Extreme acidithiobacillus acidophilus based on sulfur metabolic pathway enhancement as well as construction method and application of extreme acidithiobacillus acidophilus

Abstract

The invention discloses extreme acidithiobacillus acidophilus based on sulfur metabolic pathway enhancement as well as a construction method and application of the extreme acidithiobacillus acidophilus. According to the invention, based on conjugational transfer, sulfide of Acidithiobacillus caldus, namely a quinone oxidoreductase SQR gene is over-expressed, a promoter Amp is adopted for starting expression, an extreme acidophilic engineering bacterium A. caldus-G-SQR is constructed, and compared with wild type A. caldus, the acid stress tolerance, sulfur oxidation capacity and intracellular ATP (adenosine triphosphate) generation capacity of the extreme acidophilic engineering bacterium A. caldus-G-SQR are all improved. The core effect of the SQR in strain environmental adaptation and metabolic regulation is fully verified.

Description

TECHNICAL FIELD

[0001] The present application relates to a kind of based on sulphur metabolic pathway strengthening extreme acidophilic thiobacillus and its construction method and application, belong to genetic engineering technical field. BACKGROUND

[0002] Acidophilic thermophilic thiobacillus belongs to moderate thermophilic, obligate acidophilic chemoautotrophic gram-negative bacteria.Its sulfur metabolism catalyzes sulfide to generate elemental sulfur and directly transmits electrons into the respiratory chain, then elemental sulfur is further oxidized to generate sulfuric acid to directly participate in mineral acidolysis and reduce environmental pH.Acidophilic thermophilic thiobacillus relies on its efficient sulfur oxidation metabolic network to convert toxic sulfide into sulfuric acid to maintain the extreme acidity of the environment and obtain energy, which lays the foundation for its important functional role in sulfur cycle in many aerobic and anaerobic environmental systems.

[0003] The sulfur metabolism process of acidophilic thermophilic thiobacillus (A. Acidithiobacillus caldus ) is the core basis of energy acquisition and environmental adaptation, and in-depth study of this pathway is of great significance to understand its extreme environmental survival strategy.Current research on the sulfur metabolism mechanism of this bacterium mainly focuses on the terminal oxidation stage, however, the efficiency of the initial activation step of sulfide directly determines the input flux and energy distribution efficiency of the electron transport chain.This key initial reaction not only affects the overall metabolic flow of the subsequent sulfur oxidation pathway, but also is closely related to the intracellular redox homeostasis and toxicity alleviation of intermediate products.

[0004] Sulfide quinone oxidoreductase (SQR) is an ancient riboflavin protein, which mainly functions to oxidize sulfide to elemental sulfur and transfer electrons to quinone to complete the respiratory chain.To maintain the efficient operation of sulfur metabolism, A. caldus Sulfide:quinone oxidoreductase encoded by SQR gene as the initial entrance of the electron transport chain, its activity directly determines the flux efficiency of the entire sulfur oxidation pathway.In A. caldus , there is no report on the construction of SQR gene knockout and overexpression strains by CRISPR-Cas9 system to analyze the sulfur metabolism regulation network, and there is also a lack of research on enhancing the adaptability of the strain to extreme environment by using SQR gene edited strain. SUMMARY

[0005] To further understand the sulfur metabolism regulation mechanism in A. A. caldus , a new CRISPR-Cas9 gene editing system is developed, based on which the key gene SQR of sulfur oxidation is selected as the research object, and SQR gene knockout strain and overexpression strain are successfully constructed, and the sulfur oxidation rate of the overexpression strain is significantly improved, showing strong environmental adaptability.

[0006] The present application is realized by the following technical solutions: The first object of the present application is to provide an extreme acidophilic engineered bacterium with improved sulfur metabolism, which overexpresses sulfide:quinone oxidoreductase SQR, and the expression of the sulfide:quinone oxidoreductase SQR is initiated by a promoter Amp.

[0007] In an embodiment of the present application, the nucleotide sequence of the gene encoding the sulfide:quinone oxidoreductase SQR is shown in SEQ ID NO. 1.

[0008] In an embodiment of the present application, the amino acid sequence of the sulfide:quinone oxidoreductase SQR is shown in SEQ ID NO. 2.

[0009] In an embodiment of the present application, the nucleotide sequence of the promoter Amp is shown in SEQ ID NO. 3.

[0010] In an embodiment of the present application, the extreme acidophilic engineered bacterium uses pJRD215 as an overexpression vector.

[0011] In an embodiment of the present application, the host of the extreme acidophilic engineered bacterium is Acidithiobacillus ferrooxidans A. A. caldus MTH04.

[0012] The second object of the present application is to provide a preparation method of the extreme acidophilic engineered bacterium, which comprises the following steps: connecting the gene encoding sulfide:quinone oxidoreductase SQR and the gene encoding promoter Amp into a plasmid, transferring the plasmid into E. coli competence, and then transferring the plasmid into the host of Acidithiobacillus ferrooxidans by conjugation transfer to obtain the extreme acidophilic engineered bacterium.

[0013] In an embodiment of the present application, the conjugation transfer method is as follows: caldus SM10 (pJRD215-SQR) is conjugated with E. coli MTH04 is adjusted to OD 600 The same is mixed according to 1:2 and coated on a solid conjugation medium covered with a filter membrane of 0.45 μm, and then incubated at 37 ℃ for 2-3 days; the filter membrane is washed with an inorganic salt solution, and 10 -3 , 10 -4 , 10 -5 Gradient dilution; respectively coated on a resistant Starky-Na2S2O3 solid medium, and then incubated at 37 ℃ for 7 days; single colonies are selected from the solid plate, inoculated into 20 mL of Starky-S 0 medium, and then incubated for 3-5 days, followed by colony PCR verification and sequencing.

[0014] A third objective of this invention is to provide a method for improving the tolerance of *Thiobacillus acidophilus* to sulfur-oxidized acid stress, wherein the method involves overexpressing sulfide quinone oxidoreductase SQR with the promoter Amp in a *Thiobacillus acidophilus* host.

[0015] In one embodiment of the present invention, the amino acid sequence of the sulfide quinone oxidoreductase SQR is shown in SEQ ID NO.2, and the nucleotide sequence of the promoter Amp is shown in SEQ ID NO.3.

[0016] A fourth objective of this invention is to provide the application of the aforementioned extreme acidophilic engineered bacteria in biological desulfurization.

[0017] In this invention, the sulfur metabolism capacity of the extreme acidophilic engineered bacteria includes, under different pH conditions A. caldus The G-SQR strain showed higher growth rates than the wild type. A. caldus- Strain M exhibited a higher maximum specific growth rate than the wild-type strain at pH 2.0, but a higher maximum specific growth rate at pH 1.5. Under culture conditions of pH 2.0 and pH 1.5, A. caldus -G-SQR strain maximum cell concentration compared to wild type A. caldus Compared with the previous strain, the increase was 2.4 × 10⁻⁶. 7 cell·mL -1 and 1.8×10 7 cell·mL -1 .

[0018] Furthermore, under different pH conditions A. caldus The sulfate production concentration of the G-SQR strain was higher than that of the wild type. A. A. caldus Strains. Under culture conditions of pH 2.0, pH 1.5, pH 1.0, and pH 0.8, caldus -G-SQR strain maximum sulfate concentration compared to wild type A. caldus Compared with the previous strain, the increase was 4.9 × 10⁻⁶. 7 cell·mL -1 0.8×10 7 cell·mL -1 1.2×10 7 cell·mL -1 and 0.7×10 7 cell·mL -1 Increased sulfate production capacity indicates enhanced sulfur oxidation ability, generating more energy and promoting bacterial growth.

[0019] Furthermore, under different pH conditions A. caldus The intracellular ATP concentration of the G-SQR strain was higher than that of the wild type.A. A. caldus Strains. Under culture conditions of pH 2.0, pH 1.5, pH 1.0, and pH 0.8, caldus Intracellular ATP production concentration of G-SQR strain compared to wild type A. caldus Compared with the strain, the increases were 465 nM, 256 nM, 34 nM and 45 nM, respectively.

[0020] Furthermore, under different pH conditions A. caldus The intracellular reactive sulfide concentration of the G-SQR strain was higher than that of the wild type. A. A. caldus Strains. Under culture conditions of pH 2.0, pH 1.5, pH 1.0, and pH 0.8, caldus Intracellular reactive sulfide concentration in G-SQR strain compared to wild type A. caldus Compared with the strain, the increase was 48 nM × 10⁻⁶. 8 cells⁻¹、18 nM×10 8 cells⁻¹、50 nM×10 8 cells⁻¹ and 741 nM×10 8 Cells⁻¹. Increased concentration of reactive sulfides helps cells resist oxidative stress caused by acid stress and buffers the acidification process.

[0021] The beneficial effects of this invention are: This invention is based on conjugation transfer overexpression A. caldus The autologous sulfide-quinone oxidoreductase SQR gene was extracted and expressed using the promoter Amp to construct an extreme acidophilic engineered bacterium. Acidithiobacillus caldus -G-SQR, which is similar to the wild type A. caldus Compared to the previous strain, acid stress tolerance, sulfur oxidation capacity, and intracellular ATP production capacity were all improved. This fully verifies the core role of SQR in the strain's environmental adaptation and metabolic regulation. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] A. caldus Phylogenetic analysis of the protein encoded by F0726_RS13095 in Example 1.

[0024] Figure 1 As in Example 1Figure 2 Alignment of amino acid sequences of MTH04 F0726 RS13095 encoded protein with homologous sequences.

[0025] A. caldus Overexpression strain promoter strength verification for Example 1 Figure 3 Schematic diagram of MTH04 sulfur metabolism pathway.

[0026] A. caldus Overexpression strain promoter strength verification for Example 2

[0027] Figure 4 Schematic diagram of conjugative transfer construction of SQR overexpression strain of Acidithiobacillus ferrooxidans for Example 2.

[0028] Figure 5 PCR verification of SQR overexpression strain of Acidithiobacillus ferrooxidans for Example 2.

[0029] Figure 6 Schematic diagram of construction of base knockout plasmid for Example 3. Figure 7 PCR verification of base knockout plasmid for Example 3. Figure 8 Schematic diagram of conjugative transfer construction of Acidithiobacillus ferrooxidans knockout strain for Example 3.

[0030] Figure 9 PCR verification of Acidithiobacillus ferrooxidans knockout strain for Example 3. Figure 10 Overexpression strain for Example 4 Figure 11 M, A. caldus -G-SQR and A. caldus -Q-SQR three strains under different acid stress conditions. Among them, (A) is the growth curve; (B) is the specific growth rate curve.

[0031] A. caldus Sulfur oxidation capacity of M, Figure 12 M, A. caldus -G-SQR and A. caldus -Q-SQR three strains under different acid stress conditions.

[0032] A. caldus Intracellular sulfane sulfur concentration of M, Figure 13 M, A. caldus -G-SQR and A. caldus -Q-SQR three strains under different acid stress conditions.

[0033] A. caldus Sulfur oxidation capacity of M, Figure 14 M, A. caldus -G-SQR and A. caldusChanges in intracellular ATP concentration of three strains -Q-SQR under different acid stress conditions. Detailed Implementation

[0034] The present invention will be further illustrated below with specific examples. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, after reading the teachings of this invention, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined by the appended claims.

[0035] The culture media involved in the following examples are as follows: LB liquid medium: yeast extract 5 g·L -1 10 g / L of peptone -1 NaCl 10 g·L -1 ; LB solid medium: yeast extract 5 g·L -1 10 g / L of peptone -1 NaCl 10 g·L -1 20 g·L agar powder -1 ; Starky-S 0 Liquid culture medium: CaCl2·2H2O 0.25 g / L, (NH4)SO4 2 g / L, KH2PO4 3 g / L, MgSO4·7H2O 0.5 g / L, FeSO4·7H2O 0.01 g / L. Adjust the pH of the medium to 2.5-3.5 with concentrated sulfuric acid, then autoclave at 115℃ for 30 min. Before use, sterilize the sulfur powder under UV light for 30 min, adding 1 g of sulfur powder per 100 mL of medium.

[0036] Starky-Na₂S₂O₃ conjugation transfer solid medium: Solution A: CaCl₂·2H₂O 0.5 g / L, (NH₄)SO₄ 6 g / L, KH₂PO₄ 6 g / L, MgSO₄·7H₂O 1 g / L, 0.05% (w / v) yeast extract, pH adjusted to 4.5-5.0 with concentrated sulfuric acid, autoclaved at 121℃ for 20 min; Solution B: 2% (w / v) agar powder, with an appropriate volume of distilled water added, autoclaved at 121℃ for 20 min; Solution C: Na₂S₂O₃·5H₂O 200 g / L, FeSO₄·7H₂O 0.6 g / L, dissolved in distilled water, filtered for sterilization. Solutions A and B are cooled to approximately 60℃ and mixed, then 5% (w / v) solution C is added and mixed thoroughly to prepare solid plates.

[0037] Starky-Na2S2O3 solid medium: A liquid: CaCl2·2H2O 0.5 g / L, (NH4)SO4 6 g / L, KH2PO4 6 g / L, MgSO4·7H2O 1 g / L, adjust pH to 4.5-5.0 with concentrated sulfuric acid, 121°C high temperature and high pressure sterilization for 20 min; B liquid: 2% (w / v) agar powder, add the corresponding volume of distilled water, 121°C high temperature and high pressure sterilization for 20 min; C liquid: Na2S2O3·5H2O 200 g / L, FeSO4·7H2O 0.6 g / L, dissolved in distilled water, filtered to remove bacteria. Mix A and B liquids when cooled to about 60°C, then add 5% (w / v) C liquid and mix well to prepare solid plates.

[0038] Starky-Na2S2O3 inorganic salt: Mix solid medium A liquid with an equal volume of distilled water.

[0039] In this application, the host A. caldus MTH04 was preserved in the laboratory and disclosed in the non-patent literature "Transcriptional regulatory factor EpsR mediates adaptation mechanism of extremophile A. caldus to copper stress environment and performance in bioleaching of low-grade copper ore by enhancing "contact" mechanism", https: / / doi.org / 10.1016 / j.jhazmat.2025.139473.

[0040] The technical solutions of the present application will be described in detail below in conjunction with specific examples. In the following examples, unless otherwise specified, the reagents, materials and equipment used can be purchased from commercial channels, or prepared by conventional methods, or commonly used in the industry.

[0041] Example 1: Acidithiobacillus caldus Source SQR gene bioinformatics analysis (1) Homologous sequence alignment of F0726_RS13095 encoded protein A. caldus F0726_RS13095 is annotated as FAD / NAD(P)-binding oxidoreductase in the middle, and the gene sequence is shown as SEQ ID NO. 1. By analyzing the homologous sequence of SQR through NCBI BLASTP, a neighbor-joining phylogenetic tree of SQR homologous genes was constructed using MEGA 11 software. The tree is shown in Figure 1.A. caldus It can be seen that F0726 RS13095 belongs to the SQR enzyme family.

[0042] SQR (SEQ ID NO. 1): (2) Amino acid sequence alignment Figure 1 The amino acid sequence of F0726 RS13095 encoding protein from the source is shown as SEQ ID NO. 2, and homologous protein sequence alignment is performed on the SQR protein of other typical strains using Jalview software, and the alignment result is shown as A. caldus

[0043] SQR (SEQ ID NO. 2) MAHVVILGAGTGGMPAAYEMKDALGKDHEVTLISANDYFQFVPSNPWLGVGWSKREDITFPIRPYVERKGIHFIPQRAEKIDAEKQEIQLADGSSVHYDYLLIATGPKLAFENVPGSDPHEGPVQSVCTADHAEMAYGKYQELLDNPGPIVIGAMPGASCFGPAYEYAMIVASDLKKRGMRDKIPSFSFVTSEPYIGHLGIQGVGDSRGILTRGLEEEGITAYTNCKVTKVENGQMYITQVNDQGETVKEFTLPVKFGMMIPAFKGVPAVAGVEGLCNPGGFVLVDENQRSKKYPNIYAAGIAIAIPPVEQTPVPTGAPKTGYMIESMVSAAVHNIKADIEGRKGERTMGTWNAVCFADMGDRGAAFVALPQLKPRKVDVFAYGRWVHLAKVAFEKYFIRKMKMGVSEPFYEKVLFKMMGITRLKEEPMEQRKAS Example 2: Construction of SQR overexpression strain based on conjugation transfer technology (1) Screening of overexpression strain promoter The nucleotide sequences of the promoters used are shown as SEQ ID NO. 3-4. The plasmid pET-28a is linearized by reverse amplification of primers 28a-F and 28a-R. The gene fragment is obtained by amplification from the genome by primers SQR-R and SQR-F. The linearized vector and the fragment are connected by homologous recombination, and the promoters are replaced by Amp and tac respectively to construct recombinant plasmids 28aA-SQR and 28aT-SQR. Figure 2 A. caldus

[0044] ​​​The recombinant correct colonies were picked to LB medium for overnight culture at 37℃, and the bacterial liquid was transferred to TB medium, and 0.4 mM IPTG was used to induce the overexpression of SQR protein at 16℃ for 20 h. 50 mL of bacterial liquid was ultrasonically broken for 30 min, and a hammer was added to the lysis solution. The broken mixture was centrifuged at low speed for 1 h, and the supernatant was collected and filtered through a 0.22 μm filter. A small amount of supernatant was taken for SDS-PAGE analysis verification, and the results are shown in SQR Lane 1 is the 28aT-SQR broken supernatant sample, and lane 2 is the 28aA-SQR broken supernatant sample. At the position of the target protein 47.7 kDa, the 28aT-SQR breaking effect is better, and the tac promoter is preferentially selected as an element in the overexpression plasmid. However, the success rate is low in the subsequent construction of the overexpression plasmid, and the conjugation transfer effect is not good. In comparison, the Amp promoter is used as an element in the overexpression plasmid to construct the plasmid and the conjugation transfer efficiency is higher, so the Amp promoter is selected as an element in the overexpression plasmid in the subsequent process.

[0045] P Amp (SEQ ID NO. 3) CGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGT P tac (SEQ ID NO. 4) TTGACAATTAATCATCGGCTCGTATAATGTTTCACCTTATCATCAAGAT The primer sequences involved are as follows: SQR-R: CGAGTGCGGCCGCAATCAGGAGGCCTTGCGCTG SQR-F: GGTCGCGGATCCGAATTCGATGGCACACGTGGTGATTCTG 28a-F: TTGCGGCCGCACTCGAG 28a-R: CGAATTCGGATCCGCGACC (2) The construction of pJRD215G-SQR recombinant plasmid and the construction of overexpression strain are shown in the experimental process as Figure 4 shown.

[0046] Amp promoter was used. The broad host shuttle plasmid pJRD215 with streptomycin resistance was linearized by reverse amplification of the plasmid pJRD215 with primers pJRD215G-SQR-F and pJRD215G-SQR-R. Figure 5 The SQR gene fragment was amplified from the genome. The linearized vector and the fragment were connected by homologous recombination to construct the recombinant plasmid pJRD215G-SQR.

[0047] The super-competent cells were prepared according to the instructions of the super-competent cell preparation kit (Shanghai Biomed; B529303-0200). E. A. caldus The SM10 was transformed into the competent cells. The competent cells were thawed on ice, and 10 μL of the above-mentioned recombinant plasmid pJRD215-SQR was added. The cells were heat-shocked at 42 ℃ in a water bath for 60 s, and then immediately placed in an ice bath for 3 min. Subsequently, 900 μL of liquid LB medium was added, and the cells were cultured at 37 ℃ on a shaking table for 1 h. Part of the bacterial solution was spread on solid LB medium and cultured overnight. Single colonies on the plate were selected for colony PCR verification and sequencing. The primer sequences involved are as follows: pJRD215G-SQR-F: GCGCAAGGCCTCCTGACTAGACCTAGGCCTTAAGAT pJRD215G-SQR-R: AAACAAATAGGGGTTCCGCGCTAGAGTCTTTGTTTTGACGCC GSQR-R: AATATTGAAAAAGGAAGAGTATGGCACACGTGGTGATTCTG GSQR-F: AAGGCCTAGGTCTAGTCAGGAGGCCTTGCGCT (3) The verified successful coli SM10 was conjugated and transferred to E. coli MTH04, and spread on Starky-Na2S2O3 solid medium. Single bacterial bodies were selected for culture, and plasmids were extracted.

[0048] (4) The recombinant plasmid obtained in step (3) was verified by PCR. The primers used were pJRD215G-JP-F and pJRD215G-JP-R.

[0049] The primer sequences involved are as follows: pJRD215G-JP-F: CATCGCATACTCGTAGGCCGG pJRD215G-JP-R: GAAGCGCGAATATAGAGAAATATCCCGAATG (5) Positive transformants were obtained by nucleic acid electrophoresis, and the results are shown in A. caldus Figure 3, which are of correct size. Therefore, after sequencing correctly, it was named Figure 6 pJRD215G-SQR, abbreviated as A. caldus- G-SQR.

[0050] (6) MTH04 was used as a control group and named A. caldus- MTH04, abbreviated as A. caldus M, for subsequent experiments. A. caldus

[0051] Example 3: Construction of SQR knockout strain based on conjugation transfer technology (1) sgRNA prediction According to Cas-Designer, the potential sgRNA target of SQR was designed, and the sequence with higher score was selected as sgRNA, which is shown in SEQ ID NO. 5.

[0052] sgRNA (SEQ ID NO. 5) GTTCCTTCCAACCCCTGGCTGGG (2) Construction of pJRD215Q basic plasmid, the experimental process is shown in A. caldus .

[0053] The promoter and terminator nucleotide sequences used are shown in SEQ ID NO. 6-7. The broad-spectrum shuttle plasmid pJRD215 with streptomycin resistance was selected, and the plasmid pJRD215 was amplified in reverse by primers pJRD215Q-SQR-F and pJRD215Q-SQR-R to linearize it. The Cas gene fragment was amplified from the pCas plasmid by primers cas-R and cas-F. The T7 gene fragment was amplified from the pT7 synthesis plasmid by primers T7-F and T7-R. The linearized vector and fragments were connected by homologous recombination to construct the recombinant plasmid pJRD215Q.

[0054] P tac (SEQ ID NO. 6) TTGACAATTAATCATCGGCTCGTATAATG T T7te (SEQ ID NO. 7) GGCTCACCTTCGGGTGGGCCTTTCTGCG The primer sequences involved are as follows: ​pJRD215Q-SQR-F: ATACGAGCCGATGATTAATTGTCAAAGCTTTAATGCGGTAGTT pJRD215Q-SQR-R: CTAGACCTAGGCCTTAAGATCATATGCA cas-R: GGCCGCAAGCTTTTGCAGGTTCAGTCACCTCCTAGCTGACTCAA cas-F: CGGCTCGTATAATGTTTCACCTTATCATCAAGATATGGATAAGAAATACTC T7-F: ACCTGCAAAAGCTTGCGGC T7-R: ATCTTAAGGCCTAGGTCTAGCTGAAGTTAACAAGTAAGCTTCCTAGGT (2) Construction of knockout strain: According to the super-competent cell preparation kit (Shanghai Biotech; B529303-0200) instructions to prepare E. Figure 7 SM10 transformed competent cells. The competent cells were thawed on ice, and 10 μL of the recombinant plasmid pJRD215-SQR prepared in step (1) was added, and the water bath was heated at 42 ℃ for 60 s, and then immediately ice-bathed for 3 min. Then add 900 μL of liquid LB medium, 37 ℃ shaking bed culture 1 h. Take part of the bacterial liquid spread on solid LB medium, overnight culture, select single colony on the plate for colony PCR verification and sequencing.

[0055] (3) The recombinant plasmid obtained in step (2) was verified by PCR, and the primers used were pJRD215Q-JP-F and pJRD215Q-JP-R.

[0056] The primer sequences involved are as follows: pJRD215Q-JP-F: ACGGTAGCTTATTCAGTCCTAGTGGT pJRD215Q-JP-R: CATCGGCAGTTCTTCGAACAGTG (4) Positive transformants were obtained by nucleic acid electrophoresis, and the results are shown in coli , which are correct in size.

[0057] (5) Construction of pJRD215Q-SQR recombinant plasmid, the experimental process is shown in Figure 8 .

[0058] The plasmid pJRD215G was linearized by reverse amplification with primers cas-R2 and T7-F. The sgRNA fragment was amplified from the psg synthesis plasmid with primers sg-F and sg-R. The upstream and downstream homologous arms of the gene fragment were amplified from the genome with primers U-F and U-R, and D-F and D-R, respectively. Figure 9 A. caldus The linearized vector and the fragment were connected by homologous recombination to construct the recombinant plasmid pJRD215Q-SQR.

[0059] The primer sequences involved are as follows: cas-R2: TCAGTCACCTCCTAGCTGACTCAA sg-F: GTCAGCTAGGAGGTGACTGACTCGAGTAAGGATCTCCAGGCA sg-R: CGCCCGGACTAGCCTACAGA U-F: GCTAGTCCGGGCGAATTCGTTCCCGCTACAACCC U-R: GTACAGCGACCAGTGCCTGTCATGCTCCTCAAAGCGTCG D-F: GACGCTTTGAGGAGCATGACAGGCACTGGTCGCTGTACCC D-R: GGCCGCAAGCTTTTGCAGGTGAGGACACGCACGGCATAGAC (6) The recombinant plasmid obtained in step (5) was verified by PCR, and primers D-F and pJRD215Q-JP-R were used.

[0060] (7) The verified recombinant plasmid was conjugated and transferred to SM10 and MTH04, and plated on Starky-Na2S2O3 solid medium. Single bacterial bodies were selected for culture, and plasmids were extracted. SQR E. coli (8) Positive transformants were obtained by nucleic acid electrophoresis, and the results are shown in

[0061] (8) Positive transformants were obtained by nucleic acid electrophoresis, and the results are shown in A. caldus . Therefore, after sequencing, it was named Figure 10 pJRD215Q-SQR, abbreviated as A. caldus- Q-SQR.

[0062] Example 4: A. caldus- M, A. caldus -G-SQR and A. caldus -Q-SQR three strains of bacteria under acid stress conditions ​​The extreme acidophilic recombinant strains prepared in Examples 2 and 3 were used. A. caldus -G-SQR and A. caldus -Q-SQR, and A. caldus M is used for subsequent experiments.

[0063] (1) Culture conditions: Set up a gradient culture condition with pH values ​​of 2.0, 1.5, 1.0 and 0.8, and take samples once every two days.

[0064] (2) Nucleic acid method was used for determination. A. caldus The bacterial cell concentration. The specific steps are as follows: Centrifuge 1 mL of culture medium at 3000 rpm for 30 s to remove sulfur powder. Mix the supernatant with 5% trichloroacetic acid at a 1:1 ratio, incubate at 80 ℃ in a metal bath for 25 min, then immediately cool in an ice bath. Use 5% trichloroacetic acid as a blank control and determine the OD value of the sample. 260 The absorbance value at the specified point was then used to calculate the cell concentration according to the standard curve.

[0065] A. caldus -G-SQR, A. caldus -Q-SQR and A. caldus M growth curve and specific growth curve as follows A. caldus As shown in the figure. This study set initial pH values ​​of 2.0, 1.5, 1.0, and 0.8 for acid stress culture. The results showed that the biomass of all three strains decreased with decreasing pH, reaching a minimum at pH 2.0. Figure 11 -G-SQR, A. caldus -Q-SQR and A. caldus The maximum cell concentration of strain M was 3.44 × 10⁻⁶. 8 cell·mL -1 3.19×10 8 cell·mL -1 2.72×10 8 cell·mL -1 The maximum specific growth rate was 0.44 d. -1 0.46 d -1 0.36 d -1 , A. caldus -G-SQR strain and A. caldus Compared to strain M, the time to reach the maximum specific growth rate was 0.87 days earlier. A. caldus -Q-SQR strain and A. caldus Compared to strain M, the time to reach the maximum specific growth rate was delayed by 0.51 days. At pH 0.8 A. caldus -G-SQR, A. caldus -Q-SQR and A. caldus The maximum cell concentration of strain M was 0.69 × 10⁻⁶. 8 cell·mL-1 0.59 x 10 8 cell mL -1 0.3 x 10 8 cell mL -1 , the maximum specific growth rates were 0.1 d -1 , 0.09 d -1 , 0.05 d -1 , A. caldus The maximum specific growth rate of the G-SQR strain reached 0.28 days earlier than that of the M strain. A. caldus Example 5:

[0066] M, A. caldus G-SQR and A. caldus Q-SQR strains under acid stress A. caldus The sulfur oxidation of the three strains G-SQR, Q-SQR and M under acid stress was investigated. The initial pH was 2.0, 1.5, 1.0, and 0.8 for acid stress culture, A. caldus G-SQR, A. caldus Q-SQR and A. caldus M strains were as shown in the table. The results showed that under different pH conditions Figure 12 M had lower sulfur oxidation ability than the G-SQR strain, A. caldus Q-SQR had lower sulfur oxidation ability than the M strain. With the decrease of pH, the sulfur oxidation ability gradually decreased. At pH 2.0 A. caldus G-SQR strain, A. caldus G-SQR strain, A. caldus Q-SQR strain, the maximum sulfate concentration was 1.20 g / L, 1.69 g / L, and 1.02 g / L, respectively, at pH 0.8, A. caldus M strain, A. caldus G-SQR strain, A. Q-SQR strain, the maximum sulfate concentration was 0.42 g / L, 0.48 g / L, and 0.41 g / L, respectively. caldus A. caldus Example 6: A. caldus M, A. caldus- G-SQR and Q-SQR strains under acid stress

[0067] The extreme acidophilic recombinant strains G-SQR and Q-SQR prepared in Examples 2 and 3, and M were used for subsequent experiments. A. caldus A. caldus G-SQR and A. caldus Q-SQR strains under acid stress The extreme acidophilic recombinant strains G-SQR and Q-SQR prepared in Examples 2 and 3, and M were used for subsequent experiments. A. caldus A. caldus G-SQR and A. caldus Q-SQR strains under acid stress The extreme acidophilic recombinant strains G-SQR and Q-SQR prepared in Examples 2 and 3, and M were used for subsequent experiments.

[0068] To further investigate the effects of SQR gene overexpression on A. caldus The effects of sulfur metabolism were investigated using high-performance liquid chromatography (HPLC) to analyze the concentration of intracellular reactive sulfides. The steps included: (1) Prepare two 50 mM Tris-HCl buffer solutions at pH 9.5. Add 1% Triton X-100, 50 μM DTPA and 1 mM sulfite to one solution and mix well to obtain the reaction buffer. Add 1% Triton X-100, 50 μM DTPA and 500 μM DTT to the other solution and mix well to obtain the control buffer.

[0069] (2) Add 100 μL of reaction buffer and control buffer to the cell lysate respectively, place the mixture in a 98°C metal bath, and react for 15 min to allow the active sulfide and sulfite to react completely.

[0070] (3) After cooling to room temperature, centrifuge at 12000×g for 3 min, take 50 μL of the supernatant, add 5 μL of 25 mM mBB and react at room temperature in the dark for 30 min, add 110 D acetic acid-acetonitrile mixture to terminate the reaction, centrifuge at 12000×g for 3 min.

[0071] (4) The supernatant was analyzed by high-performance liquid chromatography (HPLC). A C18 reverse-phase column was used, with a fluorescence detector. Excitation was 370 nM, and detection was 485 nM. Mobile phase A: 0.25% acetic acid; Mobile phase B: 100% methanol. Column temperature: 38℃; Flow rate: 0.8 mL / min. Binary gradient elution: 0-1 min 7.5% B solution; 1-15 min 7.5%-52.5% B solution; 15-20 min 55% B solution; 20-31 min 100% B solution. The difference between the thiosulfate content in the sample and the thiosulfate content in the control solution is the content of active sulfides in the sample.

[0072] The results are as follows Figure 13 As shown, the results indicate that the concentration of intracellular reactive sulfides in the strain gradually increases with decreasing pH. Under pH conditions of 2.0, 1.5, 1.0, and 0.8, A. caldus -Intracellular active sulfide concentration in G-SQR strain and A. caldus Compared with the previous strain, the increase was 48.19 nM × 10⁻⁶. 8 cells⁻¹, 18.69 nM×10 8 cells⁻¹、50.02 nM×10 8 cells⁻¹, 17.06 nM×10 8 cells⁻¹. A. caldusintracellular active sulfide concentration of Q-SQR strain compared with A. caldus G-SQR strain and Q-SQR strain were reduced by 14.75 nM x 10 8 cells-1, 82.58 nM x 10 8 cells-1, 81.89 nM x 10 8 cells-1, 521.59 nM x 10 8 cells-1, respectively. The increase of active sulfide concentration helps the cell to resist oxidative stress caused by acid stress and buffer acidification process.

[0073] Example 6: A. caldus M, A. caldus G-SQR and A. caldus Q-SQR strains under acid stress The extreme acidophilic recombinant strains prepared in Examples 2 and 3 were taken A. caldus G-SQR and A. caldus Q-SQR, and A. caldus M, for subsequent experiments.

[0074] Based on the core function of SQR gene in sulfur oxidation and energy metabolism, it is speculated that SQR in Acidithiobacillus ferrooxidans may affect the level of intracellular ATP synthesis by regulating the efficiency of electron transport chain. To further explore the influence of SQR gene expression on energy metabolism, the intracellular ATP concentration of G-SQR and Q-SQR, and M was determined, including the following steps: A. A. caldus Based on the core function of SQR gene in sulfur oxidation and energy metabolism, it is speculated that SQR in Acidithiobacillus ferrooxidans may affect the level of intracellular ATP synthesis by regulating the efficiency of electron transport chain. To further explore the influence of SQR gene expression on energy metabolism, the intracellular ATP concentration of G-SQR and Q-SQR, and M was determined, including the following steps: A. caldus A. caldus A. caldus A. caldus G-SQR and Q-SQR, and M.

[0075] (1) The cells were centrifuged at low speed (367 x g, 3 min) to remove solid particles, and washed once with PBS. 200 μL of lysis solution was added for resuspension. Centrifuged at 12000 rpm for 5 min at 4°C, and the supernatant was taken.

[0076] (2) 100 μL of ATP detection reagent was added to 900 μL of ATP detection reagent diluent to prepare ATP detection working solution. 100 μL of ATP detection working solution was added to the detection hole, and it was placed at room temperature for 3-5 minutes.

[0077] The results are shown in Table 6. Figure 14 ​​As shown, the results showed that the concentration of ATP produced by the three strains gradually decreased with the decrease of pH. Under the growth conditions of pH 2.0, 1.5, 1.0, 0.8, A. caldus The intracellular ATP concentration of G-SQR strain was 464.84 nM, 256.22 nM, 134.09 nM, and 101.28 nM higher than that of G-1, G-2, and G-3 strains, respectively. A. caldus The intracellular ATP concentration of G-SQR strain was 464.84 nM, 256.22 nM, 134.09 nM, and 101.28 nM higher than that of G-1, G-2, and G-3 strains, respectively. A. caldus The intracellular ATP concentration of Q-SQR strain was 391.45 nM, 102.75 nM, 5.83 nM, and 73.35 nM lower than that of Q-1, Q-2, and Q-3 strains, respectively. A. caldus The intracellular ATP concentration of Q-SQR strain was 391.45 nM, 102.75 nM, 5.83 nM, and 73.35 nM lower than that of Q-1, Q-2, and Q-3 strains, respectively.

[0078] The above provided examples are not intended to limit the scope of the present application, and the described steps are not intended to limit the execution order. The improvements of the present application made by those skilled in the art in combination with the existing common knowledge are also within the protection scope defined by the claims of the present application.

Claims

1. An engineered extreme acidophile with improved sulfur metabolism, characterized in that, The extreme acidophilic engineering bacteria overexpress sulfide:quinone oxidoreductase SQR, and the expression of the sulfide:quinone oxidoreductase SQR is started by promoter Amp.

2. The extreme acidophilic engineered bacterium of claim 1, characterized in that, The nucleotide sequence of the coding gene of the sulfide:quinone oxidoreductase SQR is shown as SEQ ID NO.

1.

3. The extremophilic engineered bacterium of claim 1, characterized in that, The amino acid sequence of the sulfide:quinone oxidoreductase SQR is shown as SEQ ID NO.

2.

4. The extremophilic engineered bacterium of claim 1, characterized in that, The nucleotide sequence of the promoter Amp is shown as SEQ ID NO.

3.

5. The extreme acidophilic engineered bacterium of claim 1, wherein, The extreme acidophilic engineering bacteria use pJRD215 as the overexpression vector.

6. The extreme acidophile engineered bacterium of claim 1, wherein, The host of the extreme acidophilic engineered bacteria is Aciduliproficia thermophila A. caldus MTH04.

7. A method for preparing the engineered acidophile of any one of claims 1 to 6, comprising the steps of: a) cultivating the engineered acidophile in a culture medium; and b) recovering the engineered acidophile from the culture medium. 5 The method comprises the following steps: connecting the coding gene of sulfide:quinone oxidoreductase SQR and the coding gene of promoter Amp into a plasmid, transferring the plasmid into E. coli competence, and then transferring the plasmid into the host of Acidithiobacillus caldus by conjugative transfer, so as to prepare the extreme acidophilic engineering bacteria.

8. A method for improving the tolerance of Acidithiobacillus ferrooxidans to sulfur-oxidizing acid stress, characterized in that, The method is to overexpress sulfide:quinone oxidoreductase SQR by promoter Amp in the host of Acidithiobacillus caldus.

9. The method of claim 8, wherein, The amino acid sequence of the sulfide:quinone oxidoreductase SQR is shown as SEQ ID NO. 2, and the nucleotide sequence of the promoter Amp is shown as SEQ ID NO.

3.

10. Application of the extreme acidophilic engineering bacteria according to any one of claims 1-6 in biological desulfurization.

Images