes to give 22 g of pure compound 9 (50% yield). Regarding C... 42 H 59 N5O 14 The calculated mass is 857.4 m / z. The discovered [M+H] is 858.0.

[0330] A solution of ester 9 (49.0 g, 57.1 mmol) and 6-amino-1-hexanol (7.36 g, 6.28 mmol) in dichloromethane (3 volumes) was treated dropwise with triethylamine (11.56 g, 111.4 mmol). The reaction was monitored by observing the disappearance of compound 9 on HPLC method 1, and it was found that the reaction was completed within 10 minutes. The crude reaction mixture was diluted with 5 volumes of dichloromethane and washed with saturated ammonium chloride (5 volumes) and brine (5 volumes). The organic layer was dried over sodium sulfate and concentrated to an oil. The reaction was completed using a 330 g silica gel column in Teledyne ISCO. The crude oil was purified using a purification system. 4-Nitrophenol was eluted with 100% ethyl acetate, and the column was washed for 10 minutes with 20% methanol / DCM to give a colorless oil (39 g, 81% yield). Regarding C... 42 H 69 N5O 12 The calculated mass is 836.0 m / z. The discovered [M+H] is 837.0.

[0331] Alcohol 10 was co-stripped twice with 10 volumes of acetonitrile to remove any residual methanol from the chromatography solvent, and then co-stripped once with anhydrous dichloromethane (KF < 60 ppm) to remove trace amounts of water. Alcohol 10 (2.30 g, 2.8 mmol) was dissolved in 5 volumes of anhydrous dichloromethane (KF < 50 ppm) and treated with diisopropylammonium tetrazolium (188 mg, 1.1 mmol). The solution was cooled to 0 °C and treated dropwise with 2-cyanoethyl N,N,N',N'-tetraisopropylphosphonamide (1.00 g, 3.3 mmol). The solution was removed from the ice bath and stirred at 20 °C. The reaction was found to be complete within 3–6 hours. The reaction mixture was cooled to 0 °C and treated with 10 volumes of a 1:1 solution of saturated ammonium bicarbonate / brine, then heated to ambient temperature over 1 minute and allowed to stir at 20 °C for another 3 minutes. The two-phase mixture was transferred to a separatory funnel and 10 volumes of dichloromethane were added. The organic layer was separated and washed with 10 volumes of saturated sodium bicarbonate solution to hydrolyze the unreacted diphosphorus reagent. The organic layer was dried over sodium sulfate and concentrated to an oil to give 3.08 g of compound 14 (94 wt%). (Regarding C...) 51 H 86 N7O 13 The calculated mass of P is 1035.6 m / z. The discovered [M+H] = 1036.

[0332] H. Conjugation of the Target Ligand. The 5' or 3' tridentate alkyne-functionalized sense chain is conjugated to the target ligand before or after annealing. The following example describes the conjugation of the target ligand to the annealed duplex: Stock solutions of 0.5 M tris(3-hydroxypropyltriazolylmethyl)amine (THPTA), 0.5 M copper(II) sulfate pentahydrate (Cu(II)SO4·5H2O), and 2 M sodium ascorbate were prepared in deionized water. A 75 mg / mL solution of the target ligand in DMSO was prepared. 25 μL of 1 M Hepes pH 8.5 buffer was added to a 1.5 mL centrifuge tube containing the trikyne-functionalized duplex (3 mg, 75 μL, 40 mg / mL deionized water, ~15,000 g / mol). After vortexing, 35 μL of DMSO was added, and the solution was vortexed. Add the targeting ligand to the reaction (6 equivalents / dichain, 2 equivalents / alkyne, ~15 μL) and vortex the solution. Check the pH using pH paper and confirm it is ~8. In a separate 1.5 mL centrifuge tube, mix 50 μL of 0.5 M THPTA with 10 μL of 0.5 M Cu(II)SO4·5H2O, vortex, and incubate at room temperature for 5 minutes. After 5 minutes, add the THPTA / Cu solution (7.2 μL, 6 equivalents 5:1 THPTA:Cu) to the reaction vial and vortex. Immediately afterwards, add 2 M ascorbate (5 μL, 50 equivalents / dichain, 16.7 / alkyne) to the reaction vial and vortex. Once the reaction is complete (usually within 0.5–1 hour), immediately purify the reaction by non-denaturing anion exchange chromatography.

[0333] Example 2. Influenza A / Puerto Rico / 8 / 34PR8 mouse model.

[0334] To investigate the effects of the IAV RNAi reagent, an influenza A / Puerto Rico / 8 / 34PR8 mouse model (“PR8 mouse model”) was established. The influenza A / Puerto Rico / 8 / 34 (PR8) strain is a Biosafety Level 2 (BSL2) virus that has been widely used in the laboratory as a mouse influenza model for studying acute lung injury / inflammation. PR8 has previously been shown to cause severe pathogenicity in mice (CF Basler, et al., Sequence of the 1918 pandemic influenza virus nonstructural gene (NS) segment and characterization of recombinant viruses bearing the 1918NS genes. Proc Natl Acad Sci USA 98, 2746–2751 (2001)). PR8 has been passaged more than 100 times in mice, ferrets and embryo-containing eggs, resulting in complete viral attenuation and inability to replicate in humans (Annex 5, WHO Technical Report Series No. 941, 2007).

[0335] C57BL / 6 mice were infected with PR8, and subsequently administered an IAV RNAi reagent to the PR8-infected mice. C57BL / 6 mice were also first administered the IAV RNAi reagent and then subsequently infected with PR8. The optimal sublethal dose of PR8 infection was determined by examining weight loss following PR8 infection. If the animal's weight loss exceeded 20% of its pre-dose body weight, the viral dose was determined to be lethal rather than optimal. Accordingly, the PR8 dose was subsequently adjusted against the optimal sublethal dose.

[0336] Example 3. Mouse model of influenza A / California / 07 / 2009H1N1.

[0337] To study the effects of IAV RNAi reagents, a mouse model of influenza A / California / 07 / 2009H1N1 (“CA07 H1N1 mouse model”) was established. The influenza A / California / 07 / 2009(H1N1) (hereinafter “CA07 H1N1”) strain is a biosafety level 2 (BSL2) virus and has emerged with rapid human-to-human transmission, triggering the first pandemic of the 21st century. Rockman S, Laurie K, Barr I. Pandemic Influenza Vaccines: What did we learn from the 2009 Pandemic and are we better prepared now? Vaccines (Basel). May 7, 2020; 8(2):211. doi:10.3390 / vaccines8020211.PMID:32392812; PMCID:PMC7349738. This virus replaced the previous A(H1N1) and has continued to spread as a seasonal virus to this day.

[0338] C57BL / 6 mice were infected with CA07 H1N1, and subsequently administered the IAV RNAi reagent to the CA07 H1N1-infected mice. C57BL / 6 mice were also first administered the IAV RNAi reagent and then subsequently infected with CA07 H1N1. The optimal sublethal dose of CA07 H1N1 infection was determined by examining weight loss following CA07 H1N1 infection. If the animal's weight loss exceeded 20% of its pre-dose body weight, the viral dose was determined to be lethal rather than optimal. Accordingly, the CA07 H1N1 dose was subsequently adjusted relative to the optimal sublethal dose.

[0339] Example 4. IAV RNAi reagent was subsequently administered in vivo to mice infected with PR8.

[0340] Following Example 3 (“PR8 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with PR8. On days 1 and 3, four (n=4) mice (for group 1) and six (n=6) mice (for groups 2–6) were administered via intratracheal (IT) with the IAV RNAi reagent (at 3 mg / kg) in saline or a saline-based formulation. On day 8, the animals were administered via intranasal (IN) injection with PR8 (BEI) in PBS or a PBS-based formulation. Dosing was performed according to Table 12 below.

[0341] Table 12. Dosage in mice used in Example 4

[0342] The PR8 dose was quantified using EID50 (50% of the chicken embryo infection dose). This EID50 dose was determined to be the optimal sublethal dose using the PR8 mouse model described in Example 2 above.

[0343] Animals were euthanized on day 14. Bronchoalveolar lavage fluid (BALF) and lungs (both left and right lungs) were collected and harvested. The expression of mouse H1N1 and M1 in the right lung was determined using qPCR, normalized relative to group 2 with 18S rRNA as an endogenous control gene. Mean H1N1 and M1 expression per animal in lung tissue was normalized relative to group 2 (no RNAi reagent + PR8 infection). Results are shown in Table 13 below.

[0344] Table 13. Mean relative expression of H1N1 and M1 in mouse lungs in Example 4.

[0345] Groups 3, 5, and 6 showed a reduction in H1N1, with group 3 (AC02564) showing a particularly significant 90% inhibition of H1N1 (0.093). Similarly, groups 3, 5, and 6 showed a reduction in M1, with group 3 (AC02564) again showing a reduction of approximately 87% (0.135). As noted in Tables 8A, 8C, 8D, and 8E above, the IAV RNAi reagent in group 3 (AC002564) targets the M1 vRNA region of influenza A (Table 8A); the IAV RNAi reagent in group 4 (AC002567) targets the PB1 vRNA region of influenza A (Table 8C); the IAV RNAi reagent in group 5 (AC002568) targets the PB2 vRNA region of influenza A (Table 8D); and the IAV RNAi reagent in group 6 (AC002569) targets the NP vRNA region of influenza A (Table 8E). While targeting any specific vRNA segment across multiple conserved viral genome variants in the influenza A genome could potentially provide therapeutic efficacy, targeting the M1 vRNA segment, such as the group 3 IAV RNAi reagent (AC002564), is particularly promising. M1 is the most abundant protein in the influenza virus particle and plays a crucial role in many aspects of the viral life cycle, including the transport of influenza A virus ribonucleoproteins (vRNPs) between the cytoplasm and nucleus; the regulation of vRNP transcription and replication; interactions with viral envelope proteins; and the recruitment and initiation of budding of viral and host components at assembly sites. Mutations in M1 are extremely rare. At least for these reasons, M1 is highly conserved, and although it is generally considered the optimal vRNA segment target for broad-spectrum influenza A vaccines, no vaccines targeting M1 are currently available. Furthermore, while several attempts have been made to develop small molecules targeting M1, none have been successful to date.

[0346] Figure 2 Immunohistochemistry (IHC) of mouse lungs infected with PR8 (or uninfected with PBS) is shown at 6 days post-infection or day 14 of the experiment. Mouse lung tissue was stained for anti-hemagglutinin (anti-HA) influenza A virus H1N1 IgG according to the manufacturer's instructions; the anti-HA immunogen is a recombinant protein containing the sequence of the C-terminal region of influenza A virus H1N1 HA (hemagglutinin) (A / WSN / 1933(H1N1)) (GeneTex, catalog #:GTX127357). Figure 2As shown, on day 14 (6 days post-PR8 infection), RNAi reagent AC002564 showed a significant reduction in influenza A virus replication, as demonstrated by the reduced anti-HA staining in mice administered AC002564+PR8 compared to mice administered saline (without IAV RNAi reagent)+PR8, consistent with the reductions reported in Table 13 above.

[0347] Example 5. IAV RNAi reagent was subsequently administered in vivo to mice infected with PR8.

[0348] Following Example 3 (“PR8 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with PR8. On days 1 and 3, four (n=4) mice (for group 1) and six (n=6) mice (for groups 2–6) were administered via intratracheal (IT) with the IAV RNAi reagent (at 3 mg / kg) in saline or a saline-based formulation. On day 7, the animals were administered via intranasal (IN) injection with PR8 (BEI) in PBS or a PBS-based formulation. Dosing was performed according to Table 14 below.

[0349] Table 14. Dosage in mice used in Example 5

[0350] The PR8 dose was quantified using EID50 (50% of the chicken embryo infection dose). This EID50 dose was determined to be the optimal sublethal dose using the PR8 mouse model described in Example 2 above.

[0351] Animals were euthanized on day 14. Lungs (both left and right) were collected and harvested. H1N1 expression in the right lung was determined using qPCR, with 18S rRNA as an endogenous control gene. Mean H1N1 expression in lung tissue per animal was normalized relative to group 2 (no RNAi reagent + PR8 infection). Results are shown in Table 15 below.

[0352] Table 15. Mean relative expression of H1N1 in mouse lungs in Example 5. The reduction in H1N1 is not visible in this embodiment.

[0353] Example 6. IAV RNAi reagent was subsequently administered in vivo to mice infected with PR8.

[0354] Following Example 3 (“PR8 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with PR8. On days 1 and 3, four (n=4) mice (for group 1) and six (n=6) mice (for groups 2–6) were administered via intratracheal (IT) with the IAV RNAi reagent (at 3 mg / kg) in saline or a saline-based formulation. On day 15, the animals were administered via intranasal (IN) injection with PR8 (BEI) in PBS or a PBS-based formulation. Dosing was performed according to Table 16 below.

[0355] Table 16. Dosage administration to mice in Example 6.

[0356] The PR8 dose was quantified using EID50 (50% of the chicken embryo infection dose). This EID50 dose was determined to be the optimal sublethal dose using the PR8 mouse model described in Example 2 above.

[0357] Animals were euthanized on day 18. Lungs (both left and right) were collected and harvested. Mouse H1N1 expression in the lungs was determined using qPCR, with B2M as an endogenous control gene. Mean H1N1 expression in lung tissue per animal was normalized relative to group 2 (no RNAi reagent + PR8 infection). Results are shown in Table 17 below.

[0358] Table 17. Mean relative expression of H1N1 in mouse lungs in Example 6.

[0359] Only a very limited reduction in H1N1 is visible in this embodiment, if any (i.e., group 4).

[0360] Example 7. IAV RNAi reagent was subsequently administered in vivo to mice infected with PR8.

[0361] Following Example 3 (“PR8 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with PR8. On days 1 and 3, four (n=4) mice (for group 1) and six (n=6) mice (for groups 2–5) were administered via intratracheal (IT) with the IAV RNAi reagent (at 3 mg / kg) in saline or a saline-based formulation. On day 8, the animals were administered via intranasal (IN) injection with PR8 (BEI) in PBS or a PBS-based formulation. Dosing was performed according to Table 18 below.

[0362] Table 18. Dosing to mice in Example 7.

[0363] The PR8 dose was quantified using EID50 (50% of the chicken embryo infection dose). This EID50 dose was determined to be the optimal sublethal dose using the PR8 mouse model described in Example 2 above.

[0364] Animals were euthanized on day 13. Lungs (both left and right lungs) were collected and harvested. The expression of mouse H1N1 and M1 in the lungs was determined using qPCR, with B2M as an endogenous control gene. Mean H1N1 and M1 expression in lung tissue per animal was normalized relative to group 2 (no RNAi reagent + PR8 infection). Results are shown in Table 19 below.

[0365] Table 19. Mean relative expression of H1N1 and M1 in mouse lungs in Example 7.

[0366] Groups 3 and 5 showed a reduction in H1N1, with group 3 (AC002564) showing a reduction of nearly 96% (0.041) in H1N1. Groups 3 and 5 similarly showed a reduction in M1, with group 3 (AC002564) again showing a reduction of approximately 95% (0.054) in M1.

[0367] Example 8. IAV RNAi reagent was subsequently administered in vivo to mice infected with PR8.

[0368] Following Example 3 (“PR8 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with PR8. On days 1 and 4, four (n=4) mice (for group 1) and six (n=6) mice (for groups 2–9) were administered via intratracheal (IT) with the IAV RNAi reagent (at 3 mg / kg) in saline or a saline-based formulation. On days 9, 16, 23, or 30, the animals were administered via intranasal (IN) injection with PR8 (BEI) in PBS or a PBS-based formulation. Administration was performed according to Table 20 below.

[0369] Table 20. Dosing to mice in Example 8.

[0370] The PR8 dose was quantified using EID50 (50% of the chicken embryo infection dose). This EID50 dose was determined to be the optimal sublethal dose using the PR8 mouse model described in Example 2 above.

[0371] Animals were sacrificed at days 16, 23, 30, or 37 according to Table 20 above. Bronchoalveolar lavage fluid (BALF) and lungs (both left and right lungs) were collected and harvested. The expression of mouse H1N1 and M1 in the lungs was determined using qPCR, with B2M as an endogenous control gene. Mean H1N1 and M1 expression in lung tissue per animal was normalized relative to Group 2 (no RNAi reagent + PR8 infection on day 9). Results are shown in Table 21 below.

[0372] Table 21. Mean relative expression of H1N1 and M1 in mouse lungs in Example 7.

[0373] The reduction of H1N1 and M1 from IAV RNAi reagent AC002564 (groups 6-9) showed that the meaningful knockdown persisted at least until day 23 in this PR8 mouse model in this example.

[0374] Example 9. IAV RNAi reagent was subsequently administered in vivo to mice infected with PR8.

[0375] Female C57Bl / 6 mice were administered IAV RNAi reagent and subsequently infected with PR8. On days 1 and 4, four (n=4) mice (for group 1) and six (n=6) mice (for groups 2–7) were administered via intratracheal (IT) with IAV RNAi reagent in saline or saline-reconstituted form at 0.5 mg / kg, 1 mg / kg, and 3 mg / kg. On day 8, animals were administered via intranasal (IN) injection with PR8 (BEI) in PBS or PBS-reconstituted form. Administration was performed according to Table 22 below.

[0376] Table 22. Dosage administration to mice in Example 9.

[0377] The PR8 dose was quantified using EID50 (50% of the chicken embryo infection dose). This EID50 dose was determined to be the optimal sublethal dose using the PR8 mouse model described in Example 2 above.

[0378] Animals were sacrificed on day 14 or 21 according to Table 22 above. Lungs (both left and right lungs) were collected and harvested. The expression of mouse H1N1 and M1 in the lungs was determined using qPCR, with B2M as an endogenous control gene. The mean H1N1 and M1 expression in lung tissue per animal was normalized relative to group 2 (no RNAi reagent + PR8 infection on day 8). The results are shown in Table 23 below.

[0379] Table 23. Mean relative expression of H1N1 and M1 in mouse lungs in Example 9.

[0380] Groups 4–6 showed decreased H1N1 and M1 levels in the PR8 mouse model up to day 14. Data were not available for mice sacrificed on day 21 (groups 3 and 7).

[0381] Example 10. IAV RNAi reagent was subsequently administered in vivo to mice infected with PR8.

[0382] Following Example 3 (“PR8 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with PR8. On days 1 and 3, four (n=4) mice (for group 1) and six (n=6) mice (for groups 2–3) were administered via intratracheal (IT) with the IAV RNAi reagent (at 3 mg / kg) in saline or a saline-based formulation. On day 8, the animals were administered via intranasal (IN) injection with PR8 (BEI) in PBS or a PBS-based formulation. Dosing was performed according to Table 24 below.

[0383] Table 24. Dosage administration to the mouse animals used in Example 10.

[0384] The PR8 dose was quantified using EID50 (50% of the chicken embryo infection dose). This EID50 dose was determined to be the optimal sublethal dose using the PR8 mouse model described in Example 2 above.

[0385] Animals were euthanized on day 15. Lungs (both left and right lungs) were collected and harvested. The expression of mouse H1N1 and M1 in the lungs was determined using qPCR, normalized relative to group 2 with 18S rRNA as an endogenous control gene. Mean H1N1 and M1 expression per animal in lung tissue was normalized relative to group 2 (no RNAi reagent + PR8 infection). Results are shown in Table 25 below.

[0386] Table 25. Mean relative expression of H1N1 and M1 in mouse lungs in Example 10.

[0387] Group 3 showed reductions in H1N1 and M1, with a near 90-91% reduction in H1N1 and M1 by day 15 when 2x3.0 mg / kg doses were used before PR8 virus challenge (0.094, 0.088).

[0388] Example 11. IAV RNAi reagent was subsequently administered in vivo to mice infected with PR8.

[0389] Following Example 3 (“PR8 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with PR8. On days 1 and 3, four (n=4) mice (for group 1) and six (n=6) mice (for groups 2–3) were administered via intratracheal (IT) with the IAV RNAi reagent (at 3 mg / kg) in saline or a saline-based formulation. On day 7, the animals were administered via intranasal (IN) injection with PR8 (BEI) in PBS or a PBS-based formulation. Dosing was performed according to Table 26 below.

[0390] Table 26. Administration to the mouse animals used in Example 11.

[0391] The PR8 dose was quantified using EID50 (50% of the chicken embryo infection dose). This EID50 dose was determined to be the optimal sublethal dose using the PR8 mouse model described in Example 2 above.

[0392] Animals were euthanized on day 15. Lungs (both left and right lungs) were collected and harvested. The expression of mouse H1N1 and M1 in the lungs was determined using qPCR, with 18S rRNA as an endogenous control gene. Mean H1N1 and M1 expression in lung tissue per animal was normalized relative to group 2 (no RNAi reagent + PR8 infection). Results are shown in Table 27 below.

[0393] Table 27. Mean relative expression of H1N1 and M1 in mouse lungs in Example 9.

[0394] Group 3 showed reductions in H1N1 and M1, with a near 92-93% reduction in H1N1 and M1 on day 15 when 2x3.0 mg / kg doses were used before PR8 virus challenge (0.076, 0.083).

[0395] Example 12. IAV RNAi reagent was subsequently administered in vivo to mice infected with PR8.

[0396] Following Example 3 (“PR8 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with PR8. On days 1 and 3, four (n=4) mice (for group 1) and five (n=5) mice (for groups 2–8) were administered via intratracheal (IT) with the IAV RNAi reagent (at 3 mg / kg) in saline or a saline-based formulation. On day 8, the animals were administered via intranasal (IN) injection with PR8 (BEI) in PBS or a PBS-based formulation. Dosing was performed according to Table 28 below.

[0397] Table 28. Administration to mice in Example 12.

[0398] The PR8 dose was quantified using EID50 (50% of the chicken embryo infection dose). This EID50 dose was determined to be the optimal sublethal dose using the PR8 mouse model described in Example 2 above.

[0399] Animals were euthanized on day 15. Lungs (both left and right lungs) were collected and harvested. The expression of mouse H1N1 and M1 in the lungs was determined using qPCR, with 18S rRNA as an endogenous control gene. Mean H1N1 and M1 expression in lung tissue per animal was normalized relative to group 2 (no RNAi reagent + PR8 infection). Results are shown in Table 29 below.

[0400] Table 29. Mean relative expression of H1N1 and M1 in mouse lungs in Example 12.

[0401] Relatively moderate reductions in H1N1 and M1 were observed in groups 4 and 5, while virtually no reductions from the IAV RNAi reagent were observed in groups 3, 6, 7, and 8.

[0402] Example 13. IAV RNAi reagent was subsequently administered in vivo to mice infected with PR8.

[0403] Following Example 3 (“PR8 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with PR8. On days 1 and 3, four (n=4) mice (for group 1) and five (n=5) mice (for groups 2–8) were administered via intratracheal (IT) with the IAV RNAi reagent (at 3 mg / kg) in saline or a saline-based formulation. On day 8, the animals were administered via intranasal (IN) injection with PR8 (BEI) in PBS or a PBS-based formulation. Dosing was performed according to Table 30 below.

[0404] Table 30. Dosing to mice in Example 13.

[0405] The PR8 dose was quantified using EID50 (50% of the chicken embryo infection dose). This EID50 dose was determined to be the optimal sublethal dose using the PR8 mouse model described in Example 2 above.

[0406] Animals were euthanized on day 14. Lungs (both left and right lungs) were collected and harvested. The expression of mouse H1N1 and M1 in the lungs was determined using qPCR, with 18S rRNA as an endogenous control gene. Mean H1N1 and M1 expression in lung tissue per animal was normalized relative to group 2 (no RNAi reagent + PR8 infection). Results are shown in Table 31 below.

[0407] Table 31. Mean relative expression of H1N1 and M1 in mouse lungs in Example 13.

[0408]

[0409] Groups 3-8 showed only relatively moderate reductions in H1N1 and M1.

[0410] Example 14. IAV RNAi reagent was subsequently administered in vivo to mice infected with PR8.

[0411] Following Example 3 (“PR8 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with PR8. On days 1 and 3, four (n=4) mice (for group 1) and five (n=5) mice (for groups 2–8) were administered via intratracheal (IT) with the IAV RNAi reagent (at 3 mg / kg) in saline or a saline-based formulation. On day 8, the animals were administered via intranasal (IN) injection with PR8 (BEI) in PBS or a PBS-based formulation. Dosing was performed according to Table 32 below.

[0412] Table 32. Dosing to mice in Example 14.

[0413] The PR8 dose was quantified using EID50 (50% of the chicken embryo infection dose). This EID50 dose was determined to be the optimal sublethal dose using the PR8 mouse model described in Example 2 above.

[0414] Animals were euthanized on day 15. Lungs (both left and right lungs) were collected and harvested. The expression of mouse H1N1 and M1 in the lungs was determined using qPCR, with 18S rRNA as an endogenous control gene. Mean H1N1 and M1 expression in lung tissue per animal was normalized relative to group 2 (no RNAi reagent + PR8 infection). Results are shown in Table 33 below.

[0415] Table 33. Mean relative expression of H1N1 and M1 in mouse lungs in Example 14.

[0416] Groups 3, 4, 6, and 7 showed only relatively moderate reductions in H1N1 and M1.

[0417] Example 15. IAV RNAi reagent administered in vivo to mice previously infected with PR8.

[0418] Following Example 3 (“PR8 model mice”), female C57Bl / 6 mice were infected with PR8 and subsequently administered IAV RNAi reagent. On day 1, four (n=4) mice (for group 1) and five (n=5) mice (for groups 2–11) were administered PR8 (BEI) via intranasal (IN) injection in PBS or PBS-reconstituted. On day 5, the animals were administered IAV RNAi reagent (at 3 mg / kg) via intratracheal (IT) administration in saline or saline-reconstituted at 3 mg / kg. Dosing was performed according to Table 34 below.

[0419] Table 34. Dosage administration to mice in Example 15.

[0420] The PR8 dose was quantified using EID50 (50% of the chicken embryo infection dose). This EID50 dose was determined to be the optimal sublethal dose using the PR8 mouse model described in Example 2 above.

[0421] Animals were sacrificed on days 5, 6, 7, 8, 9, or 10, as per Table 34 above. Lungs (both left and right lungs) were collected and harvested. The expression of mouse H1N1 and M1 in the lungs was determined using qPCR, with 18S rRNA as an endogenous control gene. Mean H1N1 and M1 expression in lung tissue per animal was normalized relative to each control group treated with saline; group 3 was normalized to group 2, group 5 to group 4, group 7 to group 6, group 9 to group 8, and group 11 to group 10. Results are shown in Table 35 below.

[0422] Table 35. Mean relative expression of H1N1 and M1 in mouse lungs in Example 15.

[0423] Groups 3, 5, 7, 9, and 11 showed reductions in H1N1 and M1. Specifically, group 11 showed a ~92% reduction in H1N1 (0.074) and a ~93% reduction in M1 (0.065) on day 9.

[0424] Example 16. IAV RNAi reagent was subsequently administered in vivo to mice infected with CA07 H1N1.

[0425] Following Example 4 (“CA07 H1N1 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with CA07. On days 1 and 3, four (n=4) mice (for group 1) and five (n=5) mice (for groups 2–8) were administered via intratracheal (IT) with the IAV RNAi reagent (at 3 mg / kg) in saline or saline-based formulation. On day 8, the animals were administered via intranasal (IN) injection with CA07 H1N1 in PBS or PBS-based formulation. Dosing was performed according to Table 36 below.

[0426] Table 36. Dosage administration to the mouse animals used in Example 16.

[0427] The CA07 dose was quantified using TCID50 (50% of the tissue culture infection dose). Following the CA07 mouse model described in Example 3 above, this TCID50 dose was determined to be the optimal sublethal dose.

[0428] Animals were euthanized on day 14. Lungs (both left and right lungs) were collected and harvested. The expression of mouse H1N1 and M1 in the lungs was determined using qPCR, with 18S rRNA as an endogenous control gene. Mean H1N1 and M1 expression in lung tissue per animal was normalized relative to group 2 (no RNAi reagent + CA07 infection). Results are shown in Table 37 below.

[0429] Table 37. Mean relative expression of H1N1 and M1 in mouse lungs in Example 16.

[0430] Groups 3-8 each showed a decrease in H1N1 and M1.

[0431] Example 17. IAV RNAi reagent was subsequently administered in vivo to mice infected with CA07 H1N1.

[0432] Following Example 4 (“CA07 H1N1 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with CA07. On days 1 and 3, four (n=4) mice (for group 1) and five (n=5) mice (for groups 2–8) were administered via intratracheal (IT) with the IAV RNAi reagent (at 3 mg / kg) in saline or saline-based formulation. On day 8, the animals were administered via intranasal (IN) injection with CA07 H1N1 in PBS or PBS-based formulation. Dosing was performed according to Table 38 below.

[0433] Table 38. Dosage administration to the mouse animals used in Example 17.

[0434] The CA07 dose was quantified using TCID50 (50% of the tissue culture infection dose). Following the CA07 mouse model described in Example 3 above, this TCID50 dose was determined to be the optimal sublethal dose.

[0435] Animals were euthanized on day 14. Lungs (both left and right lungs) were collected and harvested. The expression of mouse H1N1 and M1 in the lungs was determined using qPCR, with 18S rRNA as an endogenous control gene. Mean H1N1 and M1 expression in lung tissue per animal was normalized relative to group 2 (no RNAi reagent + CA07 infection). Results are shown in Table 39 below.

[0436] Table 39. Mean relative expression of H1N1 and M1 in mouse lungs in Example 17.

[0437] Groups 3-8 each showed a decrease in H1N1 and M1.

[0438] Example 18. IAV RNAi reagent was subsequently administered in vivo to mice infected with CA07 H1N1.

[0439] Following Example 4 (“CA07 H1N1 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with CA07. On days 1 and 3, four (n=4) mice (for group 1) and five (n=5) mice (for groups 2–8) were administered via intratracheal (IT) with the IAV RNAi reagent (at 3 mg / kg) prepared in saline or saline. On day 8, the animals were infected via intranasal (IN) injection with CA07 H1N1 prepared in PBS or 4240 TCID50 in PBS. Administration was performed according to Table 40 below.

[0440] Table 40. Dosing to mice in Example 18.

[0441] The CA07 dose was quantified using TCID50 (50% of the tissue culture infection dose). Following the CA07 mouse model described in Example 3 above, this TCID50 dose was determined to be the optimal sublethal dose.

[0442] Animals were euthanized on day 14. Lungs (both left and right lungs) were collected and harvested. The expression of mouse H1N1 and M1 in the lungs was determined using qPCR, with 18S rRNA as an endogenous control gene. Mean H1N1 and M1 expression in lung tissue per animal was normalized relative to group 2 (no RNAi reagent + CA07 infection). Results are shown in Table 41 below.

[0443] Table 41. Mean relative expression of H1N1 and M1 in mouse lungs in Example 18.

[0444] The IAV RNAi reagent in group 3 (AC002601) was particularly potent, showing reductions of more than 86% in both H1N1 and M1, while the IAV RNAi reagents in the remaining groups (i.e., groups 4–8) showed only moderate inhibition of H1N1 and M1 or no inhibition in some cases.

[0445] Example 19. IAV RNAi reagent was subsequently administered in vivo to mice infected with CA07 H1N1.

[0446] Following Example 4 (“CA07 H1N1 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with CA07. On days 1 and 3, four (n=4) mice (for group 1) and five (n=5) mice (for groups 2–8) were administered via intratracheal (IT) with the IAV RNAi reagent (at 3 mg / kg) in saline or saline-based formulation. On day 8, the animals were administered via intranasal (IN) injection with CA07 H1N1 in PBS or PBS-based formulation. Dosing was performed according to Table 42 below.

[0447] Table 42. Dosage administration to the mouse animals used in Example 19.

[0448] The CA07 dose was quantified using TCID50 (50% of the tissue culture infection dose). Following the CA07 mouse model described in Example 3 above, this TCID50 dose was determined to be the optimal sublethal dose.

[0449] Animals were euthanized on day 14. Lungs (both left and right lungs) were collected and harvested. The expression of mouse H1N1 and M1 in the lungs was determined using qPCR, with 18S rRNA as an endogenous control gene. Mean H1N1 and M1 expression in lung tissue per animal was normalized relative to group 2 (no RNAi reagent + CA07 infection). Results are shown in Table 43 below.

[0450] Table 43. Mean relative expression of H1N1 and M1 in mouse lungs in Example 19.

[0451] Groups 3 and 8 showed significant reductions in H1N1 and M1; groups 4 and 5 showed more moderate reductions in H1N1 and M1; and groups 6 and 7 showed no reduction in H1N1 and only very limited reductions in M1.

[0452] Example 20. IAV RNAi reagent was subsequently administered in vivo to mice infected with CA07 H1N1.

[0453] Following Example 4 (“CA07 H1N1 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with CA07. On days 1 and 3, four (n=4) mice (for group 1) and five (n=5) mice (for groups 2–8) were administered via intratracheal (IT) with the IAV RNAi reagent (at 1.5 mg / kg) in saline or saline-based formulation. On day 8, the animals were administered via intranasal (IN) injection with CA07H1N1 in PBS or PBS-based formulation. Dosing was performed according to Table 44 below.

[0454] Table 44. Dosing to mice in Example 20.

[0455] The CA07 dose was quantified using TCID50 (50% of the tissue culture infection dose). Following the CA07 mouse model described in Example 3 above, this TCID50 dose was determined to be the optimal sublethal dose.

[0456] Animals were euthanized on day 14. Lungs (both left and right lungs) were collected and harvested. The expression of mouse H1N1 and M1 in the lungs was determined using qPCR, with 18S rRNA as an endogenous control gene. Mean H1N1 and M1 expression in lung tissue per animal was normalized relative to group 2 (no RNAi reagent + CA07 infection). Results are shown in Table 45 below.

[0457] Table 45. Mean relative expression of H1N1 and M1 in mouse lungs in Example 20.

[0458] Groups 3-8 each showed a significant reduction in both H1N1 and M1.

[0459] Example 21. IAV RNAi reagent was subsequently administered in vivo to mice infected with CA07 H1N1.

[0460] Following Example 4 (“CA07 H1N1 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with CA07. On days 1 and 3, eight mice (n=8) (for groups 1–5) were administered via intratracheal (IT) with the IAV RNAi reagent (at 3 mg / kg) in saline or saline-based formulation. On day 8, the animals were administered via intranasal (IN) injection with CA07 H1N1 in PBS or PBS-based formulation. Dosing was performed according to Table 46 below.

[0461] Table 46. Dosing to mice in Example 21.

[0462] The CA07 dose was quantified using TCID50 (50% of the tissue culture infection dose).

[0463] The animals were sacrificed on day 22. The mice were observed for body weight and survival rate after CA07 infection. Survival rates are shown in Table 47 below.

[0464] Table 47. Survival rate of test animals in Example 21 after CA07 infection.

[0465] Treatment with AC002601, followed by a subsequent infection with CA07 (12000 TCID50), resulted in a 100% survival rate at day 11 post-infection. Treatment with AC002601, followed by a subsequent infection with CA07 (24000 TCID50), resulted in an 87.5% survival rate at day 11 post-infection. This contrasts with a survival rate of only 12.5% ​​at day 11 in group 2 and 0% at day 7 in group 4, where the same infection was administered to mice without the IAV RNAi reagent.

[0466] Example 22. IAV RNAi reagent was subsequently administered in vivo to mice infected with CA07 H1N1.

[0467] Following Example 4 (“CA07 H1N1 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with CA07. On days 1 and 3, four (n=4) mice (for group 1) and five (n=5) mice (for groups 2–8) were administered via intratracheal (IT) with the IAV RNAi reagent (at 3 mg / kg) in saline or saline-based formulation. On day 8, the animals were administered via intranasal (IN) injection with CA07 H1N1 in PBS or PBS-based formulation. Dosing was performed according to Table 48 below.

[0468] Table 48. Dosing to mice in Example 22.

[0469] The CA07 dose was quantified using TCID50 (50% of the tissue culture infection dose). Following the CA07 mouse model described in Example 3 above, this TCID50 dose was determined to be the optimal sublethal dose.

[0470] Animals were euthanized on day 14. Lungs (both left and right lungs) were collected and harvested. The expression of mouse H1N1 and M1 in the lungs was determined using qPCR, with 18S rRNA as an endogenous control gene. Mean H1N1 and M1 expression in lung tissue per animal was normalized relative to group 2 (no RNAi reagent + CA07 infection). Results are shown in Table 49 below.

[0471] Table 49. Mean relative expression of H1N1 and M1 in mouse lungs in Example 22.

[0472] Group 3 showed a significant reduction in H1N1 and M1.

[0473] Example 23. IAV RNAi reagent was subsequently administered in vivo to mice infected with CA07 H1N1.

[0474] Following Example 4 (“CA07 H1N1 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with CA07. On days 1 and 3, four (n=4) mice (for group 1) and five (n=5) mice (for groups 2–8) were administered via intratracheal (IT) with the IAV RNAi reagent (at 3 mg / kg) in saline or saline-based formulation. On day 8, the animals were administered via intranasal (IN) injection with CA07 H1N1 in PBS or PBS-based formulation. Dosing was performed according to Table 50 below.

[0475] Table 50. Dosing to mice in Example 23.

[0476] The CA07 dose was quantified using TCID50 (50% of the tissue culture infection dose). Following the CA07 mouse model described in Example 3 above, this TCID50 dose was determined to be the optimal sublethal dose.

[0477] Animals were euthanized on day 14. Lungs (both left and right lungs) were collected and harvested. The expression of mouse H1N1 and M1 in the lungs was determined using qPCR, with 18S rRNA as an endogenous control gene. Mean H1N1 and M1 expression in lung tissue per animal was normalized relative to group 2 (no RNAi reagent + CA07 infection). Results are shown in Table 51 below.

[0478] Table 51. Mean relative expression of H1N1 and M1 in mouse lungs in Example 23.

[0479] Group 3 (AC002601) showed a significant reduction in H1N1 and M1. Group 4 (AC002564) showed a more moderate reduction in H1N1 and M1. The remaining groups (Groups 5-8) showed limited to no inhibition of H1N1 and M1.

[0480] Example 24. IAV RNAi reagent was subsequently administered in vivo to mice infected with CA07 H1N1.

[0481] Following Example 4 (“CA07 H1N1 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with CA07. On days 1 and 3, eight (n=8) mice (for groups 1–5) were administered via intratracheal (IT) with the IAV RNAi reagent (at 3 mg / kg) in saline or saline-based formulation. On day 8, the animals were administered via intranasal (IN) injection with CA07 H1N1 in PBS or PBS-based formulation. Dosing was performed according to Table 52 below.

[0482] Table 52. Dosing to mice in Example 24.

[0483] The CA07 dose was quantified using TCID50 (50% of the tissue culture infection dose).

[0484] The animals were sacrificed on day 22. Mouse weight and survival rate after CA07 infection were observed. Survival rates are shown in Table 53 below.

[0485] Table 53. Survival rate of test animals in Example 24 after CA07 infection.

[0486] Treatment with AC002564, followed by subsequent infection with CA07 (12000 TCID50), achieved a survival rate of 83.3% at 15 days post-infection. Treatment with AC002564, followed by subsequent infection with CA07 (24000 TCID50), achieved a survival rate of 75% at 15 days post-infection. This contrasts with group 2 (only 33% survival rate at 15 days post-infection) and group 4 (only 25% survival rate at 15 days post-infection), which did not receive RNAi treatment.

[0487] Example 25. IAV RNAi reagent was subsequently administered in vivo to mice infected with CA07 H1N1.

[0488] Following Example 4 (“CA07 H1N1 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with CA07. On days 1 and 3, four (n=4) mice (for group 1) and five (n=5) mice (for groups 2–8) were administered via intratracheal (IT) with the IAV RNAi reagent (at 3 mg / kg) in saline or saline-based formulation. On day 8, the animals were administered via intranasal (IN) injection with CA07 H1N1 in PBS or PBS-based formulation. Dosing was performed according to Table 54 below.

[0489] Table 54. Dosage administration to the mouse animals used in Example 25.

[0490] The CA07 dose was quantified using TCID50 (50% of the tissue culture infection dose). Following the CA07 mouse model described in Example 3 above, this TCID50 dose was determined to be the optimal sublethal dose.

[0491] Animals were euthanized on day 14. Lungs (both left and right lungs) were collected and harvested. The expression of mouse H1N1 and M1 in the lungs was determined using qPCR, with 18S rRNA as an endogenous control gene. Mean H1N1 and M1 expression in lung tissue per animal was normalized relative to group 2 (no RNAi reagent + CA07 infection). Results are shown in Table 55 below.

[0492] Table 55. Mean relative expression of H1N1 and M1 in mouse lungs of Example 25.

[0493] Groups 3-8 each showed a decrease in H1N1 and M1.

[0494] Example 26. IAV RNAi reagent was subsequently administered in vivo to mice infected with CA07 H1N1.

[0495] Following Example 4 (“CA07 H1N1 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with CA07. On days 1 and 3, four (n=4) mice (for group 1) and five (n=5) mice (for groups 2–8) were administered via intratracheal (IT) with the IAV RNAi reagent (at 3 mg / kg) in saline or saline-based formulation. On day 8, the animals were administered via intranasal (IN) injection with CA07 H1N1 in PBS or PBS-based formulation. Dosing was performed according to Table 56 below.

[0496] Table 56. Dosage in the mouse animals used in Example 26.

[0497] The CA07 dose was quantified using TCID50 (50% of the tissue culture infection dose). Following the CA07 mouse model described in Example 3 above, this TCID50 dose was determined to be the optimal sublethal dose.

[0498] Animals were euthanized on day 14. Lungs (both left and right lungs) were collected and harvested. The expression of mouse H1N1 and M1 in the lungs was determined using qPCR, with 18S rRNA as an endogenous control gene. Mean H1N1 and M1 expression in lung tissue per animal was normalized relative to group 2 (no RNAi reagent + CA07 infection). Results are shown in Table 57 below.

[0499] Table 57. Mean relative expression of H1N1 and M1 in mouse lungs in Example 26.

[0500] Groups 3-8 showed a certain decrease in H1N1 and M1.

[0501] Example 27. IAV RNAi reagent was administered in vivo to mice previously and subsequently infected with CA07 H1N1.

[0502] Following Example 4 (“CA07 H1N1 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with CA07. On days 1, 2, and / or 3, five (n=5) mice (for groups 1–8) were administered the IAV RNAi reagent (at 3 mg / kg or 6 mg / kg) via intratracheal (IT) or intranasal (IN) administration, using saline or a saline-reconstituted form. On day 1, the animals were administered CA07H1N1 via intranasal (IN) injection, using PBS or a PBS-reconstituted form. Administration was performed according to Table 58 below.

[0503] Table 58. Dosing to mice in Example 27.

[0504] The CA07 dose was quantified using TCID50 (50% of the tissue culture infection dose). Following the CA07 mouse model described in Example 3 above, this TCID50 dose was determined to be the optimal sublethal dose.

[0505] Animals were euthanized on day 7. Lungs (both left and right) were collected and harvested. Mouse H1N1 expression in the lungs was determined using qPCR, with 18S rRNA as an endogenous control gene. Mean H1N1 expression in lung tissue per animal was normalized relative to group 2 (no RNAi reagent + CA07 infection). Results are shown in Table 59 below.

[0506] Table 59. Mean relative expression of H1N1 in mouse lungs in Example 27.

[0507] Groups 3, 4, 6, and 7 showed a significant reduction in H1N1, while groups 5 and 8 showed a more moderate reduction in H1N1.

[0508] Example 28. IAV RNAi reagent was subsequently administered in vivo to mice infected with CA07 H1N1.

[0509] Following Example 4 (“CA07 H1N1 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with CA07. On days 1 and 3, five (n=5) mice (for groups 1–8) were administered via intratracheal (IT) with the IAV RNAi reagent (at 0.75 mg / kg) in saline or saline-based formulation. On day 8, the animals were administered via intranasal (IN) injection with CA07 H1N1 in PBS or PBS-based formulation. Dosing was performed according to Table 60 below.

[0510] Table 60. Dosing to mice in Example 28.

[0511] The CA07 dose was quantified using TCID50 (50% of the tissue culture infection dose). Following the CA07 mouse model described in Example 3 above, this TCID50 dose was determined to be the optimal sublethal dose.

[0512] Animals were euthanized on day 14. Lungs (both left and right lungs) were collected and harvested. The expression of mouse H1N1 and M1 in the lungs was determined using qPCR, with 18S rRNA as an endogenous control gene. Mean H1N1 and M1 expression in lung tissue per animal was normalized relative to group 2 (no RNAi reagent + CA07 infection). Results are shown in Table 61 below.

[0513] Table 61. Mean relative expression of H1N1 and M1 in mouse lungs in Example 28.

[0514] Groups 3-8 each showed a decrease in H1N1 and M1.

[0515] Example 29. IAV RNAi reagent was subsequently administered in vivo to mice infected with CA07 H1N1.

[0516] Following Example 4 (“CA07 H1N1 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with CA07. On days 1 and 3, four (n=4) mice (for group 1) and five (n=5) mice (for groups 2–8) were administered via intratracheal (IT) with the IAV RNAi reagent, either in saline or prepared in saline, at 1 mg / kg or 2 mg / kg. On day 8, the animals were administered via intranasal (IN) injection with CA07 H1N1, either in PBS or prepared in PBS. Dosing was performed according to Table 62 below.

[0517] Table 62. Dosing to mice in Example 29.

[0518] The CA07 dose was quantified using TCID50 (50% of the tissue culture infection dose). Following the CA07 mouse model described in Example 3 above, this TCID50 dose was determined to be the optimal sublethal dose.

[0519] Animals were euthanized on day 14. Lungs (both left and right lungs) were collected and harvested. The expression of mouse H1N1 and M1 in the lungs was determined using qPCR, with 18S rRNA as an endogenous control gene. Mean H1N1 and M1 expression in lung tissue per animal was normalized relative to group 2 (no RNAi reagent + CA07 infection). Results are shown in Table 63 below.

[0520] Table 63. Mean relative expression of H1N1 and M1 in mouse lungs in Example 29.

[0521] Groups 3-8 each showed a decrease in H1N1 and M1.

[0522] Example 30. IAV RNAi reagent was administered in vivo to mice previously infected with CA07 H1N1.

[0523] Following Example 4 (“CA07 H1N1 model mice”), female C57Bl / 6 mice were first infected with CA07 and subsequently administered IAV RNAi reagent. On day 1, five (n=5) mice (for groups 1–7) were administered via intratracheal (IT) with IAV RNAi reagent (at 3 mg / kg or 6 mg / kg) prepared in saline or saline. On day 1, the animals were also administered via intranasal (IN) injection with CA07 H1N1 prepared in PBS or PBS. Dosing was performed according to Table 64 below.

[0524] Table 64. Dosage in mice used in Example 30.

[0525] The CA07 dose was quantified using TCID50 (50% of the tissue culture infection dose). Following the CA07 mouse model described in Example 3 above, this TCID50 dose was determined to be the optimal sublethal dose.

[0526] Animals were euthanized on day 7. Lungs (both left and right lungs) were collected and harvested. The expression of mouse H1N1 and M1 in the lungs was determined using qPCR, with 18S rRNA as an endogenous control gene. Mean H1N1 and M1 expression in lung tissue per animal was normalized relative to group 2 (no RNAi reagent + CA07 infection). Results are shown in Table 65 below.

[0527] Table 65. Mean relative expression of H1N1 and M1 in mouse lungs in Example 30.

[0528] Groups 4-7 each showed a decrease in H1N1 and M1.

[0529] Example 31. IAV RNAi reagent was subsequently administered in vivo to mice infected with CA07 H1N1.

[0530] Following Example 4 (“CA07 H1N1 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with CA07. On day 1, four (n=4) mice (for group 1) and five (n=5) mice (for groups 2–8) were administered via intratracheal (IT) with the IAV RNAi reagent (at 0.75 mg / kg) in saline or saline-based formulation. On day 8, the animals were administered via intranasal (IN) injection with CA07H1N1 in PBS or PBS-based formulation. Dosing was performed according to Table 66 below.

[0531] Table 66. Administration to mice in Example 31.

[0532] The CA07 dose was quantified using TCID50 (50% of the tissue culture infection dose). Following the CA07 mouse model described in Example 3 above, this TCID50 dose was determined to be the optimal sublethal dose.

[0533] Animals were euthanized on day 14. Lungs (both left and right lungs) were collected and harvested. The expression of mouse H1N1 and M1 in the lungs was determined using qPCR, with 18S rRNA as an endogenous control gene. Mean H1N1 and M1 expression in lung tissue per animal was normalized relative to group 2 (no RNAi reagent + CA07 infection). Results are shown in Table 67 below.

[0534] Table 67. Mean relative expression of H1N1 and M1 in mouse lungs of Example 31.

[0535] Groups 3-8 each showed a decrease in H1N1 and M1.

[0536] Example 32. IAV RNAi reagent was administered in vivo to mice previously infected with CA07 H1N1.

[0537] Following Example 4 (“CA07 H1N1 model mice”), female C57Bl / 6 mice were first infected with CA07 and subsequently administered IAV RNAi reagent. On day 1, five (n=5) mice (for group 1) and ten (n=10) mice (for groups 2–5) were administered via intranasal (IN) or oral feeding with IAV RNAi reagent (at 3 mg / kg) or saline or a saline-based formulation, or oseltamivir (…). Animals were administered 20 mg / kg (Group 5 was administered on days 1, 2, 3, 4, and 5). Prior to administration of the IAV RNAi reagent, on day 1, animals were administered via intranasal (IN) injection with PBS or CA07 H1N1 prepared in PBS. Administration was performed according to Table 68 below.

[0538] Table 68. Dosing to mice in Example 32.

[0539] The CA07 dose was quantified using TCID50 (50% of the tissue culture infection dose). Following the CA07 mouse model described in Example 3 above, this TCID50 dose was determined to be the optimal sublethal dose.

[0540] Animals were euthanized on day 7. Lungs (both left and right lungs) were collected and harvested. The expression of mouse H1N1 (measuring genomic RNA) and M1 (measuring decreased mRNA) in the lungs was determined using qPCR, with 18S rRNA as an endogenous control gene. Mean H1N1 and M1 expression in lung tissue per animal was normalized relative to group 2 (no RNAi reagent + CA07 infection). Results are shown in Table 69 below.

[0541] Table 69. Mean relative expression of H1N1 (genomic RNA) and M1 (mRNA) in mouse lungs in Example 32.

[0542] Especially when compared with commercially available oseltamivir When compared, groups 3 and 4, which were administered the IAV RNAi reagent, showed a significant reduction of H1N1 and M1 greater than or equal to about 80%, while oseltamivir did not show a reduction of H1N1 or M1 and was generally comparable to model mice administered saline.

[0543] The viral load of CA07 H1N1 was quantified in the lungs of mice. Figure 3 The results show the viral load in the lungs of the test animals at day 7 when they were sacrificed. IAV RNAi reagent AC002869 reduced the viral load in the lungs by approximately 2 log. 10 TCID50 / mL. In contrast, the group treated with oseltamivir alone showed a reduction in pulmonary viral load of less than 1 log. 10 TCID50 / mL.

[0544] Mouse lung samples were prepared for H&E staining, IHC staining, and RNA scope. Lung samples from the mouse test animals were processed and paraffin-embedded (formalin-fixed paraffin-embedded FFPE). Lung sections were collected using a microtome and fixed on glass slides. Histological inflammation assays were performed on the slides using an automated IHC staining system (Ventana Discovery Ultra), detected by DAB chromogenic assay. The inflammation assay utilized the pan-inflammatory marker Iba1 (Wako, catalog #: 019-19741, 1:400), a secondary antibody from Roche (DISC. OmniMap anti-Rb HRP, catalog #: 05269679001), and visual detection using a chromogenic reagent from Roche (DISC. ChromoMap DAB, catalog #: 05266645001) to detect all inflammatory cells. Lung samples were scanned using an Olympus VS2000 automated scanner for image analysis. The images were then loaded into the image analysis software Halo-Indica Lab, where the cell detection module was used to detect inflammatory cells (Iba1+ cells).

[0545] Inflammation in the lungs of the test animals was quantified, and the inflammation percentage of the test group was standardized against that of the second group (saline + CA07). The results were shown in [data missing]. Figure 4 In the middle. For example Figure 4As shown, RNAi reagent AC002869 reduced pneumonia by approximately 50% compared to the approximately 36% reduction achieved with oseltamivir treatment. Figure 5 Further histological studies of the lungs of mouse test animals were presented, demonstrating that the IAV RNAi reagent AC002869 reduced inflammation in the lungs of mouse test animals.

[0546] Example 33. IAV RNAi reagent was subsequently administered in vivo to mice infected with CA07 H1N1.

[0547] Following Example 4 (“CA07 H1N1 model mice”), female C57Bl / 6 mice were administered the IAV RNAi reagent and subsequently infected with CA07. On days 1 and 3 (for groups 1–4), and on days 3+4+5+6+7 (for group 5), ten (n=10) mice (for groups 1–5) were administered intranasally (IN) or orally with the IAV RNAi reagent (at 3 mg / kg) or oseltamivir (or a saline-based or saline-reconstituted solution). The animals were administered 40 mg / kg. On day 8, the animals were administered via intranasal (IN) injection with PBS or CA07 H1N1 prepared in PBS. Dosing was performed according to Table 70 below.

[0548] Table 70. Dosing to mice in Example 33.

[0549] The CA07 dose was quantified using TCID50 (50% of the tissue culture infection dose).

[0550] Animals were euthanized on day 15. Mouse weight and survival were observed after CA07 infection. Survival was determined after euthanizing any test animal that lost more than 20% of its initial body weight (>20% weight loss = death). Survival rates are shown in Table 71 below.

[0551] Table 71. Survival rate of test animals in Example 33 after CA07 infection.

[0552] Animals treated with IAV RNAi reagents AC002866 or AC002869, followed by a subsequent infection with CA07 (12000 TCID50), achieved 100% survival at day 15 post-infection. Test animals treated with saline followed by a subsequent infection with CA07 (12000 TCID50) showed only a 10% survival rate at day 8 post-infection (Group 2). Similarly, with oseltamivir... The test animals treated with the drug showed only a 20% survival rate at 15 days post-infection (group 5). IAV RNAi reagents AC002866 and AC002869 thus achieved a ~90% reduction in mortality compared to the saline-treated CA07-infected group, and with oseltamivir... The mortality rate was reduced by approximately 80% compared to the treatment group.

[0553] Example 34. In vivo administration of IAV RNAi reagent to mice infected with CA07 H1N1.

[0554] Following Example 4 (“CA07 H1N1 model mice”), female C57Bl / 6 mice were infected with CA07 and subsequently administered IAV RNAi reagent. Dosing was performed as shown in Table 72 below. On day 1, ten mice in each group (n=10) were administered via intranasal (IN) or oral feeding with IAV RNAi reagent (at 3 mg / kg) or oseltamivir (or a saline solution prepared in saline). Administer at 40 mg / kg.

[0555] Table 72. Dosing to mice in Example 34.

[0556] The CA07 dose was quantified using TCID50 (50% of the tissue culture infection dose).

[0557] Animals were euthanized on day 15. Mouse weight and survival were observed after CA07 infection. Survival was determined after euthanizing any test animal that lost more than 20% of its initial body weight (>20% weight loss = death). Survival rates are shown in Table 73 below.

[0558] Table 73. Survival rate of test animals in Example 34 after CA07 infection.

[0559] Following initial infection with therapeutic agents, animals exhibited a more severe IAV infection model. As described in Table 73 above, infection with CA07 (12000 TCID50) followed by administration of IAV RNAi reagents AC002866 or AC002869 achieved improved survival rates exceeding those achieved with oseltamivir or no treatment. Test animals infected with CA07 (12000 TCID50) followed by saline administration showed only 10% survival at days 8 and 14 post-infection (Group 2). Similarly, with oseltamivir... The test animals that received the drug showed only a 20% survival rate on day 8 (group 5) and a 10% survival rate on day 14. In contrast, the group that received the RNA reagent AD002869 (which targets the M1 influenza A genome segment) after infection with CA07 showed a 60% survival rate at 2 weeks post-infection.

[0560] Example 35. Identification of conserved RNAi reagent sequences across influenza A subtypes and evaluation of viral susceptibility.

[0561] To identify the RNAi reagent sequences disclosed in the various embodiments described herein, approximately 10,000 influenza genomes of different subtypes (including H1N1, H3N2, H5N1, H5N6, H5N8, H7N2, H7N3, H7N4, H7N7, H7N9, and H9N2) were bioinformatically evaluated to locate the most highly conserved regions. By utilizing RNAi reagents with sequences capable of targeting conserved regions across different influenza genomic subtypes, RNAi reagent therapeutics will be able to provide therapeutic benefits to patients with various influenza subtypes and thus enable the treatment of a larger patient population.

[0562] For the RNAi reagent described herein, as elsewhere in this document, candidate sequences targeting these highly conserved regions were identified in six genomic segments: PB1, PB2, PA, NP, NS, and M (referred to herein as M1, but including transcripts of M1 and M2). Genomic segments HA and NA were not evaluated due to the high genetic variability across different subtypes in these regions.

[0563] As described in the various embodiments herein, throughout the various evaluations of the RNAi reagents, the IAV RNAi reagent targeting the influenza A M1 genomic segment (i.e., the transcript of the influenza A genomic segment of SEQ ID NO:1) consistently exhibited the most significant antiviral activity compared to IAV RNAi reagents targeting other genomic segments.

[0564] Example 36. In vivo administration of IAV RNAi reagent to mice infected with H5N1.

[0565] Female C57Bl / 6 mice were first administered IAV RNAi reagent and then subsequently infected with H5N1 IAV virus. Following H5N1 virus infection, female C57Bl / 6 mice in different groups were also administered IAV RNAi reagent. On days -7 and -5, ten mice (n=10) in groups 3–4 were administered IAV RNAi reagent (3 mg / kg) in saline via intranasal (IN) or intratracheal (IT); five mice (n=5) in group 1 and ten mice (n=10) in group 2 were administered IAV RNAi reagent via saline via IN. On day 0, groups 2–5 were administered H5N1 virus via intranasal (IN). On day 0, at 4 and 8 hours after H5N1 administration, ten mice (n=10) in group 5 were administered intranasally (IN) with IAV RNAi reagent (3 mg / kg) prepared in saline. Animals in group 1 were administered H5N1 via IN with PBS. H5N1 dosage was quantified in PFU (plaque-forming units). Dosing was performed according to Table 74 below.

[0566] Table 74. Dosage in mice used in Example 36.

[0567] The H5N1 virus used was an influenza A virus (A / Viet Nam / 1203 / 2004(H5N1)).

[0568] All mouse test animals were sacrificed on day 5 (5 days post-infection). Daily body weight measurements were collected. Lungs were collected for quantification and analysis of viral load via PFU / TCID50 and lung histopathology.

[0569] Table 75. Lung viral load in mouse test animals of Example 36.

[0570] Pulmonary viral load, quantified by PFU / lobe, is shown in Table 75 and Figure 6AIn mouse test animals, prophylactic treatment with the IAVRNAi reagent AC002869 followed by H5N1 infection showed a significant reduction in pulmonary viral load. Both prophylactic treatment with AC002869 via IT (group 3) and IN (group 4) achieved significant reductions in pulmonary viral load compared to test animals treated with saline (group 2). Furthermore, therapeutic treatment with AC002869 after H5N1 infection (group 5) also showed a significant reduction in pulmonary viral load compared to test animals treated with saline (group 2). In contrast to test animals treated with saline (group 2), groups 3–5 all showed a reduction of approximately 1 / 100 or 2 log10 in pulmonary viral load. Following the analysis of variance, Tukey's honest HSD test showed the p-values ​​(denoted as **p<0.01) for each of the following groups: Group 2 vs. Group 3, Group 2 vs. Group 4, and Group 2 vs. Group 5.

[0571] The body weights of the mice used in the test were collected and are shown in Table 76 below. Figure 6B middle.

[0572] As shown in Table 76 and Figure 6B As shown, following H5N1 infection, mice treated with AC002869 exhibited improved weight changes compared to test animals treated with saline (Group 2). Prophylactic treatment with AC002869 via IT (Group 3) and IN (Group 4) both achieved significantly improved weight changes compared to test animals administered saline (Group 2). Both Groups 3 and 4 achieved approximately 94-95% weight retention compared to test animals administered saline (Group 2, approximately 76%). Furthermore, therapeutic treatment with AC002869 following H5N1 infection (Group 5) also showed a significant improvement in weight retention of approximately 91% compared to test animals administered saline (Group 2, approximately 76%).

[0573] The "clinical score" of the mouse test animals was also observed. For this study, the clinical score was defined as: 0 = Normal; 1 = Suspected illness; 2 = Mild but diagnosed illness; 3 = Moderate to severe illness; 4 = Significantly severe illness, near death – euthanasia to be performed; and 5 = Found dead.

[0574] Clinical scores of mouse test animals were shown in Figure 6CIn all tests, groups 3–5, treated with IAV RNAi reagent AC002869 via intranasal administration (groups 4 and 5, prophylactic) or intratracheal administration (group 3) before H5N1 infection (groups 3 and 4, prophylactic) or after H5N1 infection (group 5, therapeutic), showed significantly improved clinical scores compared to test animals administered saline (group 2). After H5N1 infection, test animals in groups 3–5 showed similar clinical scores to those in group 1 (not administered H5N1 virus), maintaining a clinical score of 0 for 5 days post-H5N1 infection.

[0575] The experimental data and results above confirm that the IAV RNAi reagent AC002869 described in this article also possesses potent antiviral activity against the H5N1 variant of influenza A virus, as AC002869 is designed to exhibit antiviral activity targeting highly conserved regions of influenza A virus (specifically, AC002869 targets M1). Furthermore, the IAV RNAi reagent AC002869 also exhibits both prophylactic and therapeutic antiviral activity against H5N1. Accordingly, the IAV RNAi reagent AC002869, along with other IAV RNAi reagents described in this article, can possess potent antiviral activity across different influenza subtypes and thus provide greater therapeutic benefits to patients.

[0576] Example 37. In vivo administration of IAV RNAi reagent to mice infected with H5N1.

[0577] Female Balb / c mice were first administered the IAV RNAi reagent and then infected with H5N1 IAV virus. Following H5N1 virus infection, female Balb / c mice in different groups were also administered the IAV RNAi reagent. On days -7 and -5, ten mice (n=10) in group 3 were administered intranasally (IN) with IAV RNAi reagent AC002869 (3 mg / kg) prepared in saline; ten mice (n=10) in groups 1 and 2 were administered IN with saline. On day 0, groups 2–4 were administered H5N1 virus intranasally (IN). On day 0, 4 and 8 hours after H5N1 administration, ten mice (n=10) in group 4 were administered IAV RNAi reagent (3 mg / kg) prepared in saline via intranasal (IN). Group 1 test animals were administered PBS without H5N1. The H5N1 dose was quantified using TCID50 (50% of the tissue culture infection dose). Dosing was performed according to Table 77 below.

[0578] Table 77. Dosage in mice used in Example 37.

[0579] The H5N1 virus used was an influenza A virus (A / whooper swan / Mongolia / 244 / 2005(H5N1)).

[0580] All mouse test animals were sacrificed on day 14 (14 days post-H5N1 infection). Daily body weight measurements were collected. Lungs were collected for quantification and analysis of pulmonary viral load via PFU / TCID50 and lung histopathology.

[0581] Figure 7A The mouse test animal weights are shown at time points prior to H5N1 infection. The IAV RNAi reagent AC002869 did not appear to cause significant side effects affecting animal weight.

[0582] Figure 7B The figures show the weights of mouse test animals at time points following H5N1 infection. Group 2 test animals, administered saline (without IAV RNAi reagent) and infected with H5N1, all died from H5N1 infection. Group 3 test animals, treated with IAV RNAi reagent AC002869 at -7 and -5 days, and infected with H5N1, showed weight loss from days 5 to 10, but recovered to approximately 100% of their starting weight by days 12 to 14. Group 4 test animals, treated with IAV RNAi reagent AC002869 4 and 8 hours post-H5N1 infection, showed greater weight loss compared to Group 3 after a brief recovery period between days 10 and 11, but still showed improved weight loss compared to Group 2.

[0583] Clinical scores were also observed in the mouse test animals. For this study, the clinical score was defined as: 1 = Health; 2 = Disheveled fur, panting, lethargy (triggers second observation); 3 = Score 2 plus one additional clinical sign, such as kyphosis, eye socket tightness, increased respiratory rate or >15% weight loss (triggering a third observation); 4. Dyspnea and / or cyanosis, reluctance to move when stimulated, or >25% weight loss - immediate euthanasia. Figure 7CClinical scores for the mouse test animals are shown. Both Group 3 (treated with IAV RNAi reagent AC002869 before H5N1) and Group 4 (treated with IAV RNAi reagent AC002869 after H5N1) showed improved clinical scores compared to Group 2 (untreated with IAV RNAi reagent and infected with H5N1). Group 4 showed improved clinical scores compared to Group 3. This demonstrates that both prophylactic and therapeutic treatment with AC002869 showed improved clinical scores compared to Group 2 (treated with saline and without IAV RNAi reagent), with prophylactic treatment with AC002869 showing a better clinical score than therapeutic treatment. Group 3 test animals showed a healthy (score = 1) clinical score starting from day 12.

[0584] Figure 7D Survival indices for the test animals are shown. All animals in Group 2, untreated with IAV RNAi reagent and infected with H5N1, showed a 100% mortality rate by day 10. At day 14, Group 3 (prophylactic treatment AC002869) showed a 60% survival rate, while Group 4 (therapeutic treatment AC002869) showed an 80% survival rate. Compared to Group 2, both prophylactic treatment (Group 3) and therapeutic treatment (Group 4) via IAV RNAi reagent AC002869 showed significant reductions in mortality, at 60% and 80%, respectively.

[0585] Figure 7E The results show the pulmonary viral load at TCID50. In mouse test animals, prophylactic and therapeutic treatment with IAV RNAi reagent AC002869 for H5N1 showed a significant reduction in pulmonary viral load. Both prophylactic treatment group 3 and therapeutic treatment group 4 achieved significant antiviral activity in the lungs, reducing H5N1 pulmonary viral load by ~1.5 log10 compared to test animals not treated with IAV RNAi reagent (group 2). Significance is expressed as **p<0.01.

[0586] The experimental data and results above confirm that the IAV RNAi reagent AC002869 described in this article also possesses potent antiviral activity against the H5N1 variant of influenza A virus, as AC002869 is designed to exhibit antiviral activity targeting highly conserved regions of influenza A virus (specifically, AC002869 targets M1). Furthermore, the IAV RNAi reagent AC002869 also exhibits both prophylactic and therapeutic antiviral activity against H5N1. Accordingly, the IAV RNAi reagent AC002869, along with other IAV RNAi reagents described in this article, can possess potent antiviral activity across different influenza subtypes and thus provide greater therapeutic benefits to patients.

[0587] Other implementation plans It should be understood that although the invention has been described in conjunction with its detailed description, the foregoing specification is intended to illustrate, and not limit, the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the appended claims.

Claims

1. An RNAi reagent for inhibiting the expression of influenza A virus genome, comprising: The antisense strand comprises at least 17 adjacent nucleotides that differ from any of the sequences provided in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, or 3F by 0 or 1 nucleotide; and The sense strand contains a nucleotide sequence that is at least partially complementary to the antisense strand.

2. The RNAi reagent according to claim 1, wherein the antisense strand comprises nucleotides 2-18 of any sequence provided in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E or 3F.

3. The RNAi reagent according to claim 1 or claim 2, wherein the sense strand comprises a nucleotide sequence of at least 17 adjacent nucleotides differing from any one of the sequences provided in Tables 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E or 4F by 0 or 1 nucleotide, and wherein the sense strand has a region on the 17 adjacent nucleotides that is at least 85% complementary to the antisense strand.

4. The RNAi reagent according to any one of claims 1-3, wherein at least one nucleotide of the IAV RNAi reagent is a modified nucleotide or includes modified internucleotide bonds.

5. The RNAi reagent according to any one of claims 1-4, wherein all or substantially all nucleotides are modified nucleotides.

6. The RNAi reagent according to any one of claims 4-5, wherein the modified nucleotide is selected from: 2'-O-methyl nucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2',3'-cleaved nucleotide mimic, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, debased nucleotide, ribitol, reverse nucleotide, reverse 2'-O-methyl nucleotide, reverse 2'-deoxynucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholinonucleotide, vinylphosphonate-containing nucleotide, cyclopropylphosphonate-containing nucleotide, and 3'-O-methyl nucleotide.

7. The RNAi reagent according to claim 5, wherein all or substantially all nucleotides are modified with 2'-O-methylnucleotides, 2'-fluoronucleotides, or combinations thereof.

8. The RNAi reagent according to any one of claims 1-7, wherein the antisense strand comprises a nucleotide sequence of any of the modified sequences provided in Tables 3A, 3B, 3C, 3D, 3E and 3F.

9. The RNAi reagent according to any one of claims 1-8, wherein the sense strand comprises a nucleotide sequence of any of the modified sequences provided in Tables 4A, 4B, 4C, 4D, 4E and 4F.

10. The RNAi reagent of claim 1, wherein the antisense strand comprises a nucleotide sequence of any of the modified sequences provided in Tables 3A, 3B, 3C, 3D, 3E and 3F, and the sense strand comprises a nucleotide sequence of any of the modified sequences provided in Tables 4A, 4B, 4C, 4D, 4E and 4F.

11. The RNAi reagent according to any one of claims 1-10, wherein the sense strand is 18 to 30 nucleotides in length and the antisense strand is 18 to 30 nucleotides in length.

12. The RNAi reagent according to claim 11, wherein the sense strand and antisense strand are each 18 to 27 nucleotides in length.

13. The RNAi reagent according to claim 12, wherein the sense strand and the antisense strand are each 18 to 24 nucleotides in length.

14. The RNAi reagent according to claim 13, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

15. The RNAi reagent according to claim 14, wherein the RNAi reagent has two blunt ends.

16. The RNAi reagent according to any one of claims 1-15, wherein the sense strand comprises one or two terminal caps.

17. The RNAi reagent according to any one of claims 1-16, wherein the sense strand comprises one or two reverse debasement residues.

18. The RNAi reagent according to claim 1, wherein the RNAi reagent comprises a sense strand and an antisense strand, the sense strand and the antisense strand forming a double strand having a structure having a double strand of any one of the double strands in Tables 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F, 10A, 10B, 10C, 10D, 10E or 10F.

19. The RNAi reagent of claim 18, wherein all or substantially all nucleotides are modified nucleotides.

20. The RNAi reagent of claim 1, comprising an antisense strand, said antisense strand consisting of, substantially consisting of, or containing a nucleotide sequence, said nucleotide sequence differing from the following nucleotide sequence (5' → 3') by 0 or 1 nucleotide: UUACGUUUCGACCUCGGUUAG (SEQ ID NO: 1590).

21. The RNAi reagent of claim 20, wherein the sense strand consists of, is substantially composed of, or contains a nucleotide sequence, said nucleotide sequence differing from the following nucleotide sequence (5' → 3') by 0 or 1 nucleotide: CUAACCGAGGUCGAAACGUAA (SEQ ID NO: 1706).

22. The RNAi reagent according to claim 20 or 21, wherein all or substantially all nucleotides are modified nucleotides.

23. The RNAi reagent of claim 1, comprising an antisense strand, said antisense strand comprising, consisting of, or substantially consisting of a modified nucleotide sequence, said modified nucleotide sequence differing from one of the following nucleotide sequences (5' → 3') by 0 or 1 nucleotide: cPrpusUfsascguUfucgaCfcUfcGfguuasg (SEQ ID NO: 1176); or cPrpusUfsascGfuuucgaCfcUfcGfguuasg (SEQ ID NO: 1175); Where a represents 2′-O-methyladenosine, c represents 2′-O-methylcytidine, g represents 2′-O-methylguanosine, and u represents 2′-O-methyluridine; Af represents 2′-fluoroadenosine, Cf represents 2′-fluorocytidine, Gf represents 2′-fluoroguanosine, and Uf represents 2′-fluorouridine; cPrpu represents 5′-cyclopropylphosphonate-2′-O-methyluridine; s represents thiophosphate bond; and all or substantially all nucleotides on the sense chain are modified nucleotides.

24. The RNAi reagent of claim 1, wherein the sense strand comprises, consists of, or is substantially composed of a modified nucleotide sequence, said modified nucleotide sequence differing from one of the following nucleotide sequences (5' → 3') by 0 or 1 nucleotide: csuaaccgaGfgUfcGfaaacguaa (SEQ ID NO: 1373); or csuaaccgaGfgUfcgaaacguaa (SEQ ID NO: 1374); Where a represents 2′-O-methyladenosine, c represents 2′-O-methylcytidine, g represents 2′-O-methylguanosine, and u represents 2′-O-methyluridine; Af represents 2′-fluoroadenosine, Cf represents 2′-fluorocytidine, Gf represents 2′-fluoroguanosine, and Uf represents 2′-fluorouridine; cPrpu represents 5′-cyclopropylphosphonate-2′-O-methyluridine; s represents thiophosphate bond; and all or substantially all nucleotides on the antisense strand are modified nucleotides.

25. The RNAi reagent according to any one of claims 20-24, wherein the sense strand further comprises a reverse debasement residue at the 3' end of the nucleotide sequence, at the 5' end of the nucleotide sequence, or at both.

26. The RNAi reagent according to any one of claims 1-25, wherein the RNAi reagent is linked to a targeting ligand.

27. The RNAi reagent of claim 26, wherein the targeting ligand has affinity for a cell receptor expressed on epithelial cells.

28. The RNAi reagent of claim 27, wherein the targeting ligand comprises an integrin targeting ligand.

29. The RNAi reagent according to claim 28, wherein the integrin targeting ligand is the αvβ6 integrin targeting ligand.

30. The RNAi reagent of claim 29, wherein the targeting ligand comprises the following structure: Or its pharmaceutically acceptable salt, or Or its pharmaceutically acceptable salt. in Indicates the connection point with the RNAi reagent.

31. The RNAi reagent according to any one of claims 26-29, wherein the targeting ligand has a structure selected from: in Indicates the connection point with the RNAi reagent.

32. The RNAi reagent of claim 31, wherein the RNAi reagent is conjugated to a targeting ligand having the following structure: 。 33. The RNAi reagent according to any one of claims 26-32, wherein the targeting ligand is conjugated to the sense strand.

34. The RNAi reagent of claim 33, wherein the targeting ligand is conjugated to the 5' end of the sense strand.

35. The RNAi reagent according to any one of claims 1-34, wherein the influenza A virus genome is selected from the following viral genomes: H1N1 virus genome; H2N2 virus genome; H3N2 virus genome; H5N1 virus genome; H7N9 virus genome; and H10N8 virus genome.

36. A composition comprising the RNAi reagent according to any one of claims 1-35, wherein the composition further comprises a pharmaceutically acceptable excipient.

37. The composition of claim 36, further comprising a second RNAi agent capable of inhibiting the expression of influenza A virus genome.

38. The composition of claim 37, wherein the influenza A virus genome is selected from the following viral genomes: H1N1 virus genome; H2N2 virus genome; H3N2 virus genome; H5N1 virus genome; H7N9 virus genome; and H10N8 virus genome.

39. The composition according to any one of claims 36-38, further comprising one or more additional therapeutic agents.

40. The composition according to any one of claims 36-39, wherein the composition is formulated for administration by inhalation.

41. The composition of claim 40, wherein the composition is delivered by a metering inhaler, a jet sprayer, a vibrating mesh sprayer, or a soft mist inhaler.

42. The composition according to any one of claims 36-41, wherein the RNAi reagent is a sodium salt.

43. The composition of claim 36, wherein the pharmaceutically acceptable excipient is water for injection.

44. The composition of claim 36, wherein the pharmaceutically acceptable excipient is a buffered saline solution.

45. A method for inhibiting influenza A virus genome expression in cells and / or treating one or more symptoms or diseases associated with influenza A virus infection, the method comprising introducing an effective amount of an RNAi reagent into cells and / or administering it to a subject, wherein the RNAi reagent targets an M1 influenza A virus genome segment transcript having an antisense strand comprising at least 15 adjacent nucleotides complementary to a segment of at least 15 adjacent nucleotides of SEQ ID NO. 1, differing by 0, 1, 2, or 3 nucleotides, and wherein the RNAi reagent is optionally linked to a targeting ligand, preferably wherein the targeting ligand has an affinity for a cellular receptor expressed on epithelial cells, and most preferably wherein the targeting ligand is an αvβ6 integrin targeting ligand.

46. ​​A method for inhibiting the expression of influenza A virus genome in cells, the method comprising introducing an effective amount of an RNAi reagent according to any one of claims 1-35 or a composition according to any one of claims 36-44 into the cells.

47. The method of claim 45 or 46, wherein the influenza A virus genome is selected from the following viral genomes: H1N1 virus genome; H2N2 virus genome; H3N2 virus genome; H5N1 virus genome; H7N9 virus genome; and H10N8 virus genome.

48. The method according to any one of claims 45-47, wherein the cells are within the subject.

49. The method of claim 48, wherein the subject is a human subject.

50. The method according to any one of claims 45-49, wherein the influenza A virus genome is suppressed by at least about 30% after the RNAi reagent is applied.

51. A method for treating one or more symptoms or diseases associated with influenza A virus infection, the method comprising administering to a human subject in need a therapeutically effective amount of the composition according to any one of claims 36-44.

52. The method according to claim 45 or claim 51, wherein the disease is a respiratory disease.

53. The method of claim 52, wherein the respiratory disease is lung inflammation.

54. The method of claim 52, wherein the disease is an influenza A virus infection.

55. The method of claim 54, wherein the influenza A virus infection is caused by a subtype of influenza A virus selected from: H1N1; H2N2; H3N2; H5N1; H7N9; and H10N8.

56. The method according to any one of claims 45-55, wherein the RNAi reagent is administered at a deposition dose of about 0.01 mg / kg to about 5.0 mg / kg of the subject's body weight.

57. The method according to any one of claims 45-56, wherein the RNAi reagent is administered at a deposition dose of about 0.03 mg / kg to about 2.0 mg / kg of the subject's body weight.

58. The method according to any one of claims 45-57, wherein the RNAi reagent is administered in two or more doses.

59. The use of the RNAi reagent according to any one of claims 1-35 for the treatment of diseases, conditions or symptoms mediated at least in part by influenza A virus genome activity and / or influenza A virus genome expression.

60. Use of the composition according to any one of claims 36-44 for treating at least a portion of a disease, condition, or symptom mediated by influenza A virus genomic activity and / or influenza A virus genomic expression.

61. Use of the composition according to any one of claims 36-44 for manufacturing a pharmaceutical agent for treating at least a portion of a disease, condition, or symptom mediated by influenza A virus genome and / or influenza A virus genome expression.

62. The use according to any one of claims 59-61, wherein the disease is an influenza infection.

63. A method for manufacturing an RNAi reagent according to any one of claims 1-35, comprising annealing the sense strand and the antisense strand to form a double-stranded ribonucleic acid molecule.

64. The method of claim 63, wherein the sense strand comprises a targeting ligand.

65. The method of claim 64, further comprising conjugating the target ligand to the sense chain.

Images